ID: 1035345233

View in Genome Browser
Species Human (GRCh38)
Location 7:158193051-158193073
Sequence ACAGCAGGGACTGCAGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035345233_1035345240 20 Left 1035345233 7:158193051-158193073 CCCTCCGCTGCAGTCCCTGCTGT 0: 1
1: 0
2: 1
3: 28
4: 283
Right 1035345240 7:158193094-158193116 GCCATCGCGTGCACCATGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1035345233_1035345239 19 Left 1035345233 7:158193051-158193073 CCCTCCGCTGCAGTCCCTGCTGT 0: 1
1: 0
2: 1
3: 28
4: 283
Right 1035345239 7:158193093-158193115 CGCCATCGCGTGCACCATGCAGG 0: 1
1: 0
2: 0
3: 1
4: 23
1035345233_1035345243 25 Left 1035345233 7:158193051-158193073 CCCTCCGCTGCAGTCCCTGCTGT 0: 1
1: 0
2: 1
3: 28
4: 283
Right 1035345243 7:158193099-158193121 CGCGTGCACCATGCAGGGCAGGG No data
1035345233_1035345242 24 Left 1035345233 7:158193051-158193073 CCCTCCGCTGCAGTCCCTGCTGT 0: 1
1: 0
2: 1
3: 28
4: 283
Right 1035345242 7:158193098-158193120 TCGCGTGCACCATGCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035345233 Original CRISPR ACAGCAGGGACTGCAGCGGA GGG (reversed) Intronic
900480999 1:2899290-2899312 ACAGCATCCCCTGCAGCGGACGG + Intergenic
900948172 1:5843025-5843047 ACCCCAGGGACTGCAACTGAGGG + Intergenic
900955385 1:5883498-5883520 ACAGCAGGGGCAGCAGCTCACGG + Intronic
900980071 1:6041205-6041227 ACATCAGCGACAGCTGCGGAGGG + Intronic
901171869 1:7265000-7265022 ACACCAGGGCCTGCAGGGGTGGG + Intronic
901350409 1:8590493-8590515 ACTGCAGAGACTTCAGCTGAAGG + Intronic
902463406 1:16597543-16597565 ACAGAGGGGACTGCAGGGGTTGG + Intronic
902858384 1:19226113-19226135 ACAGCAGAGACTGAATTGGAGGG - Intronic
903158112 1:21463158-21463180 ACAGAGGGGACTGCAGGGGTTGG - Intronic
904303646 1:29572871-29572893 ACAGCAGGGACTGTCACCGATGG + Intergenic
904454222 1:30637454-30637476 ACAGCAGGGACTGTCACTGATGG - Intergenic
904472226 1:30742973-30742995 ACAGAAGGGGATGCAGTGGAGGG - Intronic
905674448 1:39815944-39815966 ACACCTGGTCCTGCAGCGGATGG + Intergenic
907430102 1:54406533-54406555 GCAGCGGGGACTGCCGCGGCCGG - Intronic
907476600 1:54710084-54710106 ACAGCTGGGGCTCCAGCGGTGGG - Exonic
913091990 1:115482428-115482450 ACAGCAGGGACAGCAGCACAGGG + Intergenic
913156224 1:116101769-116101791 ACACCAGGGCCTGCAGGGGGTGG - Intergenic
913991510 1:143617001-143617023 ACAGAGGGGACTGCAGGGGTAGG + Intergenic
914049679 1:144121012-144121034 ACAGCAGGAACTGCAGCCACTGG - Intergenic
914129503 1:144844439-144844461 ACAGCAGGAACTGCAGCCACTGG + Intergenic
916395792 1:164386027-164386049 ACACCAGGGCCTGCAGGGGGTGG - Intergenic
920127195 1:203702700-203702722 ACAGCAGGGACTACTCAGGAAGG + Intronic
920246656 1:204592892-204592914 ATAGCAGGGACTCCAGAGGAAGG - Intergenic
922339074 1:224641196-224641218 ACAGCAGGTGCTGCAGCTCAGGG - Intronic
922605049 1:226885111-226885133 ACAGCAGTTGCTTCAGCGGATGG + Intronic
924394741 1:243606874-243606896 ACAGCTGGGACTGAAGCAGTTGG - Intronic
