ID: 1035346815

View in Genome Browser
Species Human (GRCh38)
Location 7:158205776-158205798
Sequence AGAGAGAGCACAGTGATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035346806_1035346815 24 Left 1035346806 7:158205729-158205751 CCCCTGCAGTGGCTGTGTGCCCC 0: 1
1: 0
2: 3
3: 31
4: 361
Right 1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG No data
1035346811_1035346815 3 Left 1035346811 7:158205750-158205772 CCAGAGAGAGAACGCATGCACTT 0: 1
1: 0
2: 1
3: 5
4: 92
Right 1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG No data
1035346805_1035346815 25 Left 1035346805 7:158205728-158205750 CCCCCTGCAGTGGCTGTGTGCCC 0: 1
1: 0
2: 5
3: 38
4: 341
Right 1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG No data
1035346810_1035346815 4 Left 1035346810 7:158205749-158205771 CCCAGAGAGAGAACGCATGCACT 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG No data
1035346808_1035346815 22 Left 1035346808 7:158205731-158205753 CCTGCAGTGGCTGTGTGCCCCAG 0: 1
1: 0
2: 7
3: 41
4: 384
Right 1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG No data
1035346807_1035346815 23 Left 1035346807 7:158205730-158205752 CCCTGCAGTGGCTGTGTGCCCCA 0: 1
1: 0
2: 2
3: 39
4: 245
Right 1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG No data
1035346803_1035346815 30 Left 1035346803 7:158205723-158205745 CCCATCCCCCTGCAGTGGCTGTG 0: 1
1: 0
2: 9
3: 40
4: 334
Right 1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG No data
1035346804_1035346815 29 Left 1035346804 7:158205724-158205746 CCATCCCCCTGCAGTGGCTGTGT 0: 1
1: 2
2: 10
3: 63
4: 418
Right 1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG No data
1035346809_1035346815 5 Left 1035346809 7:158205748-158205770 CCCCAGAGAGAGAACGCATGCAC 0: 1
1: 0
2: 1
3: 16
4: 158
Right 1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035346815 Original CRISPR AGAGAGAGCACAGTGATAGT GGG Intronic
No off target data available for this crispr