ID: 1035346427

View in Genome Browser
Species Human (GRCh38)
Location 7:158202635-158202657
Sequence CCATTTAGGGAGGCATTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1202
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 1167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035346427_1035346437 -2 Left 1035346427 7:158202635-158202657 CCAGCCAATGCCTCCCTAAATGG 0: 1
1: 0
2: 1
3: 33
4: 1167
Right 1035346437 7:158202656-158202678 GGGCCTCTGTTTTGTGGGCAGGG 0: 1
1: 0
2: 3
3: 10
4: 263
1035346427_1035346439 16 Left 1035346427 7:158202635-158202657 CCAGCCAATGCCTCCCTAAATGG 0: 1
1: 0
2: 1
3: 33
4: 1167
Right 1035346439 7:158202674-158202696 CAGGGATAATTGCTCTTGCCTGG No data
1035346427_1035346435 -7 Left 1035346427 7:158202635-158202657 CCAGCCAATGCCTCCCTAAATGG 0: 1
1: 0
2: 1
3: 33
4: 1167
Right 1035346435 7:158202651-158202673 TAAATGGGCCTCTGTTTTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 161
1035346427_1035346434 -8 Left 1035346427 7:158202635-158202657 CCAGCCAATGCCTCCCTAAATGG 0: 1
1: 0
2: 1
3: 33
4: 1167
Right 1035346434 7:158202650-158202672 CTAAATGGGCCTCTGTTTTGTGG No data
1035346427_1035346440 17 Left 1035346427 7:158202635-158202657 CCAGCCAATGCCTCCCTAAATGG 0: 1
1: 0
2: 1
3: 33
4: 1167
Right 1035346440 7:158202675-158202697 AGGGATAATTGCTCTTGCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 205
1035346427_1035346436 -3 Left 1035346427 7:158202635-158202657 CCAGCCAATGCCTCCCTAAATGG 0: 1
1: 0
2: 1
3: 33
4: 1167
Right 1035346436 7:158202655-158202677 TGGGCCTCTGTTTTGTGGGCAGG 0: 1
1: 0
2: 2
3: 20
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035346427 Original CRISPR CCATTTAGGGAGGCATTGGC TGG (reversed) Intronic
900287373 1:1908253-1908275 ACATTTTGGGAGGCAGAGGCAGG - Intergenic
900460415 1:2799976-2799998 CCATGTGGGGAGGGAGTGGCGGG + Intronic
900979131 1:6036254-6036276 GCATTTAGGGAGGCCGAGGCGGG + Intronic
901045783 1:6394837-6394859 CCACTTTGGGAGGCAGAGGCGGG - Intergenic
901412915 1:9097425-9097447 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
901446886 1:9313927-9313949 ACATTTTGGGAGGCCTAGGCGGG + Intronic
901474618 1:9481004-9481026 CCATTTTGGGAGGCCAAGGCGGG - Intergenic
901620004 1:10577159-10577181 GCATTTTGGGAGGCAGAGGCAGG + Intronic
901677082 1:10891709-10891731 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
901718808 1:11178461-11178483 TGATTTAGGGAGCTATTGGCAGG + Intronic
901813951 1:11783491-11783513 GCATTTTGGGAGGCAGAGGCGGG - Intronic
901819737 1:11820518-11820540 GCATTTTGGGAGGCAGAGGCAGG + Intronic
902402761 1:16167188-16167210 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
902424272 1:16307136-16307158 ACATTTTGGGAGGCTTAGGCGGG - Intronic
902523329 1:17035614-17035636 GCACTTTGGGAGGCCTTGGCGGG + Intronic
902763353 1:18598827-18598849 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
902973714 1:20073634-20073656 GCATTTTGGGAGGCAGAGGCAGG + Intronic
903042146 1:20539251-20539273 TCATTTAGAGAGGTTTTGGCAGG - Intergenic
903052985 1:20615384-20615406 GCAATTAGGGAGGCAGAGGCAGG + Intronic
903078485 1:20789742-20789764 GCATTTTGGGAGGCACAGGCAGG + Intergenic
903346472 1:22687651-22687673 CCATTTTGGGAGGCCAAGGCAGG + Intergenic
903389217 1:22952653-22952675 GCACTTTGGGAGGCCTTGGCGGG - Intergenic
903523487 1:23973565-23973587 CCACTTTGGGAGGCCTAGGCGGG - Intronic
903598557 1:24516216-24516238 GCATTTTGGGAGGCTGTGGCGGG + Intronic
903661251 1:24980203-24980225 GCATTTAGGGAGGCAGAAGCAGG - Intergenic
903807897 1:26018442-26018464 GCATTTTGGGAGGCTTAGGCAGG - Intergenic
904066695 1:27757728-27757750 CCATTTTGGGAGGCCAAGGCGGG + Intronic
904139219 1:28338807-28338829 CCATTTTGGGAGGCCAAGGCAGG - Intergenic
904183835 1:28687087-28687109 GCATTTTGGGAGGCAGAGGCAGG + Intronic
904198462 1:28803596-28803618 CCATTTTGGGAGGCTGAGGCAGG - Intergenic
904649679 1:31995496-31995518 ACACTTAGGGAGGCAAAGGCAGG - Intergenic
904652900 1:32019301-32019323 GCATTTTGGGAGGCAGAGGCGGG + Intronic
904730526 1:32587532-32587554 GCATTTAGGGAGGCCAAGGCAGG + Intronic
905125034 1:35710224-35710246 GCATTTTGGGAGGCTGTGGCGGG - Intergenic
905189037 1:36218786-36218808 GCATTTCGGGAGGCAGGGGCAGG + Intergenic
905248305 1:36629726-36629748 CTATTTACAGAGGCATAGGCAGG - Intergenic
905595059 1:39199393-39199415 ACATTTTGGGAGGCCTAGGCAGG + Intronic
905663871 1:39749885-39749907 GCATTTTGGGAGGCAGAGGCAGG + Intronic
905693868 1:39961059-39961081 GCACTTAGGGAGGCAGAGGCAGG - Intronic
905718927 1:40179079-40179101 GCATTTTGGGAGGCCTGGGCAGG - Intronic
905813928 1:40933318-40933340 GCACTTGGGGAGGCCTTGGCAGG - Intergenic
906304070 1:44705242-44705264 CCATTTTGGGAGGCCGAGGCAGG + Intronic
906573320 1:46863235-46863257 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
907078830 1:51602690-51602712 CCAGTTTGGGAGGCAGAGGCGGG - Intronic
907079152 1:51605342-51605364 GCACTTAGGGAGGCAGAGGCAGG + Intronic
907242543 1:53088762-53088784 GCATGGAGGGAGGGATTGGCTGG + Intronic
907458429 1:54591002-54591024 GCATTTAGGGAGGCCAAGGCAGG - Intronic
907482753 1:54755859-54755881 CCACTTTGGGAGGCCTAGGCAGG + Intergenic
908198836 1:61773419-61773441 CCACTTTGGGAGGCCTAGGCAGG + Intronic
908428350 1:64031112-64031134 GCATTTTGGGAGGCAGAGGCGGG - Intronic
908700386 1:66892657-66892679 GCATTTTGGGAGGCCTAGGCAGG + Intronic
909622657 1:77684710-77684732 CCACTTTGGGAGGCCTTGACAGG + Intergenic
910038623 1:82819801-82819823 GCACTTTGGGAGGCATAGGCAGG + Intergenic
910429491 1:87147164-87147186 GCACTTTGGGAGGCAGTGGCAGG - Intronic
910855827 1:91694237-91694259 GCATTTTGGGAGGCAGGGGCGGG - Intronic
910902782 1:92140173-92140195 GCACTTAGGGAGGCAGAGGCGGG + Intronic
910963117 1:92783065-92783087 GCATTTTGGGAGGCAGAGGCAGG - Intronic
911337767 1:96601756-96601778 GCATTTAGGGAGGCCGAGGCAGG - Intergenic
911578215 1:99603454-99603476 CCATTTTGGGAGGCCGAGGCAGG - Intergenic
911673141 1:100629885-100629907 GCACTTTGGGAGGCATAGGCAGG + Intergenic
912044660 1:105438497-105438519 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
912199472 1:107440132-107440154 GCATTTAGGTAGGCACTGCCAGG + Intronic
912535140 1:110362366-110362388 CCATTTTGGGAGGCCGAGGCGGG + Intergenic
912994151 1:114516654-114516676 CCACTTTGGGAGGCCTAGGCAGG - Intergenic
913017284 1:114752016-114752038 GCACTTTGGGAGGCCTTGGCAGG + Intronic
913043755 1:115055766-115055788 GCACTTAGGGAGGCAGAGGCAGG - Intronic
913121364 1:115743888-115743910 CCATTTTGGGAGGCTGAGGCAGG + Intronic
913333178 1:117684095-117684117 GCATTTCTGGAGGCTTTGGCTGG + Intergenic
913597893 1:120395492-120395514 CCATTTTGGGAGGCCGAGGCGGG - Intergenic
914089440 1:144483820-144483842 CCATTTTGGGAGGCCGAGGCGGG + Intergenic
914530167 1:148517018-148517040 GCATCTAGGGAGGCTATGGCAGG - Intergenic
914592938 1:149122752-149122774 CCATTTTGGGAGGCCGAGGCGGG + Intergenic
914712127 1:150223989-150224011 CCATTTTGGGAGGCTGAGGCAGG - Intronic
914809886 1:151019746-151019768 GCACTTAGGGAGGCAGAGGCAGG - Intronic
914831180 1:151172078-151172100 GCATTTAGGGAGGCCGAGGCAGG - Intronic
914835012 1:151199364-151199386 GCACTTTGGGAGGCCTTGGCGGG + Intronic
915204419 1:154259436-154259458 GCACTTAGGGAGGCAGAGGCGGG - Intronic
915379817 1:155430220-155430242 GCATTTTGGGAGGCAGAGGCAGG - Intronic
915412898 1:155716697-155716719 GCATTTTGGGAGGCAGAGGCGGG + Intronic
915750094 1:158199111-158199133 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
916044668 1:160990521-160990543 CCATTTAGGGAGGAAGGAGCAGG - Intergenic
916684366 1:167131365-167131387 CCATTTACAGAGGCATAGGAAGG + Intergenic
917016882 1:170541864-170541886 GCACTTAGGGAGGCAGAGGCGGG + Intronic
917042836 1:170825255-170825277 CCACTTAGGGAAGCAGAGGCAGG + Intergenic
917142571 1:171851658-171851680 GCATTTTGGGAGGCAGAGGCGGG - Intronic
917146813 1:171900860-171900882 GCATTTAGGGAGGCCGAGGCGGG + Intronic
917998110 1:180462123-180462145 CTATTTAGGGAGGCTGAGGCAGG + Intronic
918004786 1:180531435-180531457 GCATTTAGGGAGGCTGAGGCGGG - Intergenic
918056221 1:181023782-181023804 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
918221922 1:182443257-182443279 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
918222393 1:182447368-182447390 GCATTTTGGGAGGCTGTGGCAGG - Intergenic
918777700 1:188656141-188656163 CCACTTTGGGAGGCAGAGGCGGG - Intergenic
919082429 1:192882615-192882637 CCATTTTGGGAGGCCAAGGCGGG + Intergenic
919246171 1:194987682-194987704 GCATTTAGGGAGGCTGAGGCGGG - Intergenic
919276060 1:195418163-195418185 GCATTTTGGGAGGCAGTGGCGGG + Intergenic
919662000 1:200256465-200256487 GCACTTAGGGAGGCAGAGGCAGG - Intergenic
919893651 1:201994426-201994448 GCAATGAGGGAGGCAGTGGCAGG - Intronic
920638549 1:207729002-207729024 GCATTTAGGGAGGCCTAGGCGGG + Intronic
921021163 1:211237005-211237027 GCATTTAGGGAGGCTGAGGCAGG - Intergenic
921648992 1:217654369-217654391 GCATTTCGGGAGGCAGAGGCAGG - Intronic
921837917 1:219796560-219796582 ACATTTTGGGAGGCAGAGGCTGG + Intronic
921867795 1:220104778-220104800 CCACTTTGGGAGGCAGAGGCAGG - Intronic
922626191 1:227046050-227046072 GCATTTTGGGAGGCTTAGGCGGG - Intronic
922641651 1:227238104-227238126 ACACTTTGGGAGGCATAGGCAGG + Intronic
922794061 1:228330416-228330438 GCATTTTGGGAGGCTTAGGCAGG + Intronic
923450428 1:234112092-234112114 GCACTTTGGGAGGCAGTGGCAGG + Intronic
923560004 1:235031902-235031924 GCACTTTGGGAGGCATAGGCGGG + Intergenic
923593941 1:235345676-235345698 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
923768231 1:236912861-236912883 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
924183767 1:241465594-241465616 CCACTTTGGGAGGCCTAGGCGGG - Intergenic
924718766 1:246603975-246603997 CCACTTTGGGAGGCCTAGGCGGG + Intronic
924726080 1:246672074-246672096 GCACTTAGGGAGGCTGTGGCAGG + Intergenic
924817153 1:247452447-247452469 CCATTTTGGGAGGTAGTGGTAGG + Intergenic
1063268008 10:4475414-4475436 GCATTTAGGGAGGCTGAGGCAGG + Intergenic
1063625739 10:7688319-7688341 GCATTTTGGGAGGCTTAGGCAGG + Intergenic
1063640326 10:7823382-7823404 CCACTTTGGGAGGCAGAGGCAGG + Intronic
1064356660 10:14624976-14624998 GCATTTTGGGAGGCCTAGGCAGG + Intronic
1064401964 10:15028982-15029004 CCATTTTGGGAGGCCAAGGCAGG - Intergenic
1064601373 10:16997187-16997209 GCACTTAGGGAGGCAAAGGCAGG + Intronic
1065004606 10:21367863-21367885 CAAATTAGCCAGGCATTGGCCGG - Intergenic
1065267024 10:23987129-23987151 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1065555830 10:26914653-26914675 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1065721573 10:28633111-28633133 GCATTTTGGGAGGCCTAGGCGGG + Intergenic
1065770654 10:29075011-29075033 CCATTTTGGGAGGCCGAGGCGGG - Intergenic
1066003095 10:31122905-31122927 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1066430142 10:35343634-35343656 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1067014141 10:42743467-42743489 GCATTTTGGGAGGCAAAGGCAGG - Intergenic
1067049662 10:43006611-43006633 ACACTTAGGGAGGCAGAGGCAGG - Intergenic
1067544140 10:47179767-47179789 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1068329811 10:55548182-55548204 GCATTTAGAGAGGGTTTGGCAGG - Intronic
1068631870 10:59306627-59306649 GCATTTAGGGAGGCCAAGGCAGG + Intronic
