ID: 1035345113

View in Genome Browser
Species Human (GRCh38)
Location 7:158192471-158192493
Sequence GCTGCCAACGCTGTGTTTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035345106_1035345113 3 Left 1035345106 7:158192445-158192467 CCGCCCTCCCGACTGTACCTCCT 0: 1
1: 0
2: 1
3: 34
4: 393
Right 1035345113 7:158192471-158192493 GCTGCCAACGCTGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1035345109_1035345113 -4 Left 1035345109 7:158192452-158192474 CCCGACTGTACCTCCTCTCGCTG 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1035345113 7:158192471-158192493 GCTGCCAACGCTGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1035345108_1035345113 -1 Left 1035345108 7:158192449-158192471 CCTCCCGACTGTACCTCCTCTCG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1035345113 7:158192471-158192493 GCTGCCAACGCTGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1035345107_1035345113 0 Left 1035345107 7:158192448-158192470 CCCTCCCGACTGTACCTCCTCTC 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1035345113 7:158192471-158192493 GCTGCCAACGCTGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1035345105_1035345113 14 Left 1035345105 7:158192434-158192456 CCAGGGCAGCACCGCCCTCCCGA 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1035345113 7:158192471-158192493 GCTGCCAACGCTGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1035345110_1035345113 -5 Left 1035345110 7:158192453-158192475 CCGACTGTACCTCCTCTCGCTGC 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1035345113 7:158192471-158192493 GCTGCCAACGCTGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035345113 Original CRISPR GCTGCCAACGCTGTGTTTTG AGG Exonic
903192361 1:21663841-21663863 GCTGGCAAGGCTGGGGTTTGGGG - Intronic
911043163 1:93607850-93607872 GCAGCTTACGCTGTGCTTTGTGG - Intronic
912735175 1:112143982-112144004 GCTGCGATCGCTGTGGTTTCTGG + Intergenic
912995732 1:114530910-114530932 CCTGCTAACTCTGTGTTTTCTGG + Intergenic
921404524 1:214764730-214764752 GCTGGCAACTGTGTGTTTGGTGG + Intergenic
922484131 1:225960059-225960081 CCAGCCAAGGCTGTGTTCTGAGG - Intergenic
923373946 1:233341276-233341298 GCTGCCAACCATGTGTCTTTAGG + Intronic
1064540171 10:16397151-16397173 CCTGCCAACACTGTGATTTTAGG - Intergenic
1065810940 10:29443132-29443154 GCTCACAAAGCTGTCTTTTGTGG - Intergenic
1066509501 10:36080745-36080767 GCAGCCAAAGCAGTGTTATGAGG - Intergenic
1070173796 10:73953462-73953484 GCTGCTTAAGCTGAGTTTTGAGG + Intergenic
1071566295 10:86673054-86673076 GGTGCCAAAGCTGTGTTTGGGGG - Intronic
1073769164 10:106716530-106716552 GCTGGCAAGTCTGTGTCTTGAGG + Intronic
1074316253 10:112364253-112364275 GCTGCCATCGCTGAGCTGTGGGG + Intergenic
1074316361 10:112364899-112364921 GCTGCCATCGCTGAGCTGTGGGG - Intergenic
1075464802 10:122643277-122643299 GCTACCGAGGCTGTGTGTTGAGG + Exonic
1079399438 11:20094009-20094031 GCTGCAGACGCTTTGTTCTGTGG - Intronic
1080873274 11:36255634-36255656 GTTGACAACACTGAGTTTTGGGG - Intergenic
1084581302 11:70025109-70025131 GAGGCCAAAGCTGTGTTCTGAGG - Intergenic
1084963092 11:72727461-72727483 GTGGCCAAGGCTGTGTGTTGGGG - Intronic
1085391238 11:76183351-76183373 GCTGGCAAGGCAGTGGTTTGGGG + Intergenic
1086049867 11:82577396-82577418 GCTGCCATCTCTGTGGTTTGAGG + Intergenic
1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG + Intergenic
1087425676 11:97982565-97982587 GCTGACATCTCTGAGTTTTGGGG + Intergenic
1088369031 11:109068240-109068262 GCTGCAAACTATGTGTGTTGTGG + Intergenic
1090412062 11:126516015-126516037 GCTGCCAACGCGGTGGGCTGAGG + Intronic
