ID: 1035355256

View in Genome Browser
Species Human (GRCh38)
Location 7:158272794-158272816
Sequence TGCCGGCGGCACCTCCCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035355256_1035355259 -10 Left 1035355256 7:158272794-158272816 CCATCGGGGAGGTGCCGCCGGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1035355259 7:158272807-158272829 GCCGCCGGCAGAAGGAGAGGTGG No data
1035355256_1035355266 11 Left 1035355256 7:158272794-158272816 CCATCGGGGAGGTGCCGCCGGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1035355266 7:158272828-158272850 GGGAAGGCTGAGTGGATGGAAGG No data
1035355256_1035355265 7 Left 1035355256 7:158272794-158272816 CCATCGGGGAGGTGCCGCCGGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1035355265 7:158272824-158272846 AGGTGGGAAGGCTGAGTGGATGG 0: 1
1: 1
2: 2
3: 99
4: 761
1035355256_1035355263 -5 Left 1035355256 7:158272794-158272816 CCATCGGGGAGGTGCCGCCGGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1035355263 7:158272812-158272834 CGGCAGAAGGAGAGGTGGGAAGG 0: 1
1: 0
2: 3
3: 64
4: 696
1035355256_1035355264 3 Left 1035355256 7:158272794-158272816 CCATCGGGGAGGTGCCGCCGGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1035355264 7:158272820-158272842 GGAGAGGTGGGAAGGCTGAGTGG No data
1035355256_1035355269 30 Left 1035355256 7:158272794-158272816 CCATCGGGGAGGTGCCGCCGGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1035355269 7:158272847-158272869 AAGGATCAGGAATGACCAGGAGG 0: 1
1: 0
2: 0
3: 29
4: 253
1035355256_1035355267 17 Left 1035355256 7:158272794-158272816 CCATCGGGGAGGTGCCGCCGGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1035355267 7:158272834-158272856 GCTGAGTGGATGGAAGGATCAGG 0: 1
1: 0
2: 2
3: 19
4: 308
1035355256_1035355261 -9 Left 1035355256 7:158272794-158272816 CCATCGGGGAGGTGCCGCCGGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1035355261 7:158272808-158272830 CCGCCGGCAGAAGGAGAGGTGGG No data
1035355256_1035355268 27 Left 1035355256 7:158272794-158272816 CCATCGGGGAGGTGCCGCCGGCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1035355268 7:158272844-158272866 TGGAAGGATCAGGAATGACCAGG 0: 1
1: 0
2: 0
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035355256 Original CRISPR TGCCGGCGGCACCTCCCCGA TGG (reversed) Intronic
900181782 1:1314285-1314307 TCCTGGCGGCACCTACCAGAAGG + Exonic
901151678 1:7107599-7107621 TGCAGGAGCCACCTCCCGGAGGG + Intronic
901758451 1:11455532-11455554 TTCGGGCTGCCCCTCCCCGATGG - Intergenic
906379713 1:45324786-45324808 TGCCAGTGGTACCTCCCAGAAGG - Intergenic
922250717 1:223846266-223846288 TGCCGCCGTCACCTCCTCGGCGG + Intergenic
923042989 1:230333088-230333110 TGCCGGCGGCTCCTCCGCCCTGG + Intronic
1077431611 11:2518453-2518475 TGCCTGCAGCACCTCCCCAGAGG - Intronic
1083131106 11:60623131-60623153 TGCCGGGCACACCTCCCAGATGG - Intergenic
1088257279 11:107912960-107912982 TGCTGGTCACACCTCCCCGACGG - Intronic
1089350982 11:117821620-117821642 TGCCCGTGGCAGCTCCCGGAGGG - Intronic
1091290827 11:134438819-134438841 TGCAGTCGGCACCTCCCCCCGGG - Intergenic
1092385417 12:8032866-8032888 TGGCGGCAGCACCTCCTCTAGGG - Exonic
1094536280 12:31324948-31324970 TGCCGGCCGGACCTGCCCGACGG + Intronic
1108173946 13:47773131-47773153 TGTCAGCTGCACCTCCCTGAGGG + Intergenic
1118184357 14:63523194-63523216 TGCCGGGCACACCTCCCAGATGG - Intronic
1118517358 14:66545087-66545109 TGCCGGGCACACCTCCCAGACGG + Intronic
1121253086 14:92513911-92513933 TGCCGCCGGCAGCTCCGGGACGG - Exonic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130224600 15:82047151-82047173 CGCCCGCGGCCCCGCCCCGACGG + Intergenic