1068727572 10:60320345-60320367 GCATTTTGGGAGGCCTAGGCAGG + Intronic
1068818745 10:61348376-61348398 CCACTTTGGGAGGCCTAGGCAGG + Intergenic
1068842546 10:61631489-61631511 CCATTTTGGGAGGCAGGGGTGGG + Intergenic
1069733696 10:70637136-70637158 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1070128176 10:73638578-73638600 GCATTTTGGGAGGCCGTGGCTGG - Intronic
1070247103 10:74743115-74743137 GCACTTAGGGAGGCAGAGGCAGG - Intergenic
1070635807 10:78126315-78126337 GCACTTAGGGAGGCCATGGCGGG - Intergenic
1070818659 10:79341771-79341793 GCACTTTGGGAGGCCTTGGCGGG - Intergenic
1070909484 10:80105165-80105187 ACATTTAGGGAGGCCGAGGCAGG + Intergenic
1070971492 10:80571119-80571141 GCATTTTGGGAGGCAGTGGCAGG - Intronic
1071335421 10:84596543-84596565 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1071346512 10:84699047-84699069 CTATTTAGGGAGGAAGAGGCTGG + Intergenic
1071865367 10:89724278-89724300 GCATTTTGGGAGGCCTAGGCAGG + Intronic
1071968426 10:90877063-90877085 ACATTTTGGGAGGCCTAGGCAGG + Intronic
1072100096 10:92221244-92221266 GCATTTTGGGAGGCCATGGCAGG + Intronic
1072151225 10:92686210-92686232 ACATTTAGGGAGGCAGAGGCAGG + Intergenic
1072279337 10:93851860-93851882 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1072332062 10:94363579-94363601 GCACTTAGGGAGGCAGAGGCGGG + Intergenic
1072476267 10:95763169-95763191 GCATTTTGGGAGGCCTAGGCAGG - Intronic
1072568809 10:96640907-96640929 GCATTTAGGGAGGCTGAGGCGGG - Intronic
1072626989 10:97119048-97119070 CCATTCAGGCAGGCACTGCCTGG + Intronic
1072693707 10:97588056-97588078 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1072919395 10:99563265-99563287 CCATTTTGGGAGGCTAAGGCAGG - Intergenic
1073013535 10:100380544-100380566 GCATTTTGGGAGGCAGAGGCTGG + Intergenic
1073210385 10:101796504-101796526 GCACTTAGGGAGGCCTAGGCGGG - Intronic
1073240867 10:102057052-102057074 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1073276276 10:102314391-102314413 GCATTTTGGGAGGCCTAGGCGGG - Intronic
1073411838 10:103349292-103349314 GCACTTTGGGAGGCCTTGGCGGG - Intronic
1073442711 10:103562136-103562158 GCATTTTGGGAGGCCTAGGCGGG + Intronic
1074024857 10:109623939-109623961 CCATTTTGGGAGGCCAAGGCGGG + Intergenic
1074130004 10:110566085-110566107 GCATTTAGGGAGGCAGAGGTGGG + Intergenic
1074337300 10:112591143-112591165 CCATTCTGGGCAGCATTGGCAGG + Intronic
1074652918 10:115545121-115545143 CAATTTAGGGAGGCTGAGGCAGG + Intronic
1075415550 10:122259816-122259838 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
1075504728 10:123011778-123011800 GCATTTTGGGAGGCCATGGCGGG - Intronic
1075768426 10:124913484-124913506 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1076576831 10:131475061-131475083 CCATGTGGGAAGGCATTGGTGGG + Intergenic
1076699430 10:132263609-132263631 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1076741121 10:132486131-132486153 GCACTTAGGGAGGCTTAGGCGGG - Intergenic
1078164094 11:8867827-8867849 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1079062087 11:17258003-17258025 ACATTTTGGGAGGCAGAGGCAGG - Intronic
1079071080 11:17348191-17348213 CCACTTTGGGAGGCAGAGGCAGG - Intronic
1079899625 11:26165836-26165858 GCATTTAGGGACTCATTGGGAGG + Intergenic
1079941734 11:26689147-26689169 GCACTTAGGGAGGCCTAGGCAGG + Intronic
1081063114 11:38504369-38504391 GCACTTAGGGAGGCAGAGGCAGG + Intergenic
1081306366 11:41516801-41516823 CCATTTTGGGAGGCCGAGGCAGG - Intergenic
1081397042 11:42598631-42598653 CCAATTAGGAAGGCAGTAGCTGG + Intergenic
1081460253 11:43266257-43266279 CCACTTAGAGAGGCCATGGCGGG + Intergenic
1081572344 11:44299604-44299626 GCATTTTGGGAGGCCTAGGCGGG - Intronic
1082026295 11:47574966-47574988 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1082044375 11:47713091-47713113 CCACTTTGGGAGGCCTAGGCAGG + Intronic
1082114136 11:48309460-48309482 CCATTTTGGGAGGCCGAGGCAGG - Intergenic
1082170102 11:48993350-48993372 GCACTTTGGGAGGCAGTGGCAGG - Intergenic
1082238517 11:49849835-49849857 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1082611792 11:55308353-55308375 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1082625424 11:55478577-55478599 CCATTTTGGGAGGCTTAGGTGGG + Intergenic
1082658116 11:55875296-55875318 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
1082805348 11:57445717-57445739 GCATTTTGGGAGGCAAAGGCAGG + Intergenic
1083047323 11:59748755-59748777 GCATTTTGGGAGGCAGAGGCGGG - Intronic
1083456134 11:62779910-62779932 CCACTTTGGGAGGCAGAGGCGGG - Intronic
1083590520 11:63891198-63891220 GCACTTAGGGAGGCAGAGGCAGG - Intronic
1083688331 11:64391094-64391116 ACATTTAGGGAGGCCGAGGCAGG + Intergenic
1083985014 11:66208369-66208391 GCACTTTGGGAGGCAGTGGCAGG + Intronic
1084129914 11:67125523-67125545 TCACTTTGGGAGGCATAGGCAGG + Intronic
1084968234 11:72755555-72755577 GCACTTTGGGAGGCCTTGGCAGG - Intronic
1085032088 11:73278408-73278430 GCATTTTGGGAGGCCTAGGCGGG - Intronic
1085159172 11:74325334-74325356 CCATTTTGGGAGGCCGAGGCGGG - Intergenic
1085180946 11:74535553-74535575 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1085181089 11:74537021-74537043 GCATTTTGGGAGGCTTTGGCAGG - Intronic
1085213830 11:74809571-74809593 GCACTTAGGGAGGCCTAGGCAGG + Intronic
1085293278 11:75415424-75415446 GCATTTTGGGAGGCCTAGGCTGG + Intronic
1085421236 11:76362893-76362915 ACACTTTGGGAGGCCTTGGCCGG + Intronic
1086111558 11:83204187-83204209 GCATTTTGGGAGGCTGTGGCAGG - Intronic
1086346923 11:85906311-85906333 CCATTTGGGGAGGCTAAGGCTGG - Intronic
1086892112 11:92270430-92270452 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1087050355 11:93880763-93880785 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1087553854 11:99689279-99689301 GCATTTAGGGAGGCCAAGGCGGG + Intronic
1087560626 11:99785063-99785085 GCACTTTGGGAGGCATAGGCAGG - Intronic
1087843735 11:102947328-102947350 CCATTTTGGGAGGCTGAGGCAGG + Intronic
1087877182 11:103372263-103372285 CCACTTTGGGAGGCCTAGGCAGG - Intronic
1088191816 11:107235611-107235633 CCAGTTAGGGAGCCAATGTCGGG + Intergenic
1088225974 11:107620619-107620641 GCATTTTGGGAGGCCTAGGCGGG + Intronic
1088272205 11:108045343-108045365 CCATTTTGGGAGGCTGAGGCAGG + Intronic
1088521755 11:110709538-110709560 CCACTTAGGTAGTCAATGGCAGG + Intronic
1089078253 11:115756214-115756236 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1090041658 11:123297697-123297719 CCACTTAGGGAGGCCAAGGCAGG - Intergenic
1090391031 11:126387429-126387451 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1090755760 11:129789791-129789813 CCACTTTGGGAGGCTGTGGCGGG + Intergenic
1090792854 11:130106931-130106953 CCATTTTGGGAGGCCAAGGCAGG - Intronic
1090993565 11:131842762-131842784 GCATTTTGGGAGGCTGTGGCTGG + Intronic
1091182245 11:133617243-133617265 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1091645845 12:2271651-2271673 GCATTTAGGGAGGCCGAGGCAGG + Intronic
1091665094 12:2413261-2413283 CCATTTTGGGAGGCTGAGGCGGG - Intronic
1091756698 12:3057306-3057328 CCATTTTGGGAGGCTGAGGCAGG - Intergenic
1091868679 12:3868212-3868234 CCACTTTGGGAGGCCTAGGCGGG + Intronic
1091908614 12:4210455-4210477 CAATTTGGGGAGCCCTTGGCAGG + Intergenic
1092092492 12:5814255-5814277 CCATTTACAAAGGGATTGGCAGG - Intronic
1092251705 12:6902377-6902399 GCATTTTGGGAGGCCTAGGCGGG - Intronic
1092357123 12:7805311-7805333 GCATTTTGGGAGGCCTAGGCGGG + Intergenic
1092372428 12:7928151-7928173 GCATTTAGGAAGGCCGTGGCAGG + Intronic
1092823794 12:12378123-12378145 GCATTTTGGGAGGCCTAGGCGGG + Intronic
1093026003 12:14246034-14246056 GCACTTAGGGAGGCAGAGGCGGG - Intergenic
1093478423 12:19580279-19580301 CCATTTAGGCAGGATTTGGCAGG - Intronic
1093634438 12:21447738-21447760 GCACTTTGGGAGGCCTTGGCGGG + Intronic
1093935130 12:24992870-24992892 GCATTTAGGGAGGCAGAGGCAGG - Intergenic
1094144667 12:27215784-27215806 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1094212808 12:27910287-27910309 GCACTTTGGGAGGCCTTGGCGGG - Intergenic
1094662833 12:32487671-32487693 GCATTTTGGGAGGCAAAGGCGGG - Intronic
1094820853 12:34223052-34223074 ACATTTTGGGAGGCAAAGGCAGG + Intergenic
1094823905 12:34251802-34251824 GCACTTTGGGAGGCATAGGCGGG + Intergenic
1095474678 12:42573779-42573801 CCATTTTGGGAGGCCAAGGCGGG - Intronic
1095741003 12:45607208-45607230 CCACTTTGGGAGGCAGAGGCGGG + Intergenic
1096158308 12:49355134-49355156 CCATTTTGGGAGGCCAAGGCAGG + Intronic
1096228684 12:49885372-49885394 CCCTAGAGGGAGGCATTTGCAGG - Intronic
1096262190 12:50099854-50099876 CCATTAAGGGATGCAGAGGCAGG - Exonic
1096275858 12:50207640-50207662 CCATTTTGGGAGGCCAAGGCGGG + Intronic
1096290072 12:50334722-50334744 ACATTTTGGGAGGCTGTGGCAGG - Intronic
1096327091 12:50673538-50673560 GCACTTTGGGAGGCATTGGTGGG + Intronic
1096726447 12:53566996-53567018 GCACTTAGGGAGGCAGAGGCGGG - Intronic
1096981636 12:55731115-55731137 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1097051111 12:56223899-56223921 GCACGTAGGGAGGCATAGGCTGG - Intronic
1097542826 12:60961704-60961726 GCACTTAGGGAGGCAGAGGCGGG - Intergenic
1097670932 12:62536933-62536955 CCATTTTGGGAGGCTGAGGCAGG - Intronic
1098390045 12:69960187-69960209 GCATTTAGGGAGGCCAAGGCGGG + Intergenic
1098934342 12:76461132-76461154 GCATTTTGGGAGGCAGAGGCTGG - Intronic
1099317463 12:81102574-81102596 CCATTTTGGGAGGCCGAGGCGGG + Intronic
1099345742 12:81497783-81497805 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1099698839 12:86059286-86059308 GCACTTAGGGAGGCAGAGGCAGG - Intronic
1100011353 12:89957262-89957284 GCACTTTGGGAGGCAGTGGCAGG - Intergenic
1100303467 12:93328859-93328881 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1100316189 12:93446899-93446921 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1100371395 12:93972054-93972076 GCACTTTGGGAGGCATTGGTGGG + Intergenic
1100544709 12:95590661-95590683 GCATTTTGGGAGGCTGTGGCAGG - Intergenic
1100922100 12:99499751-99499773 CAATTTGGGGAGGGCTTGGCAGG - Intronic
1100988801 12:100230270-100230292 CCACTTTGGGAGGCAGAGGCAGG + Intronic
1101114168 12:101515994-101516016 GCATTTAGGGAGGCTGAGGCAGG - Intergenic
1101119086 12:101560654-101560676 ACATTTTGGGAGGCAGAGGCGGG - Intergenic
1101301941 12:103492202-103492224 GCATTTTGGGAGGCCATGGCAGG - Intronic
1101410759 12:104466104-104466126 GCATTTTGGGAGGCCGTGGCGGG - Intronic
1101464982 12:104939447-104939469 GCACTTTGGGAGGCATAGGCAGG - Intronic
1101480992 12:105096955-105096977 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1102104745 12:110311789-110311811 GCATTTTGGGAGGCCATGGCAGG + Intronic
1102278757 12:111601656-111601678 GCACTTTGGGAGGCAGTGGCCGG + Intergenic
1102310973 12:111844066-111844088 CCATTTTGGGAGGCCAAGGCGGG - Intronic
1102673073 12:114636564-114636586 GCATTTAGGGAGGCAGATGCAGG + Intergenic
1102698891 12:114822133-114822155 GCATTTTGGGAGGCACAGGCGGG - Intergenic
1102850647 12:116241060-116241082 GCATTTTGGGAGGCAGAGGCGGG + Intronic
1102865468 12:116370695-116370717 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1103355307 12:120315469-120315491 GCACTTTGGGAGGCATAGGCGGG + Intergenic
1103401727 12:120647826-120647848 GCACTTTGGGAGGCATAGGCAGG - Intronic
1103533186 12:121616767-121616789 GCATTTTGGGAGGCCATGGCAGG + Intergenic