924723706 1:246647196-246647218 ACAGCAGGGACTGCTCCCCAGGG - Exonic
924920058 1:248619478-248619500 AGAGCAGGGGCTGCAGAAGAGGG + Intergenic
1062926055 10:1316256-1316278 ACAGCAGGGAAGGGAGTGGATGG + Intronic
1063805342 10:9632849-9632871 ACAGCAGAGTAGGCAGCGGAGGG + Intergenic
1064380584 10:14838377-14838399 GCAGCAGGGACGGCAGCGGCAGG - Exonic
1066367715 10:34793037-34793059 GCAGCAGGGACTGCAGGTGTGGG + Intronic
1067563856 10:47322695-47322717 CCAGCAGGGACAGCAGGGGCAGG - Exonic
1071118062 10:82247023-82247045 GCAGCTGGCACTGCAGCTGAAGG - Intronic
1071131960 10:82404970-82404992 GCAGCAGGGACTTAAGCGGTTGG - Intronic
1071493410 10:86152061-86152083 ACAGCAGGGAGTGCACGAGAAGG + Intronic
1072621036 10:97079516-97079538 CCAGCAGGGACTGGAGAGGGAGG - Intronic
1073042241 10:100615609-100615631 CCAGCGGGGCCTGCAGCGGGAGG - Intergenic
1073173438 10:101533486-101533508 ACTGCAGGGATGGCAGGGGAGGG - Intronic
1073301587 10:102474222-102474244 ACAGCAGGACCTGCAGAGAAGGG - Intronic
1073322836 10:102626099-102626121 ACAGAAGGGTCTGCAGTGGAGGG + Intronic
1074022921 10:109603069-109603091 AAAGCAGGGACTGGAGAGGAAGG + Intergenic
1074732327 10:116392359-116392381 ACAGCAGGTACTGCTCAGGATGG + Intergenic
1074768008 10:116714733-116714755 AGAGAAGAGACTGCAGAGGAAGG - Intronic
1075341228 10:121648240-121648262 GCACCAGTGACTGCAGAGGAGGG - Intergenic
1076457829 10:130614549-130614571 ACTGCTGGGACTGCAGGGCACGG - Intergenic
1076715480 10:132361890-132361912 AGGGCAGGGACTGCAGCGGGTGG - Intronic
1077259397 11:1607804-1607826 ACAGCAGGGTTTGCAGCAGCTGG + Exonic
1077274506 11:1697565-1697587 ACAGCAGGGCTTGCAGCAGCTGG - Exonic
1077975687 11:7246208-7246230 CCAGCAGGGACTGTGGCAGAAGG - Intronic
1079560621 11:21814532-21814554 ACACCAGGGAGTGCAGCTGCAGG + Intergenic
1081185751 11:40040189-40040211 ACAGCAGGTGCTGGAGAGGATGG - Intergenic
1082973903 11:59053498-59053520 CCAGCAGGGGGTGCTGCGGAGGG + Intergenic
1084190851 11:67498081-67498103 ACAGTGGGGGCTGCAGTGGAGGG + Intronic
1084800162 11:71538375-71538397 ACAGCAGGGTTTGCAGCAGCTGG - Exonic
1084800175 11:71538462-71538484 ACAGCAGGGCTTGCAGCAGCTGG - Exonic
1084800188 11:71538549-71538571 ACAGCAGGGCTTGCAGCAGCTGG - Exonic
1084803977 11:71566066-71566088 GCAGCAGGGATTGCAGCAGCTGG - Exonic
1085082292 11:73645255-73645277 ACAGCCAGGACTGCTGCGGCTGG + Intergenic
1088489302 11:110371354-110371376 AGGGCAGGGACTGGAGTGGAGGG + Intergenic
1089619743 11:119715276-119715298 CCAGCTGGGCCTGCAGCTGAAGG - Intronic
1089688838 11:120173462-120173484 ACAGCAGAGGCTGGAGCAGATGG - Intronic
1090252828 11:125263398-125263420 ACAGCAGGGACTGCTGGCGACGG + Intronic
1091496168 12:974558-974580 AGAGCAGGCACTGCAGAGGTAGG - Intronic
1091679552 12:2517039-2517061 ACAGGAGGGAATGCAAAGGAAGG + Intronic
1095246970 12:39934419-39934441 GCAGCAGGGAATGCAGGGAACGG + Intronic
1096621696 12:52869448-52869470 GCAGCAGAGACAGCAGGGGAGGG + Intergenic
