ID: 1035344925

View in Genome Browser
Species Human (GRCh38)
Location 7:158191676-158191698
Sequence TCTTGGGTGGCTCTGTGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035344915_1035344925 26 Left 1035344915 7:158191627-158191649 CCTAATTCCGTGTCCTTAAGATG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1035344925 7:158191676-158191698 TCTTGGGTGGCTCTGTGATGCGG No data
1035344919_1035344925 13 Left 1035344919 7:158191640-158191662 CCTTAAGATGTTGAGTGGGCTTC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1035344925 7:158191676-158191698 TCTTGGGTGGCTCTGTGATGCGG No data
1035344916_1035344925 19 Left 1035344916 7:158191634-158191656 CCGTGTCCTTAAGATGTTGAGTG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1035344925 7:158191676-158191698 TCTTGGGTGGCTCTGTGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035344925 Original CRISPR TCTTGGGTGGCTCTGTGATG CGG Intronic
No off target data available for this crispr