1103643001 12:122367770-122367792 CCATTTTGGGAGGCCAAGGCAGG + Intronic
1103659536 12:122502605-122502627 GTATTTAGGGAGGCAGAGGCAGG - Intergenic
1103714473 12:122935957-122935979 GCACTTAGGGAGGCAGAGGCAGG + Intronic
1103873088 12:124105362-124105384 GCATTTTGGGAGGCCTAGGCGGG - Intronic
1104022816 12:125005092-125005114 GCATTTTGGGAGGCCATGGCAGG - Intronic
1104228411 12:126859678-126859700 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1104396892 12:128441746-128441768 CCATTTTGGGAGGCCGAGGCGGG + Intronic
1104505911 12:129331962-129331984 GCATTTTGGGAGGCAGAGGCGGG + Intronic
1104618865 12:130294409-130294431 CCATTTTGGGAGGCCAAGGCAGG + Intergenic
1105043005 12:132976653-132976675 CCACTTTGGGAGGCAAAGGCGGG + Intergenic
1105269986 13:18863978-18864000 GCACTTTGGGAGGCATAGGCGGG + Intergenic
1105709755 13:22995743-22995765 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1105728547 13:23188563-23188585 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1105742845 13:23346388-23346410 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1105933212 13:25071644-25071666 GCATTTTGGGAGGCCATGGCAGG + Intergenic
1106452464 13:29895322-29895344 CCATCTAGGGAGGCCAAGGCAGG - Intergenic
1107072378 13:36285300-36285322 CCATTTTGGGAGGCTGAGGCTGG + Intronic
1107129843 13:36883502-36883524 GCACTTTGGGAGGCTTTGGCAGG + Intronic
1107135803 13:36942694-36942716 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1107229906 13:38096408-38096430 ACACTTTGGGAGGCCTTGGCGGG - Intergenic
1108213191 13:48158805-48158827 CCACTTTGGGAGGCCATGGCAGG - Intergenic
1108676851 13:52744501-52744523 GCATTTTGGGAGGCAAAGGCGGG - Intergenic
1108689118 13:52846575-52846597 ACTTCTAGGGAGCCATTGGCTGG + Exonic
1108751201 13:53450056-53450078 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1108877917 13:55071329-55071351 CCACTTTGGGAGGCCTAGGCAGG - Intergenic
1109146096 13:58781715-58781737 GCATTTTGGGAGGCTTAGGCGGG - Intergenic
1109424137 13:62150064-62150086 CCATTTGGGGGGGCATTATCAGG + Intergenic
1109785924 13:67174883-67174905 CCATTTTGGGAGGCTGAGGCTGG + Intronic
1110068875 13:71147189-71147211 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1110076692 13:71254687-71254709 ACATTTTGGGAGGCCATGGCGGG + Intergenic
1110260796 13:73482994-73483016 CCAGTCGGGGAGGCCTTGGCTGG - Intergenic
1110450399 13:75634083-75634105 CCACTTTGGGAGGCAGAGGCGGG - Intronic
1110879914 13:80559064-80559086 GCACTTAGGGAGGCCTAGGCGGG - Intergenic
1111196536 13:84881935-84881957 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1111564524 13:89997551-89997573 ACATTTTGGGAGGCCTAGGCAGG - Intergenic
1111842500 13:93467835-93467857 ACACTTTGGGAGGCCTTGGCGGG - Intronic
1112121483 13:96416994-96417016 GCATTTCGGGAGGCAGAGGCGGG - Intronic
1112429251 13:99335906-99335928 GCACTTAGGGAGGCAGAGGCAGG + Intronic
1112513456 13:100030961-100030983 ACATTTTGGGAGGCAGAGGCAGG + Intergenic
1112529829 13:100190434-100190456 GCATTTTGGGAGGCCTGGGCAGG + Intronic
1112647027 13:101345551-101345573 GCACTTTGGGAGGCATAGGCAGG + Intronic
1113004963 13:105690407-105690429 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1113110300 13:106815647-106815669 CCATGTAGGCAGCCAGTGGCTGG - Intergenic
1113189038 13:107722554-107722576 CCCGCTAGGGAGGCACTGGCAGG - Intronic
1113553067 13:111208284-111208306 ACACTTAGGGAGGCAGAGGCTGG - Intronic
1114155317 14:20096397-20096419 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1114296183 14:21331274-21331296 GCACTTTGGGAGGCATGGGCGGG + Intronic
1115088692 14:29548038-29548060 CCATTTTGGGAGGCAGAGGTGGG + Intergenic
1115089384 14:29555716-29555738 CCATTTTGGGAGGCCGAGGCGGG + Intergenic
1115402837 14:32982461-32982483 GCACTTAGGGAGGCAGAGGCAGG + Intronic
1115600174 14:34948564-34948586 GCATTTTGGGAGGCAAAGGCAGG + Intergenic
1115740756 14:36385348-36385370 CCAATAAGGGAGGTATTGGCAGG + Intergenic
1116077901 14:40135363-40135385 CCATTTTGGGAGGCCGAGGCAGG - Intergenic
1116270756 14:42762308-42762330 ACATTTTGGGAGGCAGAGGCAGG - Intergenic
1116338002 14:43683668-43683690 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1116379648 14:44249653-44249675 GCATTTAGGAAGGCAGAGGCAGG + Intergenic
1116917750 14:50541772-50541794 GCATTTAGGGAGGCCGAGGCAGG + Intronic
1117031056 14:51670891-51670913 CCATTTTGGGAGGCCGAGGCAGG - Intronic
1117316561 14:54576833-54576855 CCCTTTAGGCAGACAGTGGCTGG - Intronic
1117330092 14:54703619-54703641 CCACTTTGGGAGGCCTAGGCGGG + Intronic
1117360584 14:54969270-54969292 GCACTTTGGGAGGCATAGGCGGG - Intronic
1117696434 14:58369377-58369399 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1118020062 14:61702179-61702201 CCATTTTGGGAGGCCGGGGCAGG + Intronic
1118207488 14:63736782-63736804 CCACTTTGGGAGGCAGAGGCTGG - Intergenic
1118213170 14:63784723-63784745 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1118258958 14:64229930-64229952 GCACTTTGGGAGGCCTTGGCAGG + Intronic
1118769827 14:68935268-68935290 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1119034501 14:71218236-71218258 GCACTTTGGGAGGCCTTGGCAGG - Intergenic
1119058394 14:71447813-71447835 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1119240359 14:73054436-73054458 GCATTTTGGGAGGCTGTGGCAGG + Intergenic
1119256219 14:73199991-73200013 GCATTTTGGGAGGCCTAGGCAGG - Intronic
1119311205 14:73648222-73648244 CCATTTTGGGAGGCCTGGGTGGG - Intronic
1119348980 14:73948863-73948885 GCACTTTGGGAGGCCTTGGCTGG + Intronic
1119808197 14:77496535-77496557 GCACTTAGGGAGGCCTAGGCAGG + Intronic
1120340022 14:83207864-83207886 CCACTTAGGGAGGCTGAGGCAGG + Intergenic
1120995781 14:90417795-90417817 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1121079038 14:91092835-91092857 CCATTTTGGGAGGCCGAGGCAGG + Intronic
1121239915 14:92421751-92421773 CCACTTTGGGAGGCAGAGGCAGG - Intronic
1121361264 14:93262377-93262399 CCATTTTGGGAGGCCAAGGCAGG - Intronic
1121411276 14:93749932-93749954 GCATTTTGGGAGGCCTAGGCGGG + Intronic
1121724320 14:96135445-96135467 CCATATAGGGAGACATTCGTGGG + Intergenic
1121801287 14:96776193-96776215 CCTTGAAGGGAGGCTTTGGCTGG + Intergenic
1122569100 14:102682374-102682396 ACATTTTGGGAGGCCATGGCAGG - Intronic
1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG + Intronic
1123015286 14:105370804-105370826 CCACTTTGGGAGGCAGAGGCAGG - Intronic
1123044874 14:105506950-105506972 ACATTTTGGGAGGCAGAGGCGGG - Intergenic
1123093658 14:105753893-105753915 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1123681512 15:22767609-22767631 CCACTTTGGGAGGCCTAGGCAGG - Intergenic
1123702151 15:22922743-22922765 CCACTTTGGGAGGCAAAGGCGGG + Intronic
1124079557 15:26478874-26478896 GCATTTAGGGAGGCAGAGGCGGG - Intergenic
1124333726 15:28842066-28842088 CCACTTTGGGAGGCCTAGGCGGG - Intergenic
1124446956 15:29743932-29743954 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1124697634 15:31878778-31878800 CTATTTTGGGAGGCAGAGGCGGG - Intergenic
1124922570 15:34040679-34040701 GCATTTTGGGAGGCTGTGGCGGG + Intronic
1125026903 15:35039776-35039798 GCACTTTGGGAGGCCTTGGCAGG - Intergenic
1125403122 15:39325418-39325440 CAATTTAGGGAGGCCATGGCAGG - Intergenic
1125708474 15:41763909-41763931 CCCCTTAGGGAGGCAGAGGCAGG + Intronic
1125989032 15:44087265-44087287 ACATTTAGGGAGGCTGTGGCGGG - Intronic
1126014375 15:44336057-44336079 CCACTTTGGGAGGCAGAGGCGGG - Intronic
1126136375 15:45396409-45396431 CAATTTAGGGAGAGATTGGAGGG + Intronic
1126459040 15:48895834-48895856 CCACTTAGGGAGGCCGAGGCAGG + Intronic
1126794414 15:52248390-52248412 GCATTTTGGGAGGCAGAGGCGGG - Intronic
1126910841 15:53415610-53415632 CCATTTTGGGAGGCCAAGGCAGG - Intergenic
1126951287 15:53884579-53884601 GCATTTTGGGAGGCCATGGCAGG - Intergenic
1127241266 15:57117276-57117298 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1127398728 15:58564479-58564501 GCACTTTGGGAGGCCTTGGCGGG + Intronic
1127545061 15:59985933-59985955 CCATTTTGGGAGGCCATGGCAGG + Intergenic
1128124295 15:65180653-65180675 GCATTTTGGGAGGCCTAGGCGGG + Intronic
1128279031 15:66379133-66379155 GCATTTTGGGAGGCAGAGGCGGG - Intronic
1129195196 15:73960398-73960420 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1129327475 15:74808696-74808718 GCATTTAGGGAGGCCAAGGCCGG - Intergenic
1129814002 15:78535961-78535983 GCATTTAGGGAGGCCAAGGCAGG - Exonic
1130002972 15:80063795-80063817 GCATTTTGGGAGGCCTAGGCAGG - Intronic
1130078533 15:80710821-80710843 GCACTTAGGGAGGCAGAGGCAGG - Intronic
1130383780 15:83393904-83393926 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1130627348 15:85529173-85529195 GCATTTTGGGAGGCCTAGGCGGG + Intronic
1132040208 15:98518829-98518851 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1132940524 16:2504981-2505003 GAATTTAGGGAGGCAGAGGCGGG - Intronic
1132949599 16:2553585-2553607 CCATTTTGGGAGGCCAAGGCAGG - Intronic
1132964749 16:2646582-2646604 CCATTTTGGGAGGCCAAGGCAGG + Intergenic
1133057909 16:3156306-3156328 GCATTTAGGGAGGCCAAGGCAGG - Intergenic
1133070214 16:3241753-3241775 GCATTTTGGGAGGCAAAGGCGGG - Intergenic
1133128154 16:3659971-3659993 ACATTTTGGGAGGCCTAGGCGGG - Exonic
1133152630 16:3847920-3847942 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1133842223 16:9420241-9420263 GCACTTTGGGAGGCATAGGCGGG + Intergenic
1133848642 16:9480824-9480846 CCATTTTGGGAGGCCAAGGCAGG - Intergenic
1134672893 16:16068738-16068760 CCATTTTGGGAGGCTGAGGCGGG + Intronic
1135765129 16:25170982-25171004 GCACTTTGGGAGGCATAGGCGGG + Intronic
1135770111 16:25211782-25211804 CCATTTTGGGAGGCCGAGGCAGG - Intergenic
1135771796 16:25223451-25223473 GCATTTTGGGAGGCAGAGGCGGG + Intronic
1135891894 16:26365052-26365074 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1136041941 16:27586359-27586381 GCATTTTGGGAGGCTTAGGCAGG + Intronic
1136057489 16:27701267-27701289 GCATTTTGGGAGGCTGTGGCAGG - Intronic
1136128732 16:28204948-28204970 GCATTTTGGGAGGCCTAGGCAGG + Intronic
1136341050 16:29643684-29643706 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
1137294500 16:47077387-47077409 ACATTTTGGGAGGCCTAGGCGGG + Intergenic
1137427424 16:48391422-48391444 GCATTTAGGGAGGCCTAGGTGGG - Intronic
1137567786 16:49544231-49544253 CCTTTGAGGGAGGCAATAGCAGG + Intronic
1138007404 16:53350715-53350737 TCATTTAGGGAGGCCAAGGCAGG + Intergenic
1138011038 16:53380409-53380431 CCACTTTGGGAGGCCTAGGCGGG - Intergenic
1138090517 16:54170039-54170061 CCACTTTGGGAGGCCTAGGCAGG + Intergenic
1138267048 16:55667141-55667163 GCATTTAGGGAGGCCAAGGCAGG - Intronic
1138364566 16:56463666-56463688 CTATTTTGGGAGGCAAAGGCAGG - Intronic
1138413088 16:56854909-56854931 GCACTTAGGGAGGCCTAGGCAGG + Intergenic
1138548197 16:57731834-57731856 ACATTTAGGGAGGCTGAGGCAGG + Intergenic
1138697177 16:58825421-58825443 ACATTTTGGGAGGCCTAGGCGGG - Intergenic
1138833161 16:60400708-60400730 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
1139452191 16:67037913-67037935 CCACTTTGGGAGGCAGAGGCAGG - Intronic
1139694257 16:68662344-68662366 CCACTTGGGGAGGCAGAGGCAGG + Intronic
1139749237 16:69098909-69098931 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
1139819450 16:69709132-69709154 GCATTTTGGGAGGCAAAGGCGGG - Intronic