1097560008 12:61191210-61191232 ACAACAGGGACTAAAGCAGAAGG + Intergenic
1100280394 12:93112870-93112892 ACAGCAGGGGCAGCAGCAGAAGG - Intergenic
1101880253 12:108621500-108621522 ACTGCAGGGACTGCAGCTATGGG - Intergenic
1102584205 12:113911772-113911794 ACATGAGGCACTGCAGCGCACGG + Intronic
1103436229 12:120929120-120929142 ACAGAAGGCACTGCAGGGGCTGG - Intergenic
1104955065 12:132460409-132460431 CCAGCAGGGGCTGCGGAGGAGGG + Intergenic
1105407060 13:20142008-20142030 CCAGCAGGGCCAGCAGCGGGCGG - Exonic
1105457329 13:20553716-20553738 ACAGAAGGGAGTGGAGCAGAGGG - Intergenic
1105892660 13:24692694-24692716 ACAGCAGGGTCTGCAGCCAGAGG + Intronic
1107657136 13:42603328-42603350 GCAGCAGGGACTGAAGTGTAGGG + Intronic
1109783161 13:67139978-67140000 GCAGAAGGGAATGCAGCTGATGG - Intronic
1110300046 13:73915464-73915486 AGAGCAGCGACTGCAGGGAAAGG - Intronic
1110363137 13:74650560-74650582 ACAACAGAGACTGCAGCAGCTGG - Intergenic
1113191568 13:107753926-107753948 ACGGCAGAGACTGCACTGGAGGG + Intronic
1113819790 13:113204752-113204774 AAAGCAGGGATGGCAACGGACGG + Intronic
1114069135 14:19094412-19094434 AAAGCAGGGACTGGGGAGGAGGG - Intergenic
1114093125 14:19305591-19305613 AAAGCAGGGACTGGGGAGGAGGG + Intergenic
1114532244 14:23403305-23403327 GCAGCAGGGACAGCAGTGGGTGG + Intronic
1115607090 14:35014229-35014251 AAAGCAAGGACTGCAGCCCAGGG - Intronic
1117312289 14:54539868-54539890 GCAGCAGGGACTGCAGCTTAAGG - Intergenic
1118327780 14:64793181-64793203 CCCGCAGGGCCTGCAGCCGATGG + Exonic
1119217695 14:72881749-72881771 ACAGCTGGGGCTGCTGTGGAGGG + Intronic
1119742913 14:77026082-77026104 ACAGCAGAGGCAGCAGTGGATGG - Exonic
1119769064 14:77208998-77209020 TCAGGAGTGACTGCAGCGGAGGG + Intronic
1120077740 14:80179253-80179275 ACAGTAGTAACTGCAGAGGAAGG + Intergenic
1121490603 14:94356423-94356445 ACAGCAGTGCCTGCTGTGGACGG - Intergenic
1122721526 14:103725104-103725126 ACAGCAGGGACTTCAGTCCAAGG - Intronic
1122880214 14:104687525-104687547 TCGGCAGGGAGTGCAGAGGAGGG - Intergenic
1123419549 15:20120234-20120256 ACAGCAGGAACTGCAGCCACTGG - Intergenic
1123446315 15:20333278-20333300 ACAGCAGGAACTGCAGCCACTGG + Intergenic
1123450963 15:20358485-20358507 CCACCAGGGACTGGAGCAGATGG - Intergenic
1123463737 15:20497986-20498008 ACAGCGGAGACTGGAGCTGAAGG + Intergenic
1123528771 15:21126772-21126794 ACAGCAGGAACTGCAGCCACTGG - Intergenic
1123654326 15:22502443-22502465 ACAGCGGAGACTGGAGCCGAAGG - Intergenic
1124274584 15:28315356-28315378 ACAGCGGAGACTGGAGCCGAAGG + Intronic
1124308234 15:28597637-28597659 ACAGCGGAGACTGGAGCCGAAGG - Intergenic
1124588651 15:31034402-31034424 ACAGCAGCACCTGCAGCAGATGG - Intronic
1125756753 15:42070080-42070102 CCACCAGGCACTGCAGCAGACGG - Exonic
1125967684 15:43887417-43887439 ACAGTAGGGACTGAACAGGAGGG + Intronic
1129078797 15:73021471-73021493 GCAGCAGGGCCTGCGGAGGAAGG + Intergenic
