ID: 1035344384

View in Genome Browser
Species Human (GRCh38)
Location 7:158188605-158188627
Sequence CATCAGGGGGCGAGCGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035344384_1035344400 13 Left 1035344384 7:158188605-158188627 CCCGCCACGCTCGCCCCCTGATG 0: 1
1: 0
2: 0
3: 12
4: 242
Right 1035344400 7:158188641-158188663 CGCTCGCCCCCTGATGGGGAAGG 0: 5
1: 4
2: 2
3: 4
4: 59
1035344384_1035344397 8 Left 1035344384 7:158188605-158188627 CCCGCCACGCTCGCCCCCTGATG 0: 1
1: 0
2: 0
3: 12
4: 242
Right 1035344397 7:158188636-158188658 CGCCACGCTCGCCCCCTGATGGG 0: 6
1: 4
2: 5
3: 3
4: 36
1035344384_1035344398 9 Left 1035344384 7:158188605-158188627 CCCGCCACGCTCGCCCCCTGATG 0: 1
1: 0
2: 0
3: 12
4: 242
Right 1035344398 7:158188637-158188659 GCCACGCTCGCCCCCTGATGGGG 0: 6
1: 4
2: 2
3: 9
4: 62
1035344384_1035344396 7 Left 1035344384 7:158188605-158188627 CCCGCCACGCTCGCCCCCTGATG 0: 1
1: 0
2: 0
3: 12
4: 242
Right 1035344396 7:158188635-158188657 CCGCCACGCTCGCCCCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035344384 Original CRISPR CATCAGGGGGCGAGCGTGGC GGG (reversed) Intronic
900305071 1:2001998-2002020 CATCAGGGCCCCAGCGTGGAAGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901602073 1:10430369-10430391 CGCCAGGGGGCGCGCGAGGCAGG + Exonic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903284606 1:22268824-22268846 CAGCAGGAGGCCAGAGTGGCAGG + Intergenic
903326389 1:22571131-22571153 CAGCAGGTGGGGAGCATGGCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904337128 1:29805214-29805236 CAGCAGGGGGCTGGCATGGCGGG + Intergenic
904606880 1:31702863-31702885 CAGCTGGGGGCGGGGGTGGCTGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904826470 1:33276638-33276660 CAGGAGGGGGCGGGCGTAGCGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907516049 1:54994124-54994146 GAGCAGGGGGAGAGAGTGGCAGG - Intergenic
908256716 1:62309128-62309150 CATCAGCGTGCCAGCATGGCTGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909085460 1:71165505-71165527 CATCAGGGGCAGAGCAAGGCAGG - Intergenic
909609038 1:77533864-77533886 CAGCAGAGGGCGAGCTTGGGAGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
916694234 1:167220746-167220768 CGCCAGGGGGCGCGCGAGGCCGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923205691 1:231756970-231756992 CACCAGGGGGCCATGGTGGCAGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1066224449 10:33368625-33368647 CAACAGGGAGCCAGTGTGGCTGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069854776 10:71434064-71434086 CATGAGGAGGCCAGCGTGGCTGG - Intronic
1070872489 10:79768857-79768879 GATCAGGGTGCCAGCGTGGTTGG + Intergenic
1071639411 10:87291009-87291031 GATCAGGGTGCCAGCGTGGTTGG + Intergenic
1071655827 10:87446940-87446962 GATCAGGGTGCCAGCGTGGTTGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073012497 10:100372383-100372405 CACCAGGGGCCGAGTGTGGGTGG - Intergenic
1074872003 10:117584285-117584307 GATCAGGGGGCCAGGGTGGCAGG + Intergenic
1074936269 10:118184629-118184651 AACCAGGAGGCCAGCGTGGCAGG + Intergenic
1076652212 10:131997524-131997546 CATCAGGGGGCGGGCGCTGGAGG + Intergenic
1076812566 10:132896364-132896386 GATCAGGGAGCCAGCGTGGCTGG - Intronic
1077322240 11:1947590-1947612 CCCCAGGGGGCGGGCGTGGCCGG + Intronic
1077332625 11:1990109-1990131 GAGCAGGCGGCGTGCGTGGCGGG - Intergenic
1077537753 11:3132596-3132618 CATAAAGGGGCCAGTGTGGCTGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1080660973 11:34295723-34295745 GATCAGGGTGCCAGCATGGCTGG + Intronic
1081023696 11:37981860-37981882 CAGCAGGAGGTGAGCGTGGGTGG + Intergenic
1084215580 11:67645378-67645400 CAGCTGGGGGCGAGAGAGGCAGG + Exonic
1084284394 11:68121775-68121797 CATCAGAGGCCGGGCCTGGCAGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087718855 11:101639284-101639306 CATAAGGCGGCAAGCCTGGCAGG + Intronic