1140055236 16:71520133-71520155 GCATTTTGGGAGGCCTAGGCAGG + Intronic
1140088595 16:71818643-71818665 GCATTTTGGGAGGCCATGGCGGG - Intergenic
1140166189 16:72554434-72554456 CCACTTTGGGAGGCAGAGGCAGG + Intergenic
1140206177 16:72935492-72935514 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1140282195 16:73565004-73565026 CCATTTTGGGAGGCCAAGGCGGG + Intergenic
1140500609 16:75430708-75430730 TCACTTAGGGAGGCAGAGGCTGG - Intronic
1141097011 16:81170142-81170164 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1141146443 16:81533723-81533745 GCACTTAGGGAGGCAGAGGCAGG - Intronic
1142524798 17:532504-532526 GCATTTCGGGAGGCCTGGGCAGG - Intronic
1142816617 17:2431191-2431213 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1143188922 17:5027374-5027396 ACATTTTGGGAGGCAGAGGCGGG - Exonic
1143196416 17:5079273-5079295 GCATTTTGGGAGGCCTAGGCGGG + Intronic
1143507313 17:7374731-7374753 GCATTTGGGGAGGCAGAGGCAGG + Intergenic
1143550726 17:7628807-7628829 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1143836188 17:9694868-9694890 CCACTTTGGGAGGCAGAGGCAGG - Intronic
1144186715 17:12803351-12803373 GCATTTAGGGAGGCAGAGGCAGG - Intronic
1144368355 17:14567113-14567135 ACACTTCGGGAGGCAGTGGCAGG - Intergenic
1144391069 17:14793910-14793932 GCATTTTGGGAGGCTTAGGCAGG - Intergenic
1144473892 17:15567580-15567602 CCATTTTGGGAGGCTGGGGCAGG + Intronic
1144692259 17:17275331-17275353 ACATTTTGGGAGGCAGAGGCAGG - Intronic
1145071332 17:19811006-19811028 TCATTTAGGGAGGCAGAGGCGGG + Intronic
1145076891 17:19862965-19862987 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1145222185 17:21098582-21098604 ACATTTTGGGAGGCCGTGGCGGG + Intergenic
1145301158 17:21638718-21638740 CCATTTTGGGAGGCCGAGGCAGG - Intergenic
1145949538 17:28805286-28805308 CCACTTTGGGAGGCCATGGCAGG + Intronic
1146027663 17:29336559-29336581 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1146167852 17:30604600-30604622 GCATTTTGGGAGGCAGAGGCTGG - Intergenic
1147112209 17:38271582-38271604 GCATTTAGGGAGGCTGAGGCAGG - Intergenic
1147191605 17:38741139-38741161 GCATTTTGGGAGGCTGTGGCAGG + Intronic
1147233435 17:39037307-39037329 GCATTTTGGGAGGCATAGGCAGG + Intergenic
1147247199 17:39130204-39130226 GCATTTAGGGAGGCCAAGGCAGG + Intronic
1147257148 17:39188327-39188349 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1147465810 17:40609723-40609745 ACATTTTGGGAGGCAGAGGCAGG + Intergenic
1147521903 17:41181367-41181389 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1147587909 17:41663310-41663332 CCACTTTGGGAGGCCTAGGCGGG - Intergenic
1147608583 17:41787918-41787940 GCATTTTGGGAGGCAAAGGCGGG + Intergenic
1147813641 17:43192266-43192288 CCATTTTGGGAGGCCAAGGCGGG - Intronic
1147993096 17:44346867-44346889 CCACTTTGGGAGGCCGTGGCAGG + Intronic
1148035062 17:44654255-44654277 GCATTTAGGGAAGCAAAGGCAGG - Intergenic
1148041335 17:44709565-44709587 GCATTTTGGGAGGCCTAGGCAGG - Intronic
1148433353 17:47661351-47661373 GCACTTAGGGAGGCCATGGCAGG + Intronic
1148933015 17:51142366-51142388 ACATTTTGGGAGGCTTAGGCGGG + Intergenic
1148940544 17:51206352-51206374 GCTTTTAGGGAGGCAGAGGCGGG - Intronic
1149481974 17:57010850-57010872 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1149704659 17:58684213-58684235 GCACTTTGGGAGGCCTTGGCGGG + Intronic
1149828497 17:59850803-59850825 GCATTTTGGGAGGCAGAGGCTGG + Intergenic
1150068433 17:62131581-62131603 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1150127864 17:62650139-62650161 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1150223776 17:63511684-63511706 GCATTTTGGGAGGCCTAGGCAGG - Intronic
1150454943 17:65299787-65299809 GCACTTTGGGAGGCCTTGGCGGG + Intergenic
1150569148 17:66370439-66370461 ACAGTTAGTGAGGCATTGCCAGG + Intronic
1150885992 17:69086330-69086352 CCATTTATGGATGCATTCACTGG + Intronic
1151084711 17:71366855-71366877 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1151090575 17:71435441-71435463 CCATTTAGGGAGGTGATAGCGGG + Intergenic
1151186566 17:72369048-72369070 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
1151288318 17:73129727-73129749 GCTTTTAGGGAGGCAGAGGCGGG - Intergenic
1151524641 17:74656230-74656252 GCATTTAGGGAGGCAGAGGCAGG + Intergenic
1151566850 17:74903366-74903388 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1151691291 17:75687367-75687389 GCATTTTGGGAGGCTGTGGCAGG + Intronic
1151853170 17:76703373-76703395 GCATTTTGGGAGGCAGCGGCTGG + Intronic
1152198523 17:78931630-78931652 GCATTTAGGGAGGCCGAGGCAGG - Intergenic
1152417763 17:80174089-80174111 GCACTTAGGGAGGCAGAGGCGGG + Intronic
1152555641 17:81051934-81051956 GCATTTTGGGAGGCAGAGGCGGG - Intronic
1152707856 17:81854290-81854312 CCATTTTGGGAGGCTGAGGCAGG + Intronic
1152819783 17:82431405-82431427 GCACTTAGGGAGGCAGAGGCGGG - Intronic
1152838808 17:82553180-82553202 GCACTTTGGGAGGCCTTGGCAGG - Intronic
1152886977 17:82858158-82858180 GCATTTAGGGAGGCTGAGGCGGG - Intronic
1153187425 18:2500856-2500878 CCATTTTGGGAGGCTGAGGCAGG - Intergenic
1153359583 18:4178320-4178342 CCATCTAGGGAGGCCGAGGCAGG - Intronic
1154418053 18:14196001-14196023 GCACTTTGGGAGGCATAGGCGGG - Intergenic
1155058491 18:22206431-22206453 GCATTTTGGGAGGCTTAGGCGGG + Intergenic
1155262534 18:24058406-24058428 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1155593134 18:27451623-27451645 ACATTTTGGGAGGCAGAGGCAGG - Intergenic
1155615491 18:27716694-27716716 ACATTCAGGGAGGCTGTGGCAGG - Intergenic
1155731208 18:29160992-29161014 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1156322879 18:36044439-36044461 GCATTTTGGGAGGCAGAGGCGGG + Intronic
1156375946 18:36515461-36515483 CCACTTTGGGAGGCAGAGGCGGG - Intronic
1156755171 18:40514690-40514712 GCATTTTGGGAGGCCGTGGCTGG + Intergenic
1157359103 18:46962572-46962594 CCAAGCAGGGAGGCAGTGGCTGG + Intronic
1157360097 18:46968499-46968521 CCAAGCAGGGAGGCAGTGGCTGG + Intronic
1157360697 18:47022091-47022113 CCAAGCAGGGAGGCAGTGGCTGG + Intronic
1157361686 18:47028006-47028028 CCAAGCAGGGAGGCAGTGGCTGG + Intronic
1157635937 18:49154639-49154661 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1158139252 18:54240292-54240314 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1158296515 18:56002785-56002807 ACATTTTGGGAGGCCTAGGCGGG - Intergenic
1158505290 18:58042261-58042283 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1158959650 18:62579012-62579034 CCACTTTGGGAGGCAGAGGCAGG - Intronic
1158968406 18:62643783-62643805 CCATTTTGGGAGGCTGAGGCAGG + Intergenic
1159029357 18:63214953-63214975 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1159412317 18:68095285-68095307 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1160208063 18:76853323-76853345 GCATTTTGGGAGGCCATGGCAGG - Intronic
1160304894 18:77723140-77723162 GCATTTTGGGAGGCAAAGGCAGG - Intergenic
1160758068 19:768258-768280 CCATTTTGGGAGGCCGAGGCGGG + Intergenic
1160925047 19:1540273-1540295 GCATTTTGGGAGGCCTAGGCGGG - Intergenic
1161066078 19:2238266-2238288 CCACTTTGGGAGGCCGTGGCAGG - Intronic
1161113419 19:2482609-2482631 CCATTTTGGGAGGCCAAGGCAGG - Intergenic
1161150234 19:2703706-2703728 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1161262956 19:3347629-3347651 CCATTTTGGGAGGCCGAGGCAGG + Intergenic
1161697555 19:5777960-5777982 GCATTTTGGGAGGCAGAGGCGGG + Intronic
1161863349 19:6815940-6815962 ACATTTAGGGAGGCTGAGGCAGG + Intronic
1161922566 19:7277549-7277571 ACATATTGGGAGGCATAGGCGGG + Intronic
1162102144 19:8345617-8345639 CTATTTAGGGAGGCTGAGGCAGG - Intronic
1162117575 19:8440451-8440473 GCATTTTGGGAGGCTTCGGCAGG + Intronic
1162323959 19:9987488-9987510 ACATTTTGGGAGGCAGAGGCTGG + Intronic
1162370049 19:10273110-10273132 GCATTTTGGGAGGCTTAGGCGGG + Intronic
1162422090 19:10571417-10571439 GCATTTTGGGAGGCCGTGGCGGG + Intergenic
1162464484 19:10831759-10831781 CCCATCAGGGAGGCATGGGCGGG - Exonic
1162485788 19:10960103-10960125 GCACTTAGGGAGGCCTAGGCTGG - Intergenic
1162502916 19:11064758-11064780 GCATTTTGGGAGGCAGAGGCGGG - Intronic
1162527094 19:11212486-11212508 GCATTTTGGGAGGCCTAGGCAGG - Intronic
1162627730 19:11898751-11898773 CCATTTAGGGAGGCCAAAGCAGG + Intronic
1162897746 19:13775529-13775551 GCATTTTGGGAGGCAGAGGCGGG - Intronic
1162932564 19:13964335-13964357 ACATTTTGGGAGGCAAAGGCAGG - Intronic
1163031824 19:14549696-14549718 GCACTTAGGGAGGCTTAGGCGGG + Intronic
1163135443 19:15307866-15307888 GCATTTTGGGAGGCCCTGGCGGG + Intronic
1163608013 19:18286345-18286367 CTATTTAGGGAGGCTGAGGCAGG - Intergenic
1163859750 19:19736031-19736053 GCACTTTGGGAGGCCTTGGCGGG - Intergenic
1163926410 19:20348667-20348689 GCACTTTGGGAGGCTTTGGCAGG + Intergenic
1163970994 19:20795119-20795141 ACATTTTGGGAGGCAGAGGCGGG - Intronic
1164226208 19:23248746-23248768 CCACTTAGGGAGGCTGAGGCCGG + Intronic
1164570156 19:29368520-29368542 TCATTTTGGGAGGCCTTGGAGGG + Intergenic
1164956564 19:32391854-32391876 GCATTTTGGGAGGCAAAGGCAGG + Intergenic
1164974524 19:32561961-32561983 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1165039791 19:33060916-33060938 CCAGGCAGGGAGGCATTGGGAGG - Intronic
1165238742 19:34446123-34446145 GCACTTAGGGAGGCAGAGGCTGG - Intronic
1165837209 19:38766081-38766103 CCATTTTGGGAGGCTGAGGCAGG + Intronic
1165896838 19:39146591-39146613 CCATTTGGGGAGGCCAAGGCAGG + Intronic
1165959647 19:39523438-39523460 GCACTTAGGGAGGCAGAGGCGGG + Intergenic
1166228629 19:41412622-41412644 CCATTTTGGGAGGCCAAGGCAGG - Intronic
1166591774 19:44005640-44005662 GCATTTTGGGAGGCAACGGCGGG + Intronic
1166689224 19:44812701-44812723 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1166757011 19:45198951-45198973 GCATTTAGGGAGGCTGAGGCGGG - Exonic
1166813883 19:45529978-45530000 GCACTTTGGGAGGCTTTGGCAGG - Intronic
1166878115 19:45910485-45910507 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1167059093 19:47132207-47132229 CCACTTTGGGAGGCTGTGGCGGG - Intronic
1167382112 19:49144465-49144487 GCATTTTGGGAGGCTTTGGATGG + Intronic
1167979451 19:53260977-53260999 GCACTTTGGGAGGCCTTGGCGGG - Intronic
1168501122 19:56894446-56894468 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1168639132 19:58019269-58019291 ACATTTTGGGAGGCAGAGGCAGG - Intergenic
1168674070 19:58264145-58264167 GCATTTCGGGAGGCAAAGGCAGG + Intronic
924989650 2:301682-301704 GCACTTTGGGAGGCATAGGCGGG - Intergenic
925759068 2:7166709-7166731 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
926862724 2:17325939-17325961 GCATTTTGGGAGGCCGTGGCGGG + Intergenic
927551693 2:24006695-24006717 ACACTTAGGGAGGCAGAGGCAGG + Intergenic
927627228 2:24734546-24734568 CCATTTTGAGAGGCGTAGGCAGG + Intronic
927687425 2:25181186-25181208 GCATTTTGGGAGGCTTAGGCGGG - Intergenic
927775284 2:25898101-25898123 CCATTTTGGGAGGCCGAGGCGGG - Intergenic
927794512 2:26036412-26036434 GCACTTTGGGAGGCCTTGGCGGG + Intronic
927928501 2:27028968-27028990 CCATTTTGGGAGGCCAAGGCAGG + Intergenic
927951032 2:27169612-27169634 GCATTTTGGGAGGCCTAGGCGGG + Intergenic
927978528 2:27358489-27358511 GCACTTTGGGAGGCATAGGCAGG - Intergenic
927985274 2:27405754-27405776 GCATTTTGGGAGGCAGAGGCGGG + Intronic