1129341673 15:74890367-74890389 ACATCGAGGCCTGCAGCGGAGGG + Intronic
1131055678 15:89373020-89373042 ACAGCAGGGTCATCAGCTGAAGG - Intergenic
1131539625 15:93265418-93265440 ACAGCGGGGACGGCAGCAGGTGG + Intergenic
1132469800 16:96016-96038 GCAGCAGGGACAGCAGGGAAGGG + Intronic
1132500542 16:282900-282922 GCAGCAGGGGCAGCAGGGGAGGG - Exonic
1132900305 16:2250507-2250529 ACAGCAGGGACTGCTGCACCGGG + Intronic
1133355677 16:5134950-5134972 ACTGCAGGGACTTCAGTGAAAGG - Intergenic
1134136623 16:11680726-11680748 ACAGCAGGGACTCCAGAGCCTGG + Intronic
1135464511 16:22673669-22673691 ACAGCAGTGACTGCAGAGGGAGG - Intergenic
1135920912 16:26648150-26648172 CCAGCAGGAACTGCAGGAGAAGG + Intergenic
1136101966 16:28003327-28003349 GCAGCAGGGACTGCAGGGGACGG + Intronic
1136371596 16:29840252-29840274 GCAGCAGGGGCTGCTGCTGAGGG + Exonic
1136591254 16:31219106-31219128 ACAGCAGAAACTGCAGCTGCAGG + Exonic
1136776749 16:32875878-32875900 ACAGCAGGCAATGCAGTGGGTGG - Intergenic
1136893868 16:33985635-33985657 ACAGCAGGCAATGCAGTGGGTGG + Intergenic
1137388498 16:48061647-48061669 ACAGTATGGACTGGAGTGGAAGG - Intergenic
1137958046 16:52852849-52852871 ACCGCTGGGACTGAAGCGCAAGG - Intergenic
1138167572 16:54817528-54817550 AAAGCGGAGACTGCAGGGGAAGG - Intergenic
1138497356 16:57416498-57416520 ACTGCAGTGAGTGCAGGGGAAGG - Intergenic
1139632577 16:68239500-68239522 ACAGAAGGGACCCCTGCGGAAGG - Intergenic
1140396716 16:74633575-74633597 AAAGCAGTGACTGCTGGGGATGG + Intronic
1141034481 16:80615765-80615787 ACAGGAGGGGCTGGGGCGGAGGG - Intronic
1141500219 16:84438961-84438983 AGAGCGGGGTCTGCAGGGGAGGG + Intronic
1141925248 16:87164191-87164213 ACCACAGGAACTGCTGCGGATGG - Intronic
1142344415 16:89544946-89544968 ACAGCAGTGAGTGCAGCCGGTGG - Intronic
1203079164 16_KI270728v1_random:1137987-1138009 ACAGCAGGCAATGCAGTGGGTGG - Intergenic
1203137537 16_KI270728v1_random:1738491-1738513 ACAGCAGGAACTGCAGCCACTGG + Intergenic
1142941779 17:3385998-3386020 AGAGCAGGAACAGCAGCGGGTGG - Intergenic
1143056399 17:4165429-4165451 ACAGCAGGGAGAGCACGGGAAGG + Exonic
1143480335 17:7224422-7224444 GCATCAGGGACTGCAGCCGATGG + Intronic
1143568542 17:7740077-7740099 ACAGGAGAGAGTGCAGGGGAGGG + Intronic
1144037584 17:11381471-11381493 GCAGCAGGGAGTGCAGTGGCAGG + Intronic
1144886849 17:18468968-18468990 AGAGCAGGAACTGCAGGGGCTGG - Intergenic
1145145366 17:20475328-20475350 AGAGCAGGAACTGCAGGGGCTGG + Intergenic
1146265618 17:31450769-31450791 ACAGAAGAGACTGGAGCCGAAGG - Intronic
1146353584 17:32116065-32116087 AGAGCAGGAACTGCAGGGGCTGG - Intergenic
1146469224 17:33110917-33110939 ACAGGAAGGACTGCAGAGGTGGG - Intronic
1146890354 17:36502611-36502633 TGAGCAGGCACTGCAGGGGAAGG - Intronic
1146939876 17:36836978-36837000 AAAGCAGAGACAGCAGCTGATGG + Intergenic
1147326132 17:39670470-39670492 ACAGCACTGACCGCAGCGGCAGG - Exonic
1148083065 17:44978061-44978083 ACAGCAGGGACTGGGGAGGAGGG - Intergenic