1090470106 11:126973078-126973100 ACTGCCAACTCTAAGTTTTGAGG + Intronic
1091755073 12:3046077-3046099 GCTGCCACCTCTGTGTTCTGTGG - Intergenic
1097397603 12:59094675-59094697 CCTGCAAACCCTGTGTTGTGAGG - Intergenic
1099268187 12:80474965-80474987 CCTGCCAACTTTGTGTTTTCAGG + Intronic
1100279785 12:93107416-93107438 GCTGCCTCCCCTGTGTTATGAGG + Intergenic
1104056106 12:125231332-125231354 TCTGCCAAGGCTGTATTTTCTGG + Intronic
1104312944 12:127670813-127670835 GCTGGCATCTCTGAGTTTTGGGG + Intergenic
1104914028 12:132255351-132255373 GCTTGCAATGCTGTGTCTTGTGG + Intronic
1105456704 13:20547686-20547708 GCTGAAAAGGCTGAGTTTTGAGG - Intergenic
1105773078 13:23631249-23631271 GCTGCAAATGCTCTGTTTTGGGG - Intronic
1107660143 13:42630762-42630784 TCTTCCAATACTGTGTTTTGGGG + Intergenic
1113513276 13:110872474-110872496 GCTGTCAGTGCTGTGTTTTGAGG + Intergenic
1122913510 14:104845189-104845211 GCGGGCCAGGCTGTGTTTTGTGG + Intergenic
1123459041 15:20451634-20451656 CCTGCCAACACTATTTTTTGTGG - Intergenic
1123659020 15:22548784-22548806 CCTGCCAACACTATTTTTTGTGG + Intergenic
1124312885 15:28643276-28643298 CCTGCCAACACTATTTTTTGTGG + Intergenic
1127911795 15:63422352-63422374 CCTGACAACCCAGTGTTTTGGGG + Intergenic
1130231330 15:82099520-82099542 GCTCCCAAAGCCGTGTTTTATGG - Intergenic
1134609001 16:15592909-15592931 GCTGAGAACGCTTTTTTTTGGGG - Intronic
1134829742 16:17313386-17313408 GCTGCCAAGGCTGGCTTGTGTGG - Intronic
1136703465 16:32164914-32164936 CCTGCCAACACTATTTTTTGTGG - Intergenic
1136764236 16:32762686-32762708 CCTGCCAACACTATTTTTTGTGG + Intergenic
1136803862 16:33107700-33107722 CCTGCCAACACTATTTTTTGTGG - Intergenic
1137016129 16:35377286-35377308 GCTGGCACAGGTGTGTTTTGGGG - Intergenic
1137364246 16:47847069-47847091 GCTTGCAAAGCTGTCTTTTGTGG + Intergenic
1137747295 16:50831934-50831956 GCTGCCCTTGCTGTGTGTTGGGG + Intergenic
1138536768 16:57664264-57664286 GATTCCAATGCTGTTTTTTGGGG + Exonic
1140998291 16:80282897-80282919 GATGACAAAGTTGTGTTTTGGGG - Intergenic
1141117130 16:81318763-81318785 GTTGCCAAAGCTGAGTTTTCTGG - Intronic
1141769296 16:86079442-86079464 GCGGCCAACGCTGTCTTATTTGG + Intergenic
1203066591 16_KI270728v1_random:1024809-1024831 CCTGCCAACACTATTTTTTGTGG + Intergenic
1143002280 17:3801907-3801929 GCTGTCAACGGCGTGTTCTGTGG - Intergenic
1148721286 17:49755076-49755098 GCTGCCAACCATGTGTCTGGTGG - Intronic
1150264761 17:63825035-63825057 GAAGCCAAAGGTGTGTTTTGGGG - Exonic
1153632654 18:7086777-7086799 GCTGCCGACTCTGTGTCTTTGGG + Intronic
1157796870 18:50582827-50582849 GCTGGCATCTCTGAGTTTTGGGG - Intronic
1159355239 18:67331275-67331297 GCTGCCAACTCATTGTTTAGTGG + Intergenic
1159856442 18:73595428-73595450 GTTACCAACCCTGTGTTTAGTGG - Intergenic
1160439785 18:78880460-78880482 TCTGGTAACGCTGTGTTTTGTGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162034658 19:7932506-7932528 GCTGCCGAGGCTGTTTTCTGAGG - Intronic
1166068864 19:40376382-40376404 GATGACAACACTGGGTTTTGGGG + Intronic
926389211 2:12370286-12370308 GCTTGCAAAGCTGTCTTTTGTGG + Intergenic
927137922 2:20110975-20110997 GCTGCCAACCGTGTCTCTTGTGG - Intergenic
927388948 2:22570935-22570957 TCTGCCATTGCTGTCTTTTGAGG - Intergenic
933038489 2:77430774-77430796 GCTGGCAAAGCATTGTTTTGAGG + Intronic
935855503 2:107268752-107268774 GTGGCCAACGCTCTGATTTGAGG + Intergenic
942859709 2:180595144-180595166 GCTGCCATCACAGTGTTGTGTGG + Intergenic
943787101 2:191889605-191889627 GCAACCAAGGCAGTGTTTTGGGG + Intergenic
944129490 2:196331504-196331526 GCTGACAGAGATGTGTTTTGAGG - Intronic