1089590861 11:119539939-119539961 GATCAGGGTGCCAGCATGGCTGG - Intergenic
1090052131 11:123388811-123388833 GATCAGGGTGCCAGCATGGCTGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1202805258 11_KI270721v1_random:2903-2925 CCCCAGGGGGCGGGCGTGGCCGG + Intergenic
1202815608 11_KI270721v1_random:45285-45307 GAGCAGGCGGCGTGCGTGGCGGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095692743 12:45108731-45108753 GATCAGGGTGCCAGCATGGCTGG - Intergenic
1096683819 12:53274703-53274725 CATGAGGGGGCGGGGTTGGCAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099338511 12:81396486-81396508 CAACAGGAGGCCAGTGTGGCTGG + Intronic
1100632218 12:96400272-96400294 CAGCCGGGCGCGAGCGCGGCGGG + Exonic
1101769745 12:107738060-107738082 GATCAGGGTGCCAGCCTGGCTGG + Intronic
1102718623 12:114996901-114996923 CATCAGGGGGCCAGCATAGTTGG + Intergenic
1103162795 12:118744088-118744110 CATGAGGAGGCCAGTGTGGCAGG + Intergenic
1104088949 12:125498581-125498603 CACCAGGGGACCAGCCTGGCTGG - Intronic
1104307308 12:127621438-127621460 CACCAGGGGCTGAGCATGGCAGG - Intergenic
1104532601 12:129586505-129586527 GATCAGGGTGCCAGCGTGGTCGG + Intronic
1112362049 13:98727304-98727326 AATCATGGGGTGAGCCTGGCAGG - Intronic
1113922672 13:113922663-113922685 CATCAGGGTGCCAGCATGGCTGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1121482942 14:94292349-94292371 AGTCAGGGTGCCAGCGTGGCCGG - Intronic
1121946146 14:98124345-98124367 GATCAGGGTGCTAGCCTGGCTGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122779076 14:104136108-104136130 CGTCTGGGGGCTAGCGAGGCAGG + Intergenic
1122802247 14:104237579-104237601 AGTCAGGAGGCGAGCTTGGCAGG - Intergenic
1123097546 14:105773628-105773650 CATCAGAAGGTGAGCATGGCTGG - Intergenic
1123101476 14:105804833-105804855 AATCTGGGTGCCAGCGTGGCTGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128181960 15:65612096-65612118 CACCAGGTGGCCAGAGTGGCAGG - Intronic
1130644328 15:85710425-85710447 CAATTGGGGGCGACCGTGGCTGG + Intronic
1130996746 15:88908409-88908431 CTTCAGGGTGTGAGCGTGGTGGG - Intronic
1132247528 15:100309252-100309274 CATGTGGGGGCGAGTGTGGGAGG + Intronic
1132348441 15:101122395-101122417 AGTCAGGGAGCGAGAGTGGCGGG + Intergenic
1132714413 16:1283690-1283712 GGTCAGGGAGCCAGCGTGGCTGG + Intergenic
1133747975 16:8701896-8701918 CACGAGGGGGCCAGTGTGGCTGG + Intronic
1133843746 16:9435450-9435472 CATCAGAAGGTGAGCATGGCTGG + Intergenic
1134297194 16:12957403-12957425 GATCAGGGTGCCAGCGTGGTTGG + Intronic
1135552345 16:23408139-23408161 AGGCAGGGGGCGAGTGTGGCGGG + Intronic
1135552353 16:23408162-23408184 AGGCAGGGGGCGAGTGTGGCGGG + Intronic
1135552361 16:23408185-23408207 AGGCAGGGGGCGAGTGTGGCGGG + Intronic
1135552369 16:23408208-23408230 AGGCAGGGGGCGAGTGTGGCGGG + Intronic
1135552377 16:23408231-23408253 AGGCAGGGGGCGAGTGTGGCGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137280548 16:46973274-46973296 CATCTGCGGGCGGGCGGGGCCGG + Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143973922 17:10816180-10816202 GATCAGGGAGCCAGCTTGGCTGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1149735026 17:58986161-58986183 CAACAGGGGGCGGGTGTGGGGGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1158485003 18:57858301-57858323 CATCAAGGTGCCAGCGTGACTGG - Intergenic
1160481809 18:79246687-79246709 CAGCAGGGGGAGCGCGAGGCCGG - Intronic
1160732274 19:646712-646734 CCTCTGGGGTCGTGCGTGGCGGG - Intergenic
1160732288 19:646751-646773 CCTCTGGGGTCGCGCGTGGCGGG - Intergenic
1162094013 19:8299900-8299922 CATCTGGGGGCCAGGCTGGCTGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1165428165 19:35756848-35756870 TAGTAGGGGGCGAGCGTGGTGGG + Exonic