1150267759 17:63842259-63842281 GAAGCAGGTTCTGCAGCGGAGGG - Intronic
1152141267 17:78538227-78538249 AAAGCAGGTACTGCAGGGGCTGG + Intronic
1152337480 17:79706860-79706882 CCACCAGGGACTGGAGCAGATGG + Intergenic
1152714903 17:81894454-81894476 GCAGCAGAGCCTGCGGCGGAGGG - Exonic
1153718725 18:7879821-7879843 TCACCAGGGACAGCAGCTGATGG - Intronic
1154159849 18:11972833-11972855 ACAGCAGGGACTGAGGTGCAGGG + Intergenic
1156019359 18:32581919-32581941 ACATCAGGGAAAGCAGTGGAAGG - Intergenic
1157704497 18:49792147-49792169 ACTGCAGGGAATGCATCGGTTGG - Exonic
1158458789 18:57630096-57630118 ACAGCAAGGACCGCAGGGGGAGG - Intergenic
1159134233 18:64318456-64318478 ACAGAATAGACTGCAGGGGAAGG - Intergenic
1160446715 18:78933875-78933897 ACAGCAGGGACTGCACGCGATGG - Intergenic
1160946109 19:1644810-1644832 ACAGCAGGGCCTGGTGGGGAGGG - Intronic
1161171499 19:2814510-2814532 ACAGGAGGGGCTGAAGCAGATGG - Exonic
1161422379 19:4182905-4182927 ACAGCAGGGACCCCAGCCTAAGG + Intergenic
1161498358 19:4599235-4599257 GCAGGAGGGCCTGCAGAGGAAGG - Intergenic
1161560652 19:4970722-4970744 TCAGCAGGGGCTGCAGGAGAAGG - Intronic
1162874109 19:13608129-13608151 ACTGCACTGACTGCAGAGGAGGG - Intronic
1163471131 19:17497551-17497573 ACAGCCTGGACTGGCGCGGAAGG + Intronic
1163689427 19:18730630-18730652 GCAGCAGGAACTGCAGGGGTGGG - Intronic
1164637225 19:29800333-29800355 ACAGCAGGGCCTCCTGGGGAGGG + Intergenic
1164646843 19:29864465-29864487 ACAGCAGGCACTGCTGAGGAAGG + Intergenic
1164830673 19:31317636-31317658 ACAGCAGGGTCTGGAGAGCAGGG + Intronic
1164944429 19:32281429-32281451 ACAGGGGAGACTGCAGTGGAAGG - Intergenic
1165489174 19:36113462-36113484 CCCGCAAGCACTGCAGCGGAAGG - Exonic
1167597343 19:50434770-50434792 ACAGCAGGCAGGGCAGGGGAAGG + Intronic
1167618640 19:50549491-50549513 ACAGGAGGGTGTGCAGCGGAGGG - Intronic
1167785215 19:51630305-51630327 ACAGCAGGGGCAGCAGCAGCAGG + Intronic
1167787314 19:51646729-51646751 ACAGCAGGGGCAGCAGCAGCAGG + Exonic
1168016751 19:53580355-53580377 ACAGCAGGGACAGCGCGGGAGGG + Intergenic
1202679068 1_KI270711v1_random:34990-35012 ACAGAGGGGACTGCAGGGGTTGG + Intergenic
1202689069 1_KI270712v1_random:73575-73597 ACAGCAGGAACTGCAGCCGCTGG - Intergenic
925281217 2:2686647-2686669 ACGGCAGGGACTCCATCTGAGGG + Intergenic
925865607 2:8223585-8223607 CCAGCAGGGACGGCACCAGAAGG + Intergenic
933582644 2:84144737-84144759 ACAGCAGAGACTGTTGCAGAAGG + Intergenic
933957369 2:87382526-87382548 ACAGCAGGAACTGCAGCCACTGG + Intergenic
934136741 2:89002866-89002888 CCAACAAGGACTGCAGCTGAGGG + Intergenic
934241486 2:90274422-90274444 ACAGCAGGAACTGCAGCCACTGG + Intergenic
934271688 2:91542262-91542284 ACAGCAGGAACTGCAGCCACTGG - Intergenic
934517740 2:94999280-94999302 TCAGCAGGGACCCCAGGGGAAGG - Intergenic
934542698 2:95189198-95189220 ACAGCTGGGAGTGCAGGGGCTGG - Intergenic
935103510 2:100019037-100019059 ACAGCAAGGATTGCAGGGAAGGG - Intronic