948153308 2:235762199-235762221 GCTGCTAACCCAGTGGTTTGTGG - Intronic
1169176930 20:3524895-3524917 GCAGCCAAAGCAGTGTTTAGAGG + Intronic
1171109749 20:22469430-22469452 GCTGACAATGCTGTGTTTTCAGG - Intergenic
1178042485 21:28654819-28654841 GCTGCCAAACCTCTGTTTTTAGG - Intergenic
1180057686 21:45367309-45367331 GCTGCCAAGGCTGGGCTGTGGGG + Intergenic
1181865834 22:25854388-25854410 GCTGCCTACGCTGTGAAATGAGG - Intronic
1183602072 22:38845506-38845528 GCTGCCTGCCCTGGGTTTTGAGG - Intergenic
1184240206 22:43207825-43207847 GCTGCCCAAGCAGGGTTTTGAGG - Intronic
953239483 3:41135967-41135989 GCTGCCATCGCTGTGTACTAGGG - Intergenic
955841219 3:63114990-63115012 GCTGATAACCCTGTCTTTTGGGG + Intergenic
957136415 3:76294389-76294411 GCTGCCATCACTGTGTGATGGGG + Intronic
960639784 3:119814179-119814201 GCTGCTTACTCTGGGTTTTGAGG - Intronic
962454627 3:135553776-135553798 CCTGCCAACACTTTGTTTTTTGG - Intergenic
967662410 3:192129426-192129448 GCTACCAATGCTGTGTGATGTGG - Intergenic
969188690 4:5499523-5499545 GCTGTCAGGGCTGTGTTTTTCGG - Exonic
971452760 4:26815415-26815437 GCTCAGAAAGCTGTGTTTTGTGG - Intergenic
972384703 4:38553800-38553822 TCTGCCACCTCTGTGTTTGGGGG - Intergenic
972903891 4:43720985-43721007 ACTGCCAATGCTGAGTCTTGGGG + Intergenic
975781214 4:77841787-77841809 ACTGCCACCTCTTTGTTTTGAGG - Intergenic
976777762 4:88724552-88724574 TTTGCCAAACCTGTGTTTTGAGG + Intergenic
983391202 4:167132659-167132681 TCTGCCAAGGCTTTGATTTGTGG - Intronic
983904999 4:173172636-173172658 GCTGCCTACTCTGACTTTTGAGG + Intronic
989632477 5:43499924-43499946 ACGGCCAAGGGTGTGTTTTGTGG - Intronic
997389847 5:133505395-133505417 GCTGCCACAGATGTGCTTTGAGG - Intronic
999797977 5:155005792-155005814 GATGTGAAAGCTGTGTTTTGTGG + Intergenic
1000874183 5:166615795-166615817 ACTGCCAAGGCTGTGTCTTAAGG - Intergenic
1001385034 5:171331529-171331551 GCTCCCAAAGCTGAGTTTTGTGG - Intergenic
1004026694 6:11826384-11826406 GCTGGCAAGGGTGTGTTTTAGGG - Intergenic
1014134865 6:117877013-117877035 GCTGCATACCCTGTGCTTTGTGG - Intergenic
1017969032 6:159294490-159294512 GCAGCTAAAGCTGTGTTTGGAGG - Intergenic
1018448145 6:163877268-163877290 CCTGACAATGCTGTGTCTTGTGG - Intergenic
1018786626 6:167113431-167113453 GTTGCCCTCTCTGTGTTTTGGGG - Intergenic
1030680514 7:112428876-112428898 GATGTCAACGTTTTGTTTTGAGG - Intronic
1031378136 7:121052325-121052347 GGTGCCAACCGTATGTTTTGGGG - Intronic
1033063730 7:138132394-138132416 GCTGCCAACTATGTGATTGGAGG + Intergenic
1035345113 7:158192471-158192493 GCTGCCAACGCTGTGTTTTGAGG + Exonic
1035388298 7:158489084-158489106 AGTGCAAACGCTGTGTTTTCAGG - Intronic
1036646970 8:10617017-10617039 GCTGCCTAATCTGTGTTTTCTGG + Intronic
1045324053 8:101103635-101103657 GCCGCCAACACTGTGTGCTGGGG - Intergenic
1047950328 8:129928172-129928194 GCTGTTAACGGTGTCTTTTGAGG - Intronic
1053331495 9:37212752-37212774 GCTGTTAACACTGTGTTTAGGGG - Intronic
1056025084 9:82485632-82485654 GCTACCAACACTTTGTTTAGAGG - Intergenic
1059924607 9:119195889-119195911 TTTTCCAAAGCTGTGTTTTGAGG + Intronic
1061987654 9:134139186-134139208 GCTCTCATCTCTGTGTTTTGTGG + Intronic
1185530588 X:815184-815206 CCTGGCAACGGTGTGTTTTAGGG + Intergenic
1185582214 X:1218377-1218399 GATGCCAAGGCTGGGTTTAGGGG - Intergenic
1188837822 X:34979812-34979834 TCTGATAACGGTGTGTTTTGGGG - Intergenic
1189146615 X:38661647-38661669 GCAGCCAACGCTGTGGTTCGGGG - Intronic
1192538670 X:71949963-71949985 GCTGCCAACCGTGTGGTCTGGGG - Intergenic
1194946890 X:100079993-100080015 GCTGCCTACCCCGTCTTTTGGGG + Intergenic
1197066236 X:122237268-122237290 GCTGCCACTGCTGTGCTGTGGGG + Intergenic