928294023 2:30066939-30066961 GCACTTAGGGAGGCAGAGGCAGG + Intergenic
928308373 2:30190178-30190200 GCACTTTGGGAGGCATAGGCAGG + Intergenic
928744614 2:34396711-34396733 GCACTTTGGGAGGCCTTGGCAGG - Intergenic
929458654 2:42085062-42085084 CCACTTAGGGAGGCCAAGGCAGG + Intergenic
929679121 2:43970851-43970873 GCATTTTGGGAGGCTGTGGCGGG + Intronic
929772745 2:44906248-44906270 GCATTTTGGGAGGCAGAGGCTGG + Intergenic
930039939 2:47114122-47114144 GCACTTAGGGAGGCAGAGGCAGG + Intronic
930135318 2:47897448-47897470 GCATTTTGGGAGGCTTAGGCGGG + Intronic
931372515 2:61676993-61677015 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
931488805 2:62722367-62722389 CCATTTTGGGAGGCCAAGGCAGG - Intronic
931526926 2:63166637-63166659 ACATTTAGGGAGGCTGAGGCAGG - Intronic
931776260 2:65543482-65543504 CCATTTTGGGAGGCCAAGGCGGG - Intergenic
932045408 2:68343908-68343930 GCACTTTGGGAGGCATAGGCAGG - Intergenic
932765825 2:74469199-74469221 GCACTTTGGGAGGCTTTGGCGGG - Intergenic
933158059 2:78995642-78995664 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
933202104 2:79463163-79463185 CCATTTTGGGAGGCCGAGGCAGG + Intronic
933491143 2:82986334-82986356 CCATTTTGGGAGGCCCAGGCGGG - Intergenic
933660946 2:84926642-84926664 GGATTTTGGGAGGCCTTGGCGGG - Intergenic
933720279 2:85393280-85393302 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
933758015 2:85655572-85655594 GCACTTAGGGAGGCAGAGGCAGG + Intergenic
934030327 2:88039438-88039460 GCATTTTGGGAGGCAGAGGCGGG + Intronic
934542379 2:95186594-95186616 GCATTTAGGGAGGCTAAGGCGGG - Intergenic
934760439 2:96852819-96852841 GCACTTAGGGAGGCAGAGGCAGG + Intronic
934785870 2:97005181-97005203 GCATTTTGGGAGGCAGAGGCAGG + Intronic
935044321 2:99466486-99466508 GCACTTTGGGAGGCATAGGCGGG - Intronic
935381608 2:102457087-102457109 GCACTTAGGGAGGCAAAGGCAGG - Intergenic
935460608 2:103328734-103328756 GCACTTTGGGAGGCTTTGGCAGG - Intergenic
935470326 2:103451907-103451929 GCATTTTGGGAGGCAAAGGCAGG - Intergenic
935643409 2:105311650-105311672 CCATTTTGGGAGGCTGAGGCAGG + Intronic
936079174 2:109420689-109420711 GCATTTAGGGAGGCCAAGGCGGG - Intronic
936168453 2:110145534-110145556 GCACTTTGGGAGGCCTTGGCGGG - Intronic
936704387 2:115054664-115054686 CCACTTAGGGAGGCTGAGGCAGG + Intronic
936774422 2:115955611-115955633 CCATTTTGGGAGGCTGAGGCAGG - Intergenic
937677221 2:124605207-124605229 CCATTTAGTCTGGGATTGGCTGG - Intronic
937720135 2:125085143-125085165 GCATTTAGGGAGGCTAAGGCAGG - Intergenic
938174385 2:129110927-129110949 CCATTTTGGGAGGCTGAGGCAGG + Intergenic
938328679 2:130432295-130432317 GCATTTTGGGAGGCCATGGCGGG + Intergenic
938361266 2:130689199-130689221 GCATTTTGGGAGGCCATGGCGGG - Intergenic
938401883 2:130999956-130999978 CCATTTTGGGAGGCCGAGGCAGG - Intronic
938437671 2:131295889-131295911 GCATTTTGGGAGGCCATGGCGGG - Intronic
938492377 2:131768579-131768601 TTATTTAGGGAGGCCTAGGCAGG + Intergenic
938495192 2:131793771-131793793 TTATTTAGGGAGGCCTAGGCAGG - Intergenic
938779070 2:134568276-134568298 GCACTTAGGGAGGCAGAGGCAGG + Intronic
939056447 2:137370713-137370735 GCATTTTGGGAGGCCTAGGCAGG - Intronic
939568563 2:143813546-143813568 GCAATTTGGGAGGCATAGGCAGG + Intergenic
941085228 2:161109916-161109938 GCACTTTGGGAGGCCTTGGCAGG + Intergenic
941755341 2:169179472-169179494 ACACTTAGGGAGGCAGAGGCAGG + Intronic
942157300 2:173144047-173144069 CCACTTAGGGAGGCCAAGGCAGG + Intronic
942359963 2:175162005-175162027 CCATTTTGGGAGGCCTAGGCAGG - Intronic
942881636 2:180868762-180868784 CCATTTTGGGAGGCCAAGGCAGG + Intergenic
944244627 2:197518506-197518528 CCATTTTGGGAGGCCCAGGCGGG - Intronic
944524203 2:200601683-200601705 ACATTTAGGGAGGCCTAGGTGGG + Intronic
944646523 2:201785931-201785953 CCATTTTGGGAGGCCAAGGCAGG - Intergenic
944652520 2:201845503-201845525 GCATTTTGGGAGGCCTAGGCAGG + Intronic
944720247 2:202416668-202416690 GCATTTAGGGAGGCTGAGGCGGG - Intronic
944831892 2:203541347-203541369 ACACTTTGGGAGGCCTTGGCGGG - Intergenic
945073233 2:206012051-206012073 ACACTTTGGGAGGCAGTGGCAGG + Intronic
945199060 2:207263512-207263534 GCTTTTAGGGAGGCAGAGGCGGG + Intergenic
945264588 2:207878360-207878382 CCACTTTGGGAGGCAGAGGCGGG + Intronic
945905530 2:215588540-215588562 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
946559134 2:220892751-220892773 ACATTTTGGGAGGCACAGGCAGG - Intergenic
947037026 2:225871164-225871186 GCACTTTGGGAGGCTTTGGCAGG + Intergenic
947162990 2:227233257-227233279 GCACTTTGGGAGGCAGTGGCTGG - Intronic
947213826 2:227731997-227732019 ACATTTTGGGAGGCAGAGGCAGG - Intergenic
947214658 2:227739025-227739047 GCATTTTGGGAGGCCTAGGCGGG - Intergenic
947242408 2:228010278-228010300 GCATTTTGGGAGGCAGAGGCAGG + Intronic
947487126 2:230561594-230561616 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
947511090 2:230754763-230754785 CCATTTTGGGAGGCCAAGGCAGG - Intronic
947768553 2:232653237-232653259 GCATTTTGGGAGGCCTAGGCGGG - Intronic
1168741723 20:197851-197873 CCACTTTGGGAGGCCTAGGCAGG + Intergenic
1168779642 20:477743-477765 CCACTTTGGGAGGCTTGGGCGGG + Intronic
1169299194 20:4427474-4427496 GCATTTTGGGAGGCCTAGGCGGG + Intergenic
1169428366 20:5513536-5513558 CCACTTAGGGAGGCCGAGGCAGG - Intergenic
1169454875 20:5743670-5743692 GCACTTTGGGAGGCATAGGCGGG - Intergenic
1169466445 20:5845042-5845064 CCATTTTGGGAGGCCGAGGCAGG - Intronic
1169588196 20:7110859-7110881 ACACTTAGGGAGGCAGAGGCAGG + Intergenic
1169608660 20:7353353-7353375 GCATTTTGGGAGGCCATGGCTGG + Intergenic
1169841545 20:9943496-9943518 GCATTTAGGGAGGCTGAGGCAGG - Intergenic
1170196183 20:13692047-13692069 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1170467578 20:16636943-16636965 GCACTTTGGGAGGCATAGGCGGG - Intergenic
1170564123 20:17585310-17585332 ACATTGAAGGAGGAATTGGCAGG + Intronic
1170785204 20:19461777-19461799 GCACTTAGGGAGGCAGAGGCGGG - Intronic
1171429276 20:25070521-25070543 CCATGTAGGGAGCCCTTGGAGGG - Intergenic
1171774278 20:29350989-29351011 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1171816294 20:29788620-29788642 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1171899419 20:30843328-30843350 CCATTTTGGGAGGCTGAGGCAGG + Intergenic
1171902074 20:30867442-30867464 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1172251792 20:33484766-33484788 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
1172253930 20:33500199-33500221 CCACTTTGGGAGGCAGAGGCGGG - Intronic
1172275356 20:33676243-33676265 CCAGGTGGGGAGGCTTTGGCTGG - Exonic
1172283956 20:33728018-33728040 GCATTTAGGGAGGCAGAGGCTGG - Intergenic
1172569409 20:35957338-35957360 GCACTTTGGGAGGCATAGGCAGG + Intronic
1172684408 20:36743245-36743267 CCACTTTGGGAGGCAGAGGCAGG + Intronic
1172705997 20:36882294-36882316 GCACTTAGGGAGGCAGAGGCAGG + Intronic
1172717117 20:36972905-36972927 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1172731043 20:37088016-37088038 GCATTTAGGGAGGCTGAGGCGGG + Intronic
1172751207 20:37252518-37252540 GCACTTAGGGAGGCCATGGCAGG + Intronic
1172769773 20:37374819-37374841 ACATTTTGGGAGGCAGAGGCGGG - Intronic
1172904944 20:38362364-38362386 ACATTTAGGGAGGCCGAGGCGGG + Intronic
1173033079 20:39380268-39380290 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1174007133 20:47419728-47419750 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
1174585351 20:51604023-51604045 GCATTTTGGGAGGCAGAGGCGGG - Intronic
1174639433 20:52030599-52030621 ACATTTTGGGAGGCAGAGGCAGG - Intergenic
1175114482 20:56672586-56672608 GCATTTTGGGAGGCCTAGGCGGG + Intergenic
1175442214 20:59000129-59000151 CCATTTTGGGAGGCCAAGGCAGG + Intronic
1175638959 20:60610709-60610731 GCACTTTGGGAGGCCTTGGCGGG - Intergenic
1176045510 20:63090757-63090779 CCCTTGCGGGAGGCGTTGGCTGG + Intergenic
1176334714 21:5585240-5585262 ACATTTTGGGAGGCCTAGGCGGG + Intergenic
1176393043 21:6235708-6235730 ACATTTTGGGAGGCCTAGGCGGG - Intergenic
1176468376 21:7080466-7080488 ACATTTTGGGAGGCCTAGGCGGG + Intronic
1176491937 21:7462244-7462266 ACATTTTGGGAGGCCTAGGCGGG + Intergenic
1176508705 21:7676139-7676161 ACATTTTGGGAGGCCTAGGCGGG - Intergenic
1176855244 21:13963277-13963299 GCACTTTGGGAGGCATAGGCGGG + Intergenic
1177337496 21:19750239-19750261 CCATTTTGGGAGGCCGAGGCAGG - Intergenic
1177626945 21:23674102-23674124 GCAATTAGGGAGGCCGTGGCGGG - Intergenic
1177830406 21:26132989-26133011 GCACTTAGGGAGGCATGGGTGGG + Intronic
1178274114 21:31220808-31220830 CCACAAAGGGAGGCATTGTCTGG - Intronic
1178544456 21:33481037-33481059 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1178859787 21:36279162-36279184 ACATTTTGGGAGGCTTAGGCAGG + Intronic
1178868505 21:36351310-36351332 CCATTTTGGGAGGCCAAGGCGGG - Intronic
1178903157 21:36613867-36613889 GCATTTTGGGAGGCTGTGGCAGG + Intergenic
1178947086 21:36957687-36957709 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1180319739 22:11309138-11309160 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1180335452 22:11573375-11573397 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1180514037 22:16123296-16123318 GCATTTTGGGAGGCTTTGGCGGG - Intergenic
1180624818 22:17187264-17187286 GCACTTAGGGAGGCAGAGGCAGG - Intronic
1180641117 22:17300191-17300213 GCATGTTGGGAGGCCTTGGCGGG + Intergenic
1180687021 22:17677071-17677093 GCACTTAGGGAGGCAGAGGCAGG + Intronic
1180792620 22:18584666-18584688 GCATTTAGGGAGGCTGAGGCGGG - Intergenic
1181158297 22:20939490-20939512 GCATTTTGGGAGGCCTAGGCAGG - Intronic
1181183152 22:21081106-21081128 CCATTTTGGGAGGCTGAGGCGGG + Intergenic
1181229117 22:21410645-21410667 GCATTTAGGGAGGCTGAGGCGGG + Intergenic
1181249534 22:21524220-21524242 GCATTTAGGGAGGCTGAGGCGGG - Intergenic
1181679253 22:24480315-24480337 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1181780547 22:25189856-25189878 ACACTTAGGGAGGCAGAGGCAGG - Intronic
1182001125 22:26920660-26920682 GCACTTTGGGAGGCATAGGCGGG + Intergenic
1182260425 22:29070191-29070213 ACATTTAGGGAGGCCAAGGCAGG - Intergenic
1182348674 22:29685655-29685677 GCATTTTGGGAGGCTGTGGCAGG - Intronic
1182418622 22:30237720-30237742 CCACTCAGTGAGGCTTTGGCTGG - Intergenic
1182642172 22:31777072-31777094 CTACTTAGGGAGGCTTAGGCAGG - Intronic
1182908841 22:33962710-33962732 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1183163268 22:36128865-36128887 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1183266964 22:36833763-36833785 CCATTTTGGGAGGCCGAGGCGGG + Intergenic
1183529445 22:38345238-38345260 GCACTTTGGGAGGCCTTGGCGGG - Intronic
1183753959 22:39741839-39741861 CCACTTTGGGAGGCAGAGGCGGG + Intergenic
1183796168 22:40120109-40120131 GCATTTTGGGAGGCCTAGGCAGG + Intronic
1184237850 22:43194565-43194587 ACATTTAAGAAGGCATTGCCTGG + Intergenic
1184958391 22:47908934-47908956 CCATTTTGGGAGGCTGAGGCGGG - Intergenic
949553193 3:5129769-5129791 GCATTTAGGGAGGCAGAGACAGG + Intronic
949648857 3:6131355-6131377 GCATTTTGGGAGGCGGTGGCAGG - Intergenic
949913207 3:8932849-8932871 GCATTTTGGGAGGCAGAGGCGGG + Intronic
950070429 3:10147843-10147865 GCACTTAGGGAGGCTATGGCGGG + Intronic
951061573 3:18213822-18213844 GCACTTTGGGAGGCCTTGGCAGG + Intronic
951231042 3:20180048-20180070 GCATTTAGGGAGGCCGAGGCAGG + Intronic