935366989 2:102305053-102305075 AAAGCACGGACTGCAGCCAAGGG + Intergenic
936385886 2:112028697-112028719 TCAGCTGTGACTGCAGCAGAGGG - Exonic
937873716 2:126804577-126804599 AAAGCAGGGACAGAAGCGGCTGG - Intergenic
938422686 2:131156892-131156914 ACAGCAGGGACGGCAGGAGCGGG + Intronic
942059563 2:172215682-172215704 AGAGCAGGGGCTGCACCTGAGGG - Intergenic
944162327 2:196677507-196677529 ACACCAGTCACTGCAGCAGAAGG + Intronic
945359031 2:208873447-208873469 AAAGCAGTGACTGCAGGGAAAGG + Intergenic
946262797 2:218509974-218509996 ACAGCAGCAACTGCAGGGGTAGG - Exonic
947795586 2:232891995-232892017 ACAGCAGGGACGGCAGGGACAGG + Intronic
947883276 2:233540661-233540683 ACAGCATGGACCACTGCGGAAGG - Exonic
948254288 2:236554661-236554683 ACAGCAGGGGGTGCAGGGAAGGG + Intergenic
1170046532 20:12091276-12091298 TCAGGAGGGACTGCTGTGGAGGG - Intergenic
1170333685 20:15244436-15244458 ACAGCAGGGATACCAGGGGAAGG + Intronic
1171212139 20:23325260-23325282 CCTGCAGGGATTGCAGTGGATGG - Intergenic
1171498770 20:25577207-25577229 CCAGCAGGGACTCCAGAGGGCGG - Intronic
1172936055 20:38621144-38621166 ACTTCAGGGACTCCAGGGGATGG + Intronic
1173341792 20:42159345-42159367 ACAGCATGGCCTTCAGAGGATGG - Intronic
1174420872 20:50398573-50398595 ACAACAGAGGCTGGAGCGGAGGG + Intergenic
1175741693 20:61424547-61424569 ACATCAGTGGCTGCAGTGGAGGG - Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1175958201 20:62622058-62622080 ACAGCTGGGGCTGAGGCGGAGGG + Intergenic
1176222591 20:63977133-63977155 ACAGCCGGCCCTGCAGGGGAGGG + Exonic
1178624651 21:34204655-34204677 ACAGCAGGGGCTGCTGCAGATGG + Intergenic
1180487609 22:15816975-15816997 AAAGCAGGGACTGGGGAGGAGGG - Intergenic
1180634113 22:17250772-17250794 AGAGCATGGGCTGCAGCTGAAGG - Intergenic
1180913164 22:19467527-19467549 ACAGAAGGGGCTGGAGCTGAAGG + Intronic
1181351674 22:22262995-22263017 ACAGCAGGAACTGCAGCCACTGG - Intergenic
1181786596 22:25231631-25231653 CCAGCAGGTACTGCAGCCCACGG - Exonic
1181818762 22:25459443-25459465 CCAGCAGGTACTGCAGCCCACGG - Intergenic
1182310463 22:29401622-29401644 GCAGCAGTGACTGAAGTGGAAGG - Intronic
1182326404 22:29516603-29516625 AGTGCAGGGACTGCAGAAGAGGG + Intronic
1182690816 22:32160715-32160737 GCAGCAGTGACTGAAGTGGAAGG + Intergenic
1184448562 22:44569313-44569335 ACAGCACGGCCTGCAGGGGATGG + Intergenic
1184506786 22:44908491-44908513 GCAACAGGGGCTGCAGCAGAAGG - Intronic
1184995125 22:48199787-48199809 ACAGCATGGACTCCATGGGAAGG - Intergenic
1185182743 22:49372611-49372633 ACGGCAGAGACTGCAGCTGCGGG - Intergenic
1185243096 22:49756836-49756858 ACAGCAGGGGCTGGAGAGGGCGG - Intergenic
949407912 3:3734041-3734063 ATAGCAGGAACTGCAGAGAAAGG + Intronic
953563880 3:44014670-44014692 ACAGCAGGGACTGCAGACCAAGG - Intergenic
956452648 3:69389701-69389723 ACTCCAGGGACTGCAGTGGGTGG + Intronic
956669869 3:71677374-71677396 ATAGCAGTTACTGCAGCGAAAGG + Exonic
960356844 3:116664036-116664058 ACAGCTGGGAGTGCAGTGGCAGG + Intronic