1166105553 19:40596530-40596552 GATCAGGGGCAGAGCCTGGCTGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166390994 19:42408875-42408897 AGTCAGGGGGCCAGTGTGGCTGG + Intronic
1167523863 19:49972042-49972064 CAGCGGGTGCCGAGCGTGGCAGG - Intergenic
1167743610 19:51338916-51338938 CACCAGGTGGCGAGCAAGGCAGG + Exonic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168302025 19:55410567-55410589 CATTAGGAGGCCAGCGAGGCTGG + Intergenic
925133773 2:1512525-1512547 CAGCAGGGGCGGAGCGGGGCAGG - Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925532828 2:4883652-4883674 CAGCAGGGGGCCAGCATGGCCGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928053547 2:28027126-28027148 CAGCAGGGTGCCAGTGTGGCTGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929094578 2:38251291-38251313 CATAAGGAGGCTAGCGTGACAGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931309619 2:61065950-61065972 CTTCAGGGCGCGAGCGCGGGCGG + Exonic
931939804 2:67239645-67239667 GATCAGGGTGCTAGCATGGCAGG - Intergenic
932368781 2:71170660-71170682 GATCAGGGTGCCAGCATGGCTGG + Intergenic
934860980 2:97763427-97763449 CATCAAGGGGTGAGAGTGGGCGG - Intronic
935413176 2:102787286-102787308 GATCAGGGTGCCAGCATGGCTGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936518494 2:113197564-113197586 CGCCATGGGGCAAGCGTGGCTGG + Exonic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941456763 2:165718412-165718434 GATCAGGGTGCCAGCGTGGTTGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948446212 2:238035186-238035208 AATCAGGGGGCTTGCCTGGCTGG - Intronic
949027992 2:241775199-241775221 CAGCAGGGGGTGAAGGTGGCTGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1172457889 20:35092398-35092420 TGTCAGGGGCCGAGCGGGGCTGG - Intronic
1173923095 20:46760579-46760601 CCCCAGGGGGCGAGCCTGGGTGG + Intergenic
1174378723 20:50142918-50142940 AGTCAGGGGGCCAGCGTGGCAGG + Intronic
1174575018 20:51531164-51531186 CAGCTGGGGGCGAGCCTGCCTGG - Intronic
1175294618 20:57899892-57899914 GATCAGGGTGCCAGCGTGGCAGG + Intergenic
1179472209 21:41618823-41618845 GATCAGGGTGCCAGCGTGGTTGG - Intergenic
1180021359 21:45129737-45129759 CACCAGGGCGTGAGCGTGGATGG + Intronic
1181140231 22:20799137-20799159 CATCGAGGGGGGAGGGTGGCTGG + Exonic
1181500395 22:23312628-23312650 CAGGAGGAGGCCAGCGTGGCAGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183478937 22:38052406-38052428 CAGCAGGTGGCGACAGTGGCAGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
950153740 3:10707689-10707711 CACCAGGCGGCGGGCGGGGCGGG - Intronic
953376164 3:42430254-42430276 GATCAGGGGACCAGCGTGGTTGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954454877 3:50592428-50592450 AATCAGGGAGGGAGGGTGGCAGG - Intergenic
955768487 3:62368653-62368675 ATTGAGGGGGCGAGTGTGGCTGG - Intergenic
957344488 3:78944443-78944465 CATCAGGGTGCAGGCATGGCTGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960878124 3:122316758-122316780 CTTTAGGGGGCCAGAGTGGCAGG - Intergenic
961647776 3:128401529-128401551 CATCAGAGTGTGAGCATGGCAGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968483946 4:849811-849833 CATGCGGGGGCGGGCGGGGCAGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968599574 4:1502615-1502637 CATCAGGGTGTGAGCCTGCCTGG + Intergenic
970026514 4:11629823-11629845 CAGCAAGGGGCCAGTGTGGCTGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970421071 4:15906101-15906123 CATCAGGCGGCGGGCGGGCCCGG + Intergenic
972295618 4:37735100-37735122 GATCAGGGGGCCAGCATGGCTGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972960476 4:44447516-44447538 CAGCAGGGGGCGAGGGGTGCTGG + Intronic
974065805 4:57076075-57076097 GATCAGGGTGCGAGCATGGTAGG + Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977246155 4:94634005-94634027 AATCAGGGGGCCAGCATGTCTGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