952434301 3:33256904-33256926 GCATTTTGGGAGGCCTTGGCAGG + Intergenic
952671996 3:35980602-35980624 CAATCTAGGGGGGCAGTGGCAGG + Intergenic
953182682 3:40611213-40611235 GCACTTAGGGAGGCCTAGGCAGG - Intergenic
953324975 3:42005335-42005357 CCACTTTGGGAGGCTGTGGCAGG - Intergenic
953528467 3:43715407-43715429 ACATTTTGGGAGGCAGAGGCGGG - Intronic
954040873 3:47886547-47886569 GCACTTTGGGAGGCCTTGGCAGG - Intronic
954180078 3:48874798-48874820 GCATTTTGGGAGGCAGAGGCAGG + Intronic
954554010 3:51504280-51504302 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
954556700 3:51522970-51522992 GCACTTAGGGAGGCAAAGGCAGG - Intergenic
954736217 3:52708937-52708959 GCATTTAGGGAGGCCAAGGCAGG + Exonic
955097164 3:55810704-55810726 CCACTTAGGGAGGCCAAGGCAGG - Intronic
955266557 3:57449999-57450021 ACACTTTGGGAGGCATAGGCAGG + Intronic
955348370 3:58177333-58177355 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
955609805 3:60744999-60745021 GCTTTTAGGGAGGCAGAGGCGGG + Intronic
955685311 3:61543412-61543434 GCATTTTGGGAGGCCTAGGCGGG + Intergenic
956018776 3:64911934-64911956 GCACTTTGGGAGGCATAGGCAGG + Intergenic
957979686 3:87492650-87492672 CCACTTTGGGAGGCAGAGGCGGG - Intergenic
959708388 3:109360044-109360066 GCACTTTGGGAGGCAGTGGCGGG + Intergenic
961721608 3:128900607-128900629 GCATTTTGGGAGGCAGAGGCAGG - Intronic
962266313 3:133946866-133946888 GCATTTTGGGAGGCTGTGGCAGG + Intronic
962286820 3:134093350-134093372 GCATTTTGGGAGGCAGAGGCAGG - Intronic
962303910 3:134269137-134269159 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
962306315 3:134289721-134289743 TCATTTTGGGAGGCCTAGGCTGG + Intergenic
962525131 3:136231126-136231148 GCATTTTGGGAGGCAAAGGCAGG - Intergenic
962543642 3:136409581-136409603 TCATTTTGGGAGGCAAAGGCAGG - Intronic
962723162 3:138195026-138195048 GCATTTTGGGAGGCTTGGGCAGG + Intronic
962794513 3:138838816-138838838 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
963012783 3:140789137-140789159 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
963748638 3:149151277-149151299 CCATTTTGGGAGGCTGAGGCAGG - Intronic
963795284 3:149625362-149625384 GCATTTTGGGAGGCTTAGGCGGG - Intronic
963810642 3:149773214-149773236 CCAATAAGGGAGGGACTGGCAGG - Intronic
963866138 3:150363649-150363671 GCACTTAGGGAGGCAGAGGCAGG - Intergenic
966518860 3:180850797-180850819 GCATTTAGGGAGGCTGAGGCAGG - Intronic
966577382 3:181517874-181517896 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
966636428 3:182139377-182139399 ACATTTTGGGAGGCCTAGGCAGG - Intergenic
966690664 3:182738175-182738197 GCATTTAGGGAGGCTGAGGCAGG + Intergenic
966752477 3:183335619-183335641 GCATTTAGGGAGGCCCAGGCAGG + Intronic
966845550 3:184126803-184126825 GCATTTTGGGAGGCTGTGGCAGG - Intergenic
966928685 3:184661888-184661910 ACATTTTGGGAGGCAGAGGCAGG - Intronic
966965605 3:184989509-184989531 GCACTTAGGGAGGCAGAGGCGGG - Intronic
967051072 3:185785052-185785074 GCATTTTGGGAGGCAGGGGCAGG + Intronic
967474536 3:189901309-189901331 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
968144409 3:196286665-196286687 GCATTTTGGGAGGCCTAGGCGGG + Intronic
968211182 3:196850149-196850171 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
968242315 3:197101633-197101655 GCATTTTGGGAGGCCTAGGCGGG - Intronic
968314308 3:197709922-197709944 GCATTTTGGGAGGCAGAGGCAGG + Intronic
968373174 4:13851-13873 CCACTTTGGGAGGCCTAGGCAGG + Intergenic
968499688 4:942884-942906 GCATTTTGGGAGGCAGAGGCGGG - Intronic
968771293 4:2509163-2509185 GCATTTTGGGAGGCAGAGGCGGG - Intronic
968816502 4:2824322-2824344 CCATGTAAAGTGGCATTGGCGGG + Intronic
968863521 4:3192322-3192344 GCATTTTGGGAGGCAGAGGCAGG - Intronic
969380310 4:6791573-6791595 GCATTTTGGGAGGCAGAGGCAGG - Intronic
971122683 4:23721689-23721711 GCATTTAGGGAGGCTGAGGCAGG - Intergenic
971515627 4:27482284-27482306 GCATTTTGGGAGGCCTAGGCGGG + Intergenic
971545589 4:27881112-27881134 GCATTTTGGGAGGCTGTGGCAGG - Intergenic
971875495 4:32302416-32302438 ACATTTTGGGAGGCATAGGCAGG + Intergenic
972152289 4:36108142-36108164 CCACTTTGGGAGGCAGTGGTGGG - Intronic
972451836 4:39208547-39208569 CCATTTTGGGAGGCTAAGGCGGG - Intronic
972535091 4:39993291-39993313 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
973220033 4:47715357-47715379 GCATTTTGGGAGGCAGAGGCAGG + Intronic
973323689 4:48835679-48835701 CCATTTGGGGAGGCCAAGGCAGG - Intronic
973707948 4:53598477-53598499 CCATTTTGGGAGGCCAAGGCAGG - Intronic
974045720 4:56896824-56896846 CCACTTTGGGAGGCAGAGGCGGG - Intergenic
974258706 4:59496403-59496425 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
974700203 4:65433817-65433839 TCATTTTGGGAGGCCTAGGCAGG + Intronic
974795826 4:66747900-66747922 GCATTTTGGGAGGCAAAGGCAGG - Intergenic
975135236 4:70868060-70868082 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
975193494 4:71494559-71494581 GCATTTAGGGAGGCCAAGGCAGG - Intronic
975556198 4:75667642-75667664 GCACTTTGGGAGGCAATGGCAGG + Intronic
975985472 4:80197975-80197997 CCCTCTAGGCAGGCATTGTCTGG - Intronic
976181984 4:82407721-82407743 GCACTTAGGGAGGCAGAGGCGGG - Intergenic
976421587 4:84851031-84851053 GCACTTAGGGAGGCAGAGGCAGG - Intronic
976432335 4:84977097-84977119 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
976544941 4:86324158-86324180 ACATTTTGGGAGGCAATGGCAGG + Intronic
976622441 4:87142846-87142868 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
977575514 4:98670196-98670218 GCACTTTGGGAGGCCTTGGCGGG - Intergenic
977631705 4:99250037-99250059 GCATTTAGGGAGGCTGAGGCAGG - Intergenic
977644653 4:99399386-99399408 CCACTTTGGGAGGCAAAGGCAGG + Intergenic
977923386 4:102670595-102670617 CCACTTTGGGAGGCAGAGGCAGG + Intronic
977959566 4:103070685-103070707 GCATTTTGGGAGGCCTAGGCGGG - Intronic
978531203 4:109715719-109715741 GCACTTTGGGAGGCCTTGGCTGG - Intronic
978802466 4:112768498-112768520 CCATTTTGGGAGGCCTCGGTGGG - Intergenic
978873239 4:113606222-113606244 GCACTTAGGGAGGCAGAGGCAGG + Intronic
979089609 4:116465391-116465413 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
979371691 4:119895869-119895891 GCACTTTGGGAGGCAGTGGCAGG - Intergenic
979572400 4:122243492-122243514 GCATTTTGGGAGGCCATGGCTGG + Intronic
979754027 4:124317366-124317388 GCATTCAGGGAGGCAAAGGCAGG - Intergenic
979892229 4:126112622-126112644 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
979904855 4:126274989-126275011 GCATTTAGAGAGGCAGAGGCAGG + Intergenic
980062766 4:128149904-128149926 GCATTTTGGGAGGCAGAGGCAGG + Intronic
980153274 4:129074945-129074967 GCATTTTGGGAGGCTGTGGCAGG - Intronic
980447348 4:132927575-132927597 ACATTTTGGGAGGCATAAGCAGG + Intergenic
980775765 4:137434292-137434314 CCACTTTGGGAGGCCTAGGCAGG - Intergenic
981791763 4:148545618-148545640 CCATTTCGGGAGGCTGAGGCAGG - Intergenic
981877744 4:149568538-149568560 CCACTTAGGGAGGCTGCGGCAGG + Intergenic
982003767 4:151045589-151045611 GCATTTAAGGAGGCAGAGGCAGG + Intergenic
982432816 4:155341641-155341663 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
982604151 4:157492374-157492396 GCACTTAGGGAGGCCTAGGCAGG - Intergenic
982757159 4:159234706-159234728 CCACTTTGGGAGGCAGAGGCAGG - Intronic
983261041 4:165456983-165457005 GCACTTTGGGAGGCAGTGGCGGG - Intronic
983455374 4:167956221-167956243 TCATTTTGGGAGGCCTAGGCAGG - Intergenic
983558610 4:169079680-169079702 GCACTTAGGGAGGCAGAGGCAGG + Intergenic
983916782 4:173300885-173300907 GCACTTAGGGAGGCCTAGGCAGG + Intronic
984432419 4:179665510-179665532 CCATTTTGGGAGGCCAAGGCAGG + Intergenic
984629989 4:182051095-182051117 CCATTTTGGGAGGCCGAGGCAGG + Intergenic
984803384 4:183734343-183734365 GCACTTTGGGAGGCCTTGGCGGG - Intergenic
985146591 4:186900263-186900285 CCATTTTGGGAGGCTGAGGCAGG + Intergenic
985295833 4:188436247-188436269 GCATTTTGGGAGGCCATGGCAGG - Intergenic
985475002 5:73957-73979 CCATTTAGGAAGGGATGGGGAGG - Intergenic
986222447 5:5781097-5781119 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
986392504 5:7299605-7299627 CCACTTTGGGAGGCCTAGGCGGG - Intergenic
986611491 5:9572435-9572457 ACATTTAGGGAGGCTGAGGCGGG + Intergenic
986714789 5:10515238-10515260 CCATTTTGGGAGGCTGAGGCAGG + Intronic
986929528 5:12801111-12801133 CCATTTATGGAGCCCTTGTCAGG + Intergenic
987143795 5:14971493-14971515 CCATTTTGGGAGGCTGAGGCAGG + Intergenic
987307318 5:16649428-16649450 CCACTTTGGGAGGCAGAGGCAGG + Intergenic
988121374 5:26967198-26967220 GCATTTCGGGAGGTATAGGCAGG - Intronic
988133514 5:27137507-27137529 GGATTTAGGGAGGAATTGTCTGG + Intergenic
988224544 5:28396485-28396507 GCATTTTGGGAGGCCTAGGCGGG - Intergenic
988512940 5:31881044-31881066 GCATTTTGGGAGGCCTAGGCGGG - Intronic
988645895 5:33094682-33094704 CCATTTGGGGAGGCCGAGGCAGG - Intergenic
988839996 5:35074212-35074234 CCATTTTGGGAGGCTGAGGCAGG + Intronic
989031426 5:37122665-37122687 CAATTTAGGGAGGCTGCGGCGGG + Intronic
989223574 5:38998431-38998453 GCATTTTGGGAGGCCTAGGCGGG - Intronic
989223615 5:38998766-38998788 GCATTTTGGGAGGCAGAGGCAGG + Intronic
989612391 5:43307317-43307339 CCACTTTGGGAGGCTGTGGCGGG - Intronic
990292452 5:54366469-54366491 ACACTTAGGGAGGCCATGGCGGG + Intergenic
990397250 5:55394784-55394806 GCATTTTGGGAGGCAAAGGCGGG + Intronic
990858660 5:60301013-60301035 GCATTTTGGGAGGCCTAGGCAGG - Intronic
991577012 5:68115212-68115234 CCACTTAGGGAGGCTGAGGCAGG - Intergenic
992081409 5:73236803-73236825 GCACTTAGGGAGGCAGAGGCAGG + Intergenic
992146439 5:73854582-73854604 GCATTTTGGGAGGCAGAGGCGGG + Intronic
992306284 5:75442465-75442487 GCACTTTGGGAGGCAGTGGCAGG - Intronic
994047031 5:95321688-95321710 CCATATAGTGTGGCATTGCCAGG + Intergenic
994189701 5:96856072-96856094 CCCTTTAGGGAGGCCCAGGCGGG + Intronic
994450762 5:99939656-99939678 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
994968809 5:106709077-106709099 GCATTTAGGGAGGCCGAGGCAGG + Intergenic
994985582 5:106929050-106929072 GCATTTTGGGAGGCCATGGCAGG + Intergenic
995308001 5:110677005-110677027 GCATTTTGGGAGGCTATGGCAGG - Intronic
995505016 5:112851291-112851313 GCATTTAGGGAGGCCAAGGCAGG + Intronic
995648970 5:114346026-114346048 ACATTTTGGGAGGCTGTGGCAGG - Intergenic
995949271 5:117689838-117689860 CCATTTTGGGAGGCCGAGGCGGG - Intergenic
996006955 5:118432849-118432871 CCACTTTGGGAGGCCTAGGCAGG + Intergenic
996443897 5:123522255-123522277 GCACTTAGGGAGGCAGAGGCAGG + Intronic
996521409 5:124430356-124430378 CCACTTTGGGAGGCATAGGCAGG + Intergenic
996727397 5:126684641-126684663 CCACTTTGGGAGGCAGAGGCGGG + Intergenic
997139131 5:131360364-131360386 GCATTTTGGGAGGCAGAGGCGGG - Intronic
997481568 5:134188878-134188900 GCACTTTGGGAGGCATAGGCGGG + Intronic
997519464 5:134513376-134513398 GCACTTTGGGAGGCATAGGCAGG - Intergenic
998082950 5:139292206-139292228 CCACTTTTGGAGGCCTTGGCGGG - Intronic
998110584 5:139499315-139499337 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
998155441 5:139784184-139784206 CCACTTTGGGAGGCAGAGGCGGG - Intergenic
998185151 5:139973606-139973628 GCATTTTGGGAGGCAGAGGCAGG - Intronic
998263487 5:140649081-140649103 CCACTTTGGGAGGCAGAGGCGGG - Intronic
998288927 5:140893404-140893426 GCACTTAGGGAGGCAGAGGCAGG + Intronic
998356583 5:141542185-141542207 GCAGTTTGGGAGGCCTTGGCAGG + Intronic