961088560 3:124090724-124090746 AGAGCACGGACTGAAGCGGATGG + Intronic
961306129 3:125959857-125959879 CCAACAGGGACTGCAGTGGCTGG - Intergenic
962700918 3:137999165-137999187 ACGACAGGGACTGCTGGGGAGGG + Intronic
964682574 3:159358519-159358541 ACAGCAGGTGCTGCAGGGGCTGG + Intronic
965666574 3:171100444-171100466 TCAGCAGGGACTGGAGAGGCAGG - Intronic
966390992 3:179451935-179451957 AGAGCGGGGACTGCAACGCAAGG - Intergenic
967110672 3:186290730-186290752 AGAGCAGGCACTGGAGAGGAGGG + Intronic
967777042 3:193395461-193395483 ACAGCTGGGACTGAAGCAGCTGG + Intergenic
968502031 4:955304-955326 AAAGCAGGGGCTGCGGCAGAAGG - Intronic
968871081 4:3242858-3242880 TCAGCTGGGCCCGCAGCGGAAGG - Exonic
969239479 4:5889198-5889220 ACAGCAGGGACAGAAGGGTACGG + Intronic
969804739 4:9598421-9598443 ACTCCAGGGACTACAGAGGAGGG + Intergenic
975096472 4:70462855-70462877 CCAGCAGGAACTGCAGCAGGAGG + Intronic
976441841 4:85084981-85085003 ACAGCAGGAACAGCAGCAGCTGG - Intergenic
977087241 4:92617381-92617403 ACAGCAGGGCCTGTCGGGGATGG - Intronic
981256505 4:142667207-142667229 ACAGCAGGGACTGAGAAGGAGGG - Intronic
981569284 4:146134458-146134480 ACAACAGGGACTGCTGAGGGTGG - Intergenic
981694944 4:147550647-147550669 GCAGCTGGGACTGCAGCTGTGGG - Intergenic
987277834 5:16380251-16380273 ACAGCAGAAACAGCAGAGGAAGG + Intergenic
987767447 5:22251238-22251260 ACTGCAGAGAATGCAGGGGAAGG + Intronic
989122364 5:38017436-38017458 ACAGCAGGGAATGCTGAGGAGGG + Intergenic
989610709 5:43287874-43287896 ACAGCAGTGACTGGAGTAGAAGG + Intergenic
991024521 5:62015554-62015576 GCAGCAGCCACTGCAGCGGAAGG - Intergenic
1001640795 5:173242796-173242818 CCAGCAGGGACTCCAGCTGCAGG + Intergenic
1003369186 6:5508438-5508460 ACAGCAGGGACTGAACCAGAGGG + Intronic
1005023236 6:21437511-21437533 TCAGGAGGGATTGCAGCGGTGGG + Intergenic
1005421564 6:25656472-25656494 ACAGCAGCAATTGCAGCTGATGG - Intronic
1015454476 6:133410691-133410713 ACAGGAGGGACTGCTGCTGCAGG - Intronic
1016079078 6:139833789-139833811 ACAGCATGGACAGCAGCCCATGG + Intergenic
1017005450 6:150025414-150025436 ACAGCAGGAACAGAAGCGGGAGG + Exonic
1017442318 6:154475452-154475474 ACAGCAAGGGCCGCAGCAGATGG - Intronic
1018431415 6:163725703-163725725 AAAGCAGTGACTGCAGCGCCTGG - Intergenic
1018936184 6:168275405-168275427 AAAGCAGGGCCTGGAGAGGAGGG - Intergenic
1020279820 7:6644410-6644432 ACAGCACGGGCTGCAGGGCAGGG + Intronic
1021046635 7:15930861-15930883 ACACCAGGGACTCCAAAGGAAGG + Intergenic
1022025918 7:26447820-26447842 GCAGCCGGGACTGCAGTGGAAGG - Intergenic
1023303921 7:38803404-38803426 TCAGCAGGGGCTTCAGCCGAGGG + Intronic
1023660865 7:42469664-42469686 ACTGCACGGCATGCAGCGGAGGG - Intergenic
1023862179 7:44223431-44223453 GCAGCAGGAACTGGAGGGGAAGG - Intronic
1027591828 7:80127911-80127933 TCAGCAGGAACTGCAACAGAAGG - Intergenic
1027785232 7:82572379-82572401 ACAGCAGGGACTGAAAGGAATGG - Intergenic