1139806068 16:69566228-69566250 TGGCGGCGGCACCTCCTCTCCGG - Exonic
1143036972 17:4005003-4005025 GGCCGGAGTCACCTCCCCTATGG - Exonic
1143321337 17:6070795-6070817 TGCCGGGGGCACCTTCCCGGGGG + Intronic
1147954264 17:44123561-44123583 CGGCGGCAGCACCTCCTCGACGG + Exonic
1148725750 17:49788812-49788834 TGCCGGCGGCTGCGGCCCGACGG - Exonic
1149130594 17:53296370-53296392 TGATGGCTGCACCTCCCTGAAGG + Intergenic
1152922773 17:83074029-83074051 TGCCCCTGGCACCACCCCGAAGG - Intergenic
1155345593 18:24853598-24853620 TCCTGGCTGCACCTCCCTGAGGG + Intergenic
1155496866 18:26451288-26451310 TGCAAGCGCCACCTCCCCAAAGG + Intergenic
1160919113 19:1511726-1511748 TGCCGGCCGCACCTTCCGCAGGG - Intronic
1165454633 19:35903576-35903598 TGCCCGCCGCACAGCCCCGAGGG + Intronic
1165933734 19:39376562-39376584 TGCCCCCAGCACCTCCCTGATGG - Intronic
1166105190 19:40594715-40594737 TGCCGTCGTCACCTGCCCCAGGG + Intronic
1168701456 19:58442027-58442049 GGCCAGCAGCACCTCCCAGAGGG - Intergenic
926674694 2:15611393-15611415 TGCCGGGCACACCTCCCAGACGG + Intronic
936858862 2:116992349-116992371 TGATGGAAGCACCTCCCCGATGG - Intergenic
947472392 2:230411622-230411644 TGCCTTCTGCACCTCCCCGGAGG - Intergenic
1168777651 20:461950-461972 TCCCGGAGCCGCCTCCCCGAGGG - Intronic
1173800443 20:45891478-45891500 TGCTGGCGGCGCCTCCGCGAGGG - Intronic
1176104455 20:63379368-63379390 CCCCGGCTACACCTCCCCGACGG - Intergenic
1177894542 21:26844418-26844440 TGCCGGCGGCTTCTCCCCTGGGG + Exonic
1180008540 21:45034677-45034699 CCCCTGCGGCCCCTCCCCGATGG - Intergenic
1181297054 22:21847923-21847945 TGCCGGGCACACCTCCCAGACGG - Intronic
1183491943 22:38121546-38121568 GGCCGGCTGCACCTCCAGGAAGG + Intronic
1185063358 22:48618644-48618666 TGCCTCCGGGACCTCCCAGACGG - Intronic
949853653 3:8440708-8440730 TGCCGGGCACACCTCCCAGACGG - Intergenic
953652553 3:44820859-44820881 TGCCGGGCACACCTCCCAGACGG + Intronic
960477288 3:118145088-118145110 TGGCGGCTGCCCCTCCCCCAAGG + Intergenic
968532969 4:1104933-1104955 TGCTGGGGGCTCCTCCCCCAGGG + Intronic
968629078 4:1641060-1641082 TGCCGCCGGCACCTGCCCTGGGG - Exonic
968629095 4:1641122-1641144 TGCCGCCGGCACCTGCCCTGGGG - Exonic
969087653 4:4668318-4668340 TGCCGGCGTCACCTCCTCCAGGG + Intergenic
969577308 4:8043900-8043922 GGCGGGCGGCACCTCGCCCAGGG + Intronic
972551694 4:40141098-40141120 TGCCGGGCACACCTCCCAGATGG + Intronic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
985749634 5:1667026-1667048 TGCCTGTGGCACCTCCTAGAAGG + Intergenic
988166056 5:27590805-27590827 TGCAGCCAGCACCTCCCAGAGGG + Intergenic
1004414747 6:15415323-15415345 TGCCGGCTACACCTCCCAGACGG + Intronic
1004693282 6:18011290-18011312 TGCCGCCGGAGCCTCCCCAACGG - Intergenic
1022108621 7:27214114-27214136 TGCTGCCGGCGCCTGCCCGAGGG + Intergenic
1035355256 7:158272794-158272816 TGCCGGCGGCACCTCCCCGATGG - Intronic
1037811428 8:22089288-22089310 TGCCGGCCTCACCGCCCCCACGG - Exonic
1037876558 8:22551638-22551660 TCCCGGCGCCGCCTCCCCGCCGG + Intronic
1038018867 8:23536447-23536469 TGCCAGGGGCACCTCCGAGAGGG + Intronic
1042611698 8:70607891-70607913 CGTCGGCGGCAGCTCCCCGGCGG - Intronic
1045486880 8:102638414-102638436 TCCCTGCAGCACCTCCCAGAGGG + Intergenic
1047215078 8:122869571-122869593 TCCCGGCGACAGCTCCCTGAGGG - Intronic
1049729442 8:144168373-144168395 CACCGGCCGCGCCTCCCCGAGGG - Exonic
1052942172 9:34138225-34138247 TGCCGGGCACACCTCCCAGACGG - Intergenic
1062689740 9:137835049-137835071 AGCCGGCGGCGCAGCCCCGAAGG - Exonic
1185767894 X:2740855-2740877 TGCCTGAGGCTCCTCCCTGAAGG + Exonic
1189160278 X:38803737-38803759 TGCCGGCCCCTCTTCCCCGACGG + Exonic
1200066919 X:153508366-153508388 GGCCGGCTGCACCTCCCAGTAGG - Exonic