998460961 5:142309652-142309674 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
998472608 5:142394843-142394865 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
999087815 5:148908818-148908840 GCACTTTGGGAGGCATAGGCAGG + Intergenic
999146238 5:149397413-149397435 CCATTTTGGGAGGCCAAGGCGGG - Intronic
999812566 5:155141766-155141788 CCACTTTGGGAGGCAGAGGCAGG + Intergenic
999988785 5:157030417-157030439 GCATTTTGGGAGGCCATGGCAGG + Intronic
1000055812 5:157605122-157605144 GCATTTTGGGAGGCCATGGCGGG + Intergenic
1000922211 5:167151761-167151783 CCATTTTGGGAGGCCGAGGCGGG - Intergenic
1001108182 5:168873381-168873403 GCATTTTGGGAGGCTTAGGCAGG + Intronic
1003347001 6:5279129-5279151 GCATTTTGGGAGGCCTAGGCGGG + Intronic
1003852240 6:10237037-10237059 CCATTAAGGCAGGAATGGGCAGG + Intergenic
1004232553 6:13846461-13846483 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
1004445567 6:15694294-15694316 GCATTTTGGGAGGCCATGGCTGG + Intergenic
1004514842 6:16313806-16313828 GCATTTTGGGAGGCTGTGGCGGG - Intronic
1004515194 6:16316498-16316520 CCACTTTGGGAGGCAGAGGCGGG + Intronic
1004640009 6:17506143-17506165 ACATTTTGGGAGGCTTAGGCGGG - Intronic
1004723007 6:18284787-18284809 CCACTTAGGGAGGCAGAGGCGGG + Intergenic
1005111631 6:22288285-22288307 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1005311686 6:24564999-24565021 CCACTTTGGGAGGCAAAGGCAGG + Intronic
1005333267 6:24769136-24769158 CCACTTTGGGAGGCCTAGGCAGG - Intergenic
1005511855 6:26518593-26518615 CCATTTTGGGAGGCCGAGGCGGG - Intergenic
1005591407 6:27332010-27332032 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1005651524 6:27889630-27889652 CCACTTTGGGAGGCAGTGGAAGG - Intergenic
1005768272 6:29036784-29036806 ACATTTTGGGAGGCCTAGGCAGG - Intergenic
1005970500 6:30757286-30757308 CCATTTTGGGAGGCTGAGGCAGG - Intergenic
1006040819 6:31253181-31253203 CCATGTTGGGAGGCCCTGGCAGG + Intergenic
1006274098 6:32987574-32987596 GCATTTGGGGAGGCAGTTGCGGG - Intergenic
1006539836 6:34730542-34730564 CCATTTTGGGAGGCTGAGGCAGG + Intergenic
1006695102 6:35924293-35924315 ACACTTAGGGAGGCAGAGGCAGG + Intergenic
1006727224 6:36208387-36208409 GCATTTAGGGAAGCAGAGGCAGG + Intronic
1006775518 6:36589470-36589492 CCACTTTGGGAGGCAGAGGCAGG + Intergenic
1006775795 6:36591607-36591629 GCATTTTGGGAGGCCTAGGCTGG - Intergenic
1007096799 6:39218313-39218335 CCACTTCGGGAGGCCTAGGCGGG - Intronic
1007552599 6:42741676-42741698 GCATTTTGGGAGGCCTTGGTGGG - Intergenic
1007644723 6:43370802-43370824 CCATTTTGGGAGGCCGGGGCAGG + Intergenic
1007651134 6:43423066-43423088 CCATTTCGGGAGGCCGAGGCAGG - Intergenic
1007674723 6:43583878-43583900 GCATTTAGGGAGGCTGAGGCGGG + Intronic
1008316474 6:50047897-50047919 GCATTTTGGGAGGCCGTGGCAGG + Intronic
1010308885 6:74359507-74359529 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1010578432 6:77563461-77563483 CCATTTAGAGAGGCATTATAAGG + Intergenic
1010682798 6:78816829-78816851 CCACTTTGGGAGGCTTAGGCGGG + Intergenic
1011037839 6:82997471-82997493 GCATTTTGGGAGGCAGAGGCGGG + Intronic
1011075839 6:83437761-83437783 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1011627006 6:89290973-89290995 GCGTTTACGGAGGCATGGGCAGG - Intronic
1011971961 6:93236500-93236522 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1012254190 6:97014058-97014080 CCACTTTGGGAGGCCGTGGCGGG + Intronic
1012375301 6:98554874-98554896 CCACTTTGGGAGGCCTAGGCGGG + Intergenic
1012603782 6:101131971-101131993 CCATTTTGGGAGGCCAAGGCAGG + Intergenic
1012982681 6:105846721-105846743 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
1013186436 6:107763631-107763653 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1013251812 6:108341999-108342021 CTACTTAGAGAGGCATGGGCAGG + Intronic
1013271824 6:108552325-108552347 GCATTTTGGGAGGCAGGGGCGGG - Intergenic
1013501739 6:110759013-110759035 GCACTTAGGGAGGCCATGGCAGG + Intronic
1013706460 6:112840693-112840715 CCACTTTGGGAGGCCGTGGCGGG + Intergenic
1013749483 6:113386637-113386659 TCATTTAGGGAGGCTGAGGCGGG - Intergenic
1014036112 6:116768415-116768437 GCACTTTGGGAGGCATAGGCGGG - Intergenic
1014044275 6:116866276-116866298 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
1014261417 6:119222571-119222593 GCACTTTGGGAGGCTTTGGCAGG - Intronic
1014530577 6:122554430-122554452 ACATTTAGAGAGGCATTGCATGG - Intronic
1014945823 6:127495981-127496003 CCATTTTGGGAGGCTGAGGCGGG + Intronic
1015246204 6:131077332-131077354 GCATTTTGGGAGGCCTAGGCGGG - Intergenic
1015399300 6:132770487-132770509 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1015468946 6:133580481-133580503 GCACTTTGGGAGGCAGTGGCAGG - Intergenic
1015522370 6:134144647-134144669 GCATTTAGGGAGGCAGAGGCAGG - Intergenic
1015764778 6:136704790-136704812 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1015772328 6:136781967-136781989 GCATTTTGGGAGGCAGGGGCAGG + Intronic
1015826438 6:137317349-137317371 CCTTTTAAGGATGCACTGGCTGG - Intergenic
1015894373 6:138002571-138002593 GCATTTTGGGAGGCCTAGGCGGG - Intergenic
1016093980 6:140013749-140013771 CCACTTTGGGAGGCCTAGGCGGG - Intergenic
1016920582 6:149289279-149289301 GCATTTTGGGAGGCAAGGGCAGG + Intronic
1016956628 6:149633351-149633373 GCATTTTGGGAGGCCTAGGCGGG - Intronic
1016961624 6:149678072-149678094 CCACTTTGGGAGGCAGAGGCAGG + Intronic
1017140985 6:151189800-151189822 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1017168011 6:151427892-151427914 GCATTTTGGGAGGCAGAGGCGGG + Intronic
1017299816 6:152843932-152843954 GCATTTAGGGAGGCTGAGGCAGG - Intergenic
1017450189 6:154547987-154548009 CCAGTTTGGGAGGCAAAGGCGGG - Intergenic
1017468510 6:154717141-154717163 CCATTTTGGGAGGCTGAGGCAGG + Intergenic
1017659610 6:156661194-156661216 ACATTTAGGGAGGCCAGGGCAGG + Intergenic
1017667943 6:156739617-156739639 CCATTTTGGGAGGCTGAGGCAGG - Intergenic
1017769794 6:157636111-157636133 ACATTTTGGAAGGCCTTGGCTGG - Intronic
1018240627 6:161770712-161770734 CCATTTTGGGAGGCTGAGGCGGG - Intronic
1018819176 6:167359777-167359799 GCACTTTGGGAGGCGTTGGCGGG - Intronic
1019398716 7:838162-838184 GCACTTAGGGAGGCCTAGGCAGG - Intronic
1019425882 7:976428-976450 GCATTTAGGGAGGCTGAGGCAGG - Intergenic
1019623840 7:2005552-2005574 GCATTTAGGGAGGCCAAGGCAGG + Intronic
1019655369 7:2191482-2191504 CCATTTTGGGAGGCTGAGGCAGG + Intronic
1020104212 7:5413777-5413799 CCACTTTGGGAGGCCTAGGCGGG - Intronic
1020205091 7:6108289-6108311 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1020254124 7:6492492-6492514 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1020738765 7:11986620-11986642 GCATTTTGGGAGGCAGAGGCTGG - Intergenic
1021007448 7:15416278-15416300 ACATTTTGGGAGGCAGAGGCGGG - Intronic
1021321910 7:19223021-19223043 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1021422930 7:20465745-20465767 ACATTTTGGGAGGCAAAGGCAGG + Intergenic
1021542912 7:21780296-21780318 GCACTTAGGGAGGCAGAGGCAGG + Intronic
1021683953 7:23163416-23163438 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1021730688 7:23592529-23592551 GCATTTAGGGAGGCTGAGGCAGG - Intergenic
1022255127 7:28648487-28648509 GCATTTTGGGAGGCTTAGGCAGG + Intronic
1022320529 7:29283861-29283883 ACATTTTGGGAGGCAGAGGCAGG - Intronic
1023144318 7:37134320-37134342 CCATTTTGGGAGGCTGAGGCAGG + Intronic
1023445070 7:40222872-40222894 GCACTTAGGGAGGCTTAGGCAGG - Intronic
1023933439 7:44721933-44721955 CCACTTTGGGAGGCAAAGGCAGG - Intergenic
1023941825 7:44773305-44773327 GCACTTTGGGAGGCCTTGGCGGG - Intergenic
1024280426 7:47714428-47714450 GCATTTTGGGAGGCCTAGGCAGG - Intronic
1025162889 7:56680329-56680351 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1025640582 7:63363933-63363955 CCACTTTGGGAGGCTATGGCAGG - Intergenic
1025642117 7:63384153-63384175 CCACTTTGGGAGGCTATGGCAGG + Intergenic
1025776551 7:64566078-64566100 CCATTTTGGGAGGCTGAGGCTGG - Intergenic
1026092928 7:67316256-67316278 GCACTTAGGGAGGCAGAGGCAGG + Intergenic
1026203236 7:68233173-68233195 GCATTTTGGGAGGCACAGGCAGG - Intergenic
1026293002 7:69025542-69025564 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1026381867 7:69808172-69808194 CCACTTTGGGAGGCAGAGGCGGG - Intronic
1026507991 7:71002988-71003010 GCATTTAGGGAGGCCAAGGCGGG - Intergenic
1026796842 7:73371482-73371504 ACATTTTGGGAGGCAGAGGCGGG - Intergenic
1026810909 7:73463950-73463972 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1026820529 7:73544914-73544936 CCATGTATGGTGGCATAGGCTGG + Intronic
1026938589 7:74273389-74273411 CCATTTTGGGAGGCCGAGGCAGG + Intergenic
1026983762 7:74541652-74541674 CCATTTTGGGAGGCTGAGGCGGG + Intronic
1027726411 7:81811428-81811450 GCACTTAGGGAGGCAGAGGCAGG + Intergenic
1027763330 7:82307401-82307423 CCACTTTGGGAGGCAGAGGCGGG - Intronic
1027834898 7:83228250-83228272 GCAATTAGGGAGGCAGAGGCAGG + Intergenic
1028404225 7:90458971-90458993 GCATTTTGGGAGGCAGAGGCCGG + Intronic
1028899488 7:96080823-96080845 ACATTTTGGGAGGCCGTGGCAGG + Intronic
1029013710 7:97291715-97291737 GCATTTTGGGAGGCTTAGGCAGG + Intergenic
1029088219 7:98028024-98028046 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1029204221 7:98859182-98859204 GCACTTAGGGAGGCAGAGGCAGG + Intronic
1029348135 7:99993424-99993446 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1029477397 7:100793090-100793112 CCACTTTGGGAGGCAGAGGCAGG + Intronic
1029484001 7:100828290-100828312 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1029486685 7:100847244-100847266 CCATTTGGGGAGGCCAAGGCGGG - Intronic
1029659378 7:101949374-101949396 GCATTTTGGGAGGCCTAGGCGGG - Intronic
1030002491 7:105080091-105080113 GCATTTAGGGAGGCCGAGGCAGG - Intronic
1030033943 7:105392742-105392764 GCACTTAGGGAGGCAGAGGCAGG - Intronic
1030044394 7:105481974-105481996 GCACTTTGGGAGGCCTTGGCAGG - Intronic
1030056482 7:105587924-105587946 GCATTTAGGGAGGCTGAGGCTGG - Intronic
1031054528 7:116978933-116978955 CTATTTACAGAGGTATTGGCAGG + Intronic
1031238254 7:119205166-119205188 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1031906201 7:127462591-127462613 GCACTTAGGGAGGCAGAGGCAGG - Intergenic
1032032697 7:128497727-128497749 CCATTTTGGGAGGCTGAGGCAGG - Intronic
1032351386 7:131166935-131166957 GCATTTTGGGAGGCCATGGCAGG - Intronic
1032830934 7:135624726-135624748 ACACTTAGGGAGGCAGAGGCAGG - Intronic
1033325810 7:140377309-140377331 CCACTTTGGGAGGCCTAGGCAGG - Intronic
1033343808 7:140512070-140512092 CCATTTTGGGAGGCCCAGGCAGG - Intergenic
1033358089 7:140617102-140617124 GCATTTAGGGAGGCCAAGGCGGG - Intronic
1033423973 7:141226604-141226626 GCATTTAGGGAGGCTAAGGCAGG + Intronic
1033556067 7:142489381-142489403 GCACTTTGGGAGGCCTTGGCAGG - Intergenic
1033936205 7:146588753-146588775 GCATTTTGGGAGGCACAGGCCGG - Intronic
1034614615 7:152405094-152405116 CCATTTTGGGAGGCCAAGGCGGG - Intronic
1035346427 7:158202635-158202657 CCATTTAGGGAGGCATTGGCTGG - Intronic
1035514662 8:222368-222390 GCATTTTGGGAGGCACAGGCGGG + Intergenic
1036071889 8:5449921-5449943 CAATTTAGAGCGGCAGTGGCAGG - Intergenic
1037059036 8:14483321-14483343 ACACTTTGGGAGGCATAGGCAGG + Intronic
1037072507 8:14669086-14669108 GCATTTTGGGAGGCTTAGGCAGG + Intronic