1029382270 7:100221829-100221851 ACAGCAGGGAGCCCAGCAGAGGG - Intronic
1029452261 7:100647622-100647644 ACAGCAGAGCCTGCAGCGCCAGG - Intronic
1031134722 7:117873009-117873031 CCAGAAGCGACCGCAGCGGAGGG + Intronic
1032197194 7:129796295-129796317 ACAGCAGGGAACGCAGAGGGAGG - Intergenic
1032554758 7:132820422-132820444 ACAGGAGGGACTGGAAGGGAGGG + Intronic
1033648253 7:143321399-143321421 AGACCAGGAACTGCAGAGGAAGG - Exonic
1034270003 7:149798804-149798826 GCAGCAGGGGCTGGAGAGGAAGG + Intergenic
1035298034 7:157877764-157877786 GCAGCAGGGACAGGAGAGGAGGG + Intronic
1035345233 7:158193051-158193073 ACAGCAGGGACTGCAGCGGAGGG - Intronic
1036223960 8:6942936-6942958 ACAGCAGGGCCTGCATAGGAGGG - Intergenic
1036649004 8:10630173-10630195 CCAGCTGGGAGTGCAGTGGAGGG + Intronic
1039577016 8:38631914-38631936 ACAGCAGGGAGTACAGAGGTAGG - Intergenic
1040388402 8:46929994-46930016 ACAGGTGGGACTGCACCTGAGGG - Intergenic
1040505463 8:48043966-48043988 ACTGCAGGGAGTGCAGTGGATGG - Intronic
1041147014 8:54887591-54887613 ACAGTAGATACTGCAGGGGAGGG - Intergenic
1044606200 8:94050196-94050218 ACACCAGGGACTGTTGGGGAGGG - Intergenic
1045240519 8:100396502-100396524 ACAGCAAAGAGTGCAGCAGAGGG - Intronic
1045252183 8:100491460-100491482 ACTGCTGGGACTGCAGGAGAGGG + Intergenic
1045917167 8:107485950-107485972 ACAGTAGGGACTGCAGACGTGGG + Intronic
1047423101 8:124723638-124723660 ACAGCAGGAACTGCCTGGGATGG - Intronic
1048335891 8:133501958-133501980 ACAGCAGGGAGTGCAGCCCAGGG + Intronic
1048997331 8:139802092-139802114 ACAACAGGGAGTGGAGAGGAGGG - Intronic
1049012204 8:139894538-139894560 ACTGGAGTGCCTGCAGCGGAGGG + Intronic
1049319336 8:141987625-141987647 ACAGCAGAGGCTGGAGCCGAAGG + Intergenic
1049438670 8:142599286-142599308 ACAGCAGTGACAGCAGAGGGTGG + Intergenic
1050325063 9:4490540-4490562 ACGGCGGCGACTGCAGCGGCCGG + Exonic
1053468773 9:38330341-38330363 ACAGAAAGGACTGGAGTGGAAGG - Intergenic
1059691588 9:116689890-116689912 ATAGCAGGGACTGAGGCTGAAGG + Intronic
1061438510 9:130582320-130582342 ACAGCTGAGACTGCAGGGGTGGG - Intronic
1061496831 9:130979900-130979922 AGAGCAGGGATTGGAGAGGAAGG + Intergenic
1062344970 9:136110404-136110426 ACAGCAGGGGCTGAGGGGGAAGG - Intergenic
1062531042 9:137000520-137000542 GGAGCAGGGGCTGCAGGGGACGG - Intergenic
1203774028 EBV:62907-62929 ACAGCAGCGGCGGTAGCGGAGGG - Intergenic
1192417601 X:70997380-70997402 ATAGCTGGGACTGCAGGGGGAGG + Intergenic
1193565991 X:83077727-83077749 ACAGCATGGATTTCAGCAGATGG - Intergenic
1196828518 X:119758895-119758917 ACTGCTGGGGCTGCAGCGGGCGG + Exonic
1198953791 X:142104200-142104222 ACAGCAAGGTTTGCAGGGGATGG - Intergenic
1199491718 X:148407330-148407352 ACACCAGGGACTGTTGTGGAGGG + Intergenic
1200103110 X:153698154-153698176 ACAGCAGGCAATGCAGTGGGCGG + Intergenic
1200229863 X:154438484-154438506 GCAGGTGGGAGTGCAGCGGATGG + Intronic
1200799981 Y:7377640-7377662 ATAGCAAGGAATGCACCGGATGG - Intergenic