986436276 5:7734851-7734873 CATCAGGGTGCCAGCATGGGTGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990532347 5:56687055-56687077 CATGAGGGAGCGTGCTTGGCTGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
994052684 5:95380594-95380616 CATAAGGGGGCCACCATGGCTGG + Intergenic
994243568 5:97452112-97452134 CATCAGGGTGCCAGCATGGCTGG + Intergenic
995369419 5:111402159-111402181 CATGAGGGAGAGAGAGTGGCAGG - Intronic
998130325 5:139648508-139648530 CAGCAGGCGGCGCGCATGGCTGG - Exonic
1004281032 6:14280181-14280203 GATCAGGGTGCCAGCATGGCTGG + Intergenic
1006985585 6:38173448-38173470 CATCAGAGGGCTACCGGGGCAGG - Exonic
1007337398 6:41163348-41163370 CATCTGGGGGCCACCCTGGCTGG - Intergenic
1007787519 6:44289678-44289700 CAGCAGTGGGCAAGCGTGGGAGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009814206 6:68710130-68710152 CATCAGGGGGCTACAGAGGCTGG + Intronic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1016000531 6:139036738-139036760 CATCAGGGGGCCAAGGTGGGAGG + Intronic
1016947258 6:149546357-149546379 CACCAGGGGGCGCCCGCGGCGGG + Intergenic
1017855083 6:158343626-158343648 GATCAGGGGGCCAGCATGGTGGG - Intronic
1018759079 6:166874439-166874461 CAGCAGGGGGTGAACGTGGCTGG + Intronic
1018888850 6:167966125-167966147 CATCGGAGGCCGGGCGTGGCTGG - Intronic
1018998650 6:168729198-168729220 CACCAGAGGCTGAGCGTGGCAGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019562446 7:1665506-1665528 GGGCAGGGGGCGAGCGGGGCGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020140097 7:5607182-5607204 CCTCAGGGGGCGGCCGTGGTAGG + Intergenic
1020433752 7:8140308-8140330 CATGAGGGGGAGCGAGTGGCAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022664668 7:32399420-32399442 CATCAGGGTGCTAGCATGGTTGG + Intergenic
1022668338 7:32431719-32431741 GATCAGGGTGCCAGCATGGCTGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026944341 7:74306467-74306489 CATCCTGGGGCGAGGGAGGCAGG - Intronic
1033138891 7:138807827-138807849 GATCAGGGTGCCAGCATGGCTGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035344384 7:158188605-158188627 CATCAGGGGGCGAGCGTGGCGGG - Intronic
1036148986 8:6280751-6280773 AATCAGGGCGCTAGCATGGCTGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1044858048 8:96495197-96495219 CCAGAGAGGGCGAGCGTGGCGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048327729 8:133451982-133452004 GATCAGGGAGCCAGCGTGGTGGG + Intergenic
1049398528 8:142413055-142413077 CCTCAGGGGGAGGGCGGGGCTGG + Intergenic
1049553146 8:143269947-143269969 CATCAGGGGTGGAGCAAGGCTGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1052765260 9:32634219-32634241 CCTCAGGGTGCAAGCCTGGCAGG - Exonic
1053583823 9:39435836-39435858 CATGAGGGGTGGAGCATGGCGGG - Intergenic
1054105404 9:60994580-60994602 CATGAGGGGTGGAGCATGGCGGG - Intergenic
1059387794 9:113978413-113978435 CATCAGGGAGAGAGAGAGGCAGG + Intronic
1059393125 9:114012271-114012293 GATCAGGGTGCCAGCATGGCGGG + Intronic
1061148979 9:128818379-128818401 CAGCAGGGGGCCTGCGAGGCGGG + Intergenic
1062034298 9:134375982-134376004 CAGCAGGCTGCGAGCCTGGCGGG - Intronic
1062365026 9:136204401-136204423 GATCAGGGGTCGTGTGTGGCAGG + Intronic
1062412207 9:136431253-136431275 CCTGGGGGGGCGGGCGTGGCGGG - Intronic
1062412316 9:136431544-136431566 CCTGGGGGGGCGGGCGTGGCGGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189223068 X:39389316-39389338 CATCATGGGGCCACCGTGTCTGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189901732 X:45713356-45713378 TATCAGGGTGCCAGCGTGGATGG - Intergenic
1192545449 X:72009067-72009089 GATCAGGAGGCTAGTGTGGCTGG - Intergenic
1195750914 X:108161582-108161604 CATTAGGAGGCGGGCGGGGCGGG - Intronic
1200098328 X:153674425-153674447 CGTCAGGAGGCCAGTGTGGCCGG - Intronic