ID: 1035349531

View in Genome Browser
Species Human (GRCh38)
Location 7:158236471-158236493
Sequence CCTTCGGGCAGCTTTGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035349531_1035349541 3 Left 1035349531 7:158236471-158236493 CCTCAAGCAAAGCTGCCCGAAGG No data
Right 1035349541 7:158236497-158236519 GGTCTGCCCTGGCGTCTGTGGGG 0: 1
1: 0
2: 4
3: 22
4: 204
1035349531_1035349546 9 Left 1035349531 7:158236471-158236493 CCTCAAGCAAAGCTGCCCGAAGG No data
Right 1035349546 7:158236503-158236525 CCCTGGCGTCTGTGGGGTGGGGG No data
1035349531_1035349537 -8 Left 1035349531 7:158236471-158236493 CCTCAAGCAAAGCTGCCCGAAGG No data
Right 1035349537 7:158236486-158236508 CCCGAAGGTGGGGTCTGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 232
1035349531_1035349540 2 Left 1035349531 7:158236471-158236493 CCTCAAGCAAAGCTGCCCGAAGG No data
Right 1035349540 7:158236496-158236518 GGGTCTGCCCTGGCGTCTGTGGG No data
1035349531_1035349543 7 Left 1035349531 7:158236471-158236493 CCTCAAGCAAAGCTGCCCGAAGG No data
Right 1035349543 7:158236501-158236523 TGCCCTGGCGTCTGTGGGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 206
1035349531_1035349542 6 Left 1035349531 7:158236471-158236493 CCTCAAGCAAAGCTGCCCGAAGG No data
Right 1035349542 7:158236500-158236522 CTGCCCTGGCGTCTGTGGGGTGG No data
1035349531_1035349539 1 Left 1035349531 7:158236471-158236493 CCTCAAGCAAAGCTGCCCGAAGG No data
Right 1035349539 7:158236495-158236517 GGGGTCTGCCCTGGCGTCTGTGG No data
1035349531_1035349544 8 Left 1035349531 7:158236471-158236493 CCTCAAGCAAAGCTGCCCGAAGG No data
Right 1035349544 7:158236502-158236524 GCCCTGGCGTCTGTGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035349531 Original CRISPR CCTTCGGGCAGCTTTGCTTG AGG (reversed) Intronic