1037291658 8:17356450-17356472 ACATTTTGGGAGGCAGAGGCGGG + Intronic
1037340109 8:17835399-17835421 GCATTTTGGGAGGCAAAGGCAGG - Intergenic
1037376966 8:18241090-18241112 CCATTTTGGGAGGCCGAGGCGGG - Intergenic
1037757846 8:21722919-21722941 CCATGTAGGGAGGCATTGGTGGG - Intronic
1037851737 8:22335803-22335825 CCACTTTGGGAGGCAGAGGCAGG - Intronic
1038153788 8:24967662-24967684 GCACTTTGGGAGGCTTTGGCAGG + Intergenic
1038448342 8:27620212-27620234 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1038529970 8:28310716-28310738 ACATTTTGGGAGGCCTAGGCAGG + Intergenic
1038630904 8:29243098-29243120 GCATTTTGGGAGGCAAAGGCAGG + Intronic
1038747089 8:30263918-30263940 GCACTTAGGGAGGCCTAGGCGGG + Intergenic
1038820731 8:30949752-30949774 CCATTTTGGGAGGCCAAGGCAGG - Intergenic
1039023096 8:33228966-33228988 CCATTTTGGGAGGCGGAGGCAGG - Intergenic
1039502423 8:38028635-38028657 CCACTTTGGGAGGCCTAGGCGGG - Intergenic
1039522562 8:38183767-38183789 GCACTTAGGGAGGCAGAGGCGGG - Intronic
1039556576 8:38480401-38480423 ACATTTTGGGAGGCCTAGGCGGG - Intergenic
1039558313 8:38492904-38492926 CCACTTTGGGAGGCAGAGGCGGG + Intergenic
1039595320 8:38786453-38786475 GCATTTTGGGAGGCAGAGGCGGG + Intronic
1039812012 8:41057537-41057559 CCATTTTGGGAGGCCGAGGCTGG + Intergenic
1039860167 8:41450359-41450381 GCAATTTGGGAGGCCTTGGCAGG - Intergenic
1039909970 8:41818728-41818750 GCATTTAGGGAGGCAGAGGCAGG - Intronic
1040053709 8:43039651-43039673 GCACTTTGGGAGGCCTTGGCGGG - Intronic
1040361222 8:46666130-46666152 GCATTTAGGGAGGCTGAGGCAGG + Intergenic
1041674384 8:60523401-60523423 GCATTTTGGGAGGCAGAGGCGGG - Intronic
1042310105 8:67370972-67370994 CCATTTTGGGAGGCTGAGGCGGG + Intergenic
1042562358 8:70082155-70082177 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1042711095 8:71718527-71718549 GCATTTAGGGAGGCCAAGGCGGG + Intergenic
1042854361 8:73251046-73251068 CCATTTTGGGAGGCTGAGGCAGG - Intronic
1042981272 8:74531828-74531850 GCACTTTGGGAGGCCTTGGCAGG + Intergenic
1043434811 8:80227765-80227787 ACATTTTGGGAGGCCTAGGCTGG + Intronic
1043436121 8:80237779-80237801 GCACTTAGGGAGGCAGAGGCGGG + Intergenic
1043516602 8:81000686-81000708 GCATTTTGGGAGGCCTAGGCTGG - Intronic
1043559864 8:81479959-81479981 GCATTTAGGGAGGCCAAGGCAGG + Intronic
1044348760 8:91138804-91138826 GCATTTCGGGAGGCTGTGGCGGG + Intronic
1044649738 8:94481628-94481650 CCATTTTGGGAGGCTGAGGCAGG - Intergenic
1044668528 8:94655331-94655353 GCATTTAGGGAGGCCGAGGCGGG - Intronic
1045297803 8:100887563-100887585 CCATTTTGGGAGGCCAAGGCGGG + Intergenic
1046135454 8:110020218-110020240 CCACTTTGGGAGGCAGAGGCAGG + Intergenic
1046929824 8:119830857-119830879 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1047247749 8:123159543-123159565 GCATTTTGGGAGGCCTAGGCGGG + Intergenic
1047395158 8:124491028-124491050 CCATTTTGGGAGGCCGAGGCAGG - Intronic
1047953711 8:129957106-129957128 GCATTTAGGGAGGCTGTGGTGGG - Intronic
1048420599 8:134274754-134274776 CCATTTTGGGAGGCCGAGGCAGG - Intergenic
1048860543 8:138721763-138721785 GCATTTTGGGAGGCCTAGGCAGG - Intronic
1048913840 8:139163385-139163407 CCACTTTGGGAGGCCGTGGCAGG - Intergenic
1048957546 8:139549351-139549373 ATATTTGGGGAGGCATTGGCTGG - Intergenic
1049061645 8:140280678-140280700 GCATTTTGGGAGGCAGAGGCGGG - Intronic
1049590453 8:143458398-143458420 GCATTTAGGGAGGCAGAGGTGGG + Intronic
1049590487 8:143458556-143458578 GCATTTAGGGAGGCAGAGGTGGG + Intronic
1049590504 8:143458635-143458657 GCATTTAGGGAGGCAGAGGTGGG + Intronic
1049590521 8:143458714-143458736 GCATTTAGGGAGGCAGAGGTGGG + Intronic
1049590538 8:143458793-143458815 GCATTTAGGGAGGCAGAGGTGGG + Intronic
1049590555 8:143458872-143458894 GCATTTAGGGAGGCAGAGGTGGG + Intronic
1050013071 9:1205143-1205165 GCATTTTGGGAGGCAGAGGCAGG - Intergenic
1051067253 9:13119329-13119351 GCATTTTGGGAGGCCATGGCAGG - Intronic
1051440169 9:17074986-17075008 GCATTTTGGGAGGCAGTGGCGGG + Intergenic
1052202633 9:25801440-25801462 CCAGTTTGGGAGGCAAAGGCAGG - Intergenic
1052971227 9:34378313-34378335 CCACTTTGGGAGGCAGAGGCAGG - Intergenic
1053026730 9:34735552-34735574 GCACTTTGGGAGGCCTTGGCTGG + Intergenic
1053050071 9:34954061-34954083 ACACTTAGGGAGGCAGAGGCAGG + Intergenic
1053060328 9:35025759-35025781 GCACTTAGGGAGGCCTAGGCAGG + Intergenic
1053224424 9:36340616-36340638 ACATTTTGGGAGGCAAAGGCAGG - Intronic
1053263507 9:36693332-36693354 GCATTTAGGGAGGCTGAGGCAGG + Intergenic
1053447163 9:38161768-38161790 GCATTTAGGGAGGCCAAGGCAGG - Intergenic
1053534477 9:38912423-38912445 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1054206697 9:62136842-62136864 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1054567963 9:66779258-66779280 GCATTTAGGGAGGCCGAGGCGGG - Intergenic
1054631655 9:67451505-67451527 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1054893014 9:70272467-70272489 GCACTTAGGGAGGCAGAGGCGGG + Intronic
1055062554 9:72085308-72085330 GCATTTTGGGAGGCAGTGGCAGG + Intergenic
1055219460 9:73910828-73910850 CCACTTTGGGAGGCCTAGGCGGG - Intergenic
1055290960 9:74781287-74781309 GCACTTAGGGAGGCAGAGGCAGG + Intronic
1055301774 9:74890002-74890024 GCATTTAGGGAGGCCGAGGCAGG + Intergenic
1055719016 9:79150641-79150663 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
1056112823 9:83412746-83412768 GCATTTTGGGAGGCAGAGGCGGG + Intronic
1056174897 9:84024776-84024798 GCATTTTGGGAGGCCATGGCGGG - Intergenic
1057074143 9:92126558-92126580 CCATTTTGGGAGGCCGAGGCAGG + Intergenic
1057085142 9:92203077-92203099 CCATTTTGGGAGGCCAAGGCAGG - Intergenic
1057088469 9:92234005-92234027 GCATTTTGGGAGGCTTAGGCAGG - Intronic
1057232701 9:93334406-93334428 GCACTTTGGGAGGCAGTGGCAGG - Intronic
1057336749 9:94161652-94161674 CTATTTAGGGAGGACTTTGCTGG - Intergenic
1057497487 9:95572318-95572340 CCACTTAGGGAGGCTGAGGCAGG - Intergenic
1057687746 9:97251106-97251128 GCATTTTGGGAGGCTTAGGCAGG + Intergenic
1057805672 9:98218095-98218117 GCATTTGGGGAGGCTGTGGCAGG - Intronic
1057887617 9:98842433-98842455 GCACTTTGGGAGGCCTTGGCAGG - Intronic
1058020234 9:100078506-100078528 GCACTTTGGGAGGCAGTGGCAGG + Intronic
1058051905 9:100414815-100414837 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1058297400 9:103326511-103326533 GCATTTTGGGAGGCATAGGTGGG - Intergenic
1058443053 9:105028207-105028229 GCACTTTGGGAGGCAGTGGCGGG + Intergenic
1058469149 9:105258949-105258971 GCATTTTGGGAGGCCTAGGCGGG - Intronic
1058502095 9:105630885-105630907 ACATTTAGGGAGGCCGAGGCAGG + Intronic
1059259079 9:112958856-112958878 GCACTTAGGGAGGCAGTGGCAGG - Intergenic
1059297401 9:113283818-113283840 GCATTTTGGGAGGCAGAGGCAGG + Intronic
1059307286 9:113363940-113363962 TCACTTAGGGAGGCCTAGGCAGG + Intronic
1060285025 9:122243216-122243238 GCATTTAGGGAGGCTGAGGCAGG - Intronic
1060347777 9:122831711-122831733 CCATTTTGGGAGGCTGAGGCAGG + Intergenic
1060356525 9:122913751-122913773 GCATTTAGGGAGGCCGAGGCGGG - Intergenic
1060472295 9:123958257-123958279 GCATTTTGGGAGGCACAGGCAGG + Intergenic
1060633102 9:125177448-125177470 CCACTTAGGGAGGCAAAGACAGG + Intronic
1060646770 9:125287289-125287311 GCATTTTGGGAGGCAAAGGCAGG + Intronic
1061112714 9:128586377-128586399 GCATTTTGGGAGGCTTTGGCAGG - Intronic
1061428526 9:130516420-130516442 GCATTTAGGGAGGCTGAGGCAGG + Intergenic
1061717970 9:132532800-132532822 ACATTTTGGGAGGCAGAGGCAGG + Intronic
1061960976 9:133988963-133988985 ACACTTAGGGAGGCCTAGGCGGG + Intronic
1062301775 9:135877557-135877579 CCATTTTGGGAGGCCAAGGCAGG + Intronic
1062329893 9:136034845-136034867 GCATTTTGGAAGGCACTGGCGGG + Intronic
1062524053 9:136971122-136971144 GCATTTAGGGAGGCCGAGGCAGG + Intronic
1062685537 9:137810945-137810967 GCATTTTGGGAGGCAAAGGCAGG - Intronic
1203367969 Un_KI270442v1:274887-274909 GCATTTTGGGAGGCAGAGGCGGG - Intergenic
1185599198 X:1327401-1327423 CCACTTAGGGAGGCAGAGGTAGG + Intergenic
1185978191 X:4745568-4745590 CCATTTTGGGAGGCCTCGGCGGG + Intergenic
1186493005 X:9989653-9989675 CCACTTTGGGAGGCCTAGGCGGG - Intergenic
1187521118 X:20014961-20014983 GCATTTAGGGAGGCAGAGGCGGG - Intronic
1187909594 X:24098789-24098811 GAATTTAGGGAGGCAGAGGCAGG + Intergenic
1189124534 X:38432282-38432304 GCATTTTGGGAGGCCTAGGCGGG + Intronic
1189274669 X:39777022-39777044 GCATTTTGGGAGGCCTAGGCGGG + Intergenic
1189307808 X:40000284-40000306 GCACTTTGAGAGGCATTGGCAGG + Intergenic
1189435162 X:40986122-40986144 ACATTTAGGGAGGCCGAGGCAGG + Intergenic
1189765645 X:44369497-44369519 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
1189951806 X:46239999-46240021 GCACTTTGGGAGGCCTTGGCGGG + Intergenic
1190106743 X:47566685-47566707 CGCTGTAGGGGGGCATTGGCTGG - Exonic
1190202188 X:48371836-48371858 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
1190208350 X:48423577-48423599 GCATTTTGGGAGGCCTAGGCAGG + Intergenic
1191054063 X:56224015-56224037 GCACTTAGGGAGGCAGAGGCAGG - Intergenic
1192122390 X:68468946-68468968 GCATTTTGGGAGGCCTAGGCCGG - Intergenic
1192181016 X:68915814-68915836 GCACTTAGGGAGGCAGAGGCAGG - Intergenic
1193715401 X:84930156-84930178 ACACTTAGGGAGGCAGAGGCGGG + Intergenic
1193923177 X:87454437-87454459 GCATTTTGGGAGGCCTAGGCAGG - Intergenic
1194664670 X:96664325-96664347 CAATTTGGGGAGGCCTAGGCAGG + Intergenic
1195065244 X:101233774-101233796 CCATGTAGGCAGCCATTGCCAGG - Intronic
1195104622 X:101592431-101592453 GCACTTAGGGAGGCAGAGGCGGG - Intergenic
1195376958 X:104237333-104237355 CCACTTTGGGAGGCAGAGGCAGG + Intergenic
1195479428 X:105326301-105326323 CCATTTTGGGAGTCAGAGGCAGG - Intronic
1195640976 X:107174397-107174419 GCATTTTGGGAGGCCATGGCAGG - Intronic
1195666403 X:107434966-107434988 GCATTTTGGGAGGCAGAGGCGGG + Intergenic
1195714480 X:107805278-107805300 GCATTTAGGGAGGCAGAGGTGGG - Intergenic
1195751996 X:108169150-108169172 CCATTTAGTGAGAGGTTGGCTGG - Intronic
1195773082 X:108373154-108373176 GCTCTTAGGGAGGCATAGGCAGG + Intronic
1196187228 X:112757464-112757486 GCACTTTGGGAGGCAGTGGCAGG - Intergenic
1196321096 X:114341120-114341142 GCATTTTGGGAGGCCTAGGCGGG - Intergenic
1196794613 X:119492047-119492069 CCACTTTGGGAGGCAGAGGCAGG + Intergenic
1197016438 X:121631824-121631846 CCACTTTGGGAGGCAAAGGCAGG + Intergenic
1197210405 X:123823650-123823672 CCACTTTGGGAGGCAGAGGCAGG + Intergenic
1197229779 X:123991597-123991619 GCACTTAGGGAGGCAGAGGCGGG - Intronic
1197480326 X:126975999-126976021 CCATTTTGGGAGGCCAAGGCAGG - Intergenic
1197672708 X:129296322-129296344 GCATTTTGGGAGGCCTGGGCAGG + Intergenic
1198048129 X:132922814-132922836 ACACTTTGGGAGGCCTTGGCGGG + Intronic
1198415012 X:136411294-136411316 GCATTTTGGGAGGCAGAGGCAGG - Intronic
1198431452 X:136570802-136570824 ACATTTTGGGAGGCAGAGGCAGG - Intergenic
1199272880 X:145905799-145905821 ACATTTTGGGAGGCAAAGGCAGG + Intergenic
1199680092 X:150218161-150218183 CCCTCTGGGGAGGCAGTGGCAGG - Intergenic
1199776699 X:151018180-151018202 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1201070721 Y:10145364-10145386 GCATTTTGGGAGGCAGAGGCAGG + Intergenic
1201180905 Y:11344188-11344210 GCATTTTGGGAGGCTGTGGCGGG + Intergenic
1201299058 Y:12490387-12490409 CCATTTTGGGAGGCTGAGGCAGG - Intergenic
1201420932 Y:13797755-13797777 GCATTTTGGGAGGCAAAGGCGGG - Intergenic