ID: 1035356694

View in Genome Browser
Species Human (GRCh38)
Location 7:158280010-158280032
Sequence CCGCGGGGCTCTGTGGGTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035356694 Original CRISPR CCGCGGGGCTCTGTGGGTTC GGG (reversed) Intronic
900591753 1:3463300-3463322 CCGCCGGGCTCTCTGTGCTCAGG - Exonic
900646285 1:3710174-3710196 CTGCTGGGCTCTGTGGATGCTGG + Intronic
901679873 1:10906679-10906701 ACACGGGGCTCTGTGGATCCTGG - Intergenic
903226233 1:21895504-21895526 CAGAGGGGCTCTGTGGAATCGGG - Intronic
903226393 1:21896346-21896368 CCGTGGGGCTCAGTGGGAGCTGG - Intronic
905212869 1:36386200-36386222 CCGCGAGGTTCTGTGGGGTCGGG - Intergenic
906152999 1:43598707-43598729 CCGCTGGGCACTGGGGGGTCAGG - Exonic
909274704 1:73668268-73668290 GAGCAGGGCTCTGTGGGTTTGGG + Intergenic
913503895 1:119498014-119498036 CAGCGAGACTCTGTGGGTTTAGG - Intergenic
918428426 1:184434265-184434287 CCGAGGGTCTCTGTGGTGTCAGG + Intronic
920017712 1:202927096-202927118 CGGTGCGGCTGTGTGGGTTCGGG - Exonic
923296969 1:232603572-232603594 CCTCCCGGCTCTGTGGGTCCTGG - Intergenic
924327612 1:242911485-242911507 CCTCAGGGCACTGTGGGATCTGG - Intergenic
1065771808 10:29084991-29085013 CCGCAGGGCAGTGTGGGGTCCGG + Intergenic
1067189243 10:44056090-44056112 CCATGGGGGTCTGTGTGTTCAGG - Intergenic
1069121905 10:64577507-64577529 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1070201096 10:74207237-74207259 CTTTGGGGCTCTGTGGTTTCTGG - Intronic
1072625961 10:97112162-97112184 CTGCTGGGCTCTGAGGGTCCAGG - Intronic
1074578131 10:114690197-114690219 CCACGGGGCGCTTTGGGTCCAGG - Intergenic
1074578549 10:114694241-114694263 CAGCTGAGCTGTGTGGGTTCTGG + Intergenic
1076873117 10:133203168-133203190 CCGCTGGACTCTGTGCGTTTGGG - Intronic
1076873136 10:133203240-133203262 CCGCTGGACTCTGTGCGTTTGGG - Intronic
1077244417 11:1529256-1529278 CAGTGTGGCTCGGTGGGTTCCGG + Intergenic
1077532096 11:3102115-3102137 GGGCGGGGCTCTGTGGGGGCGGG - Intronic
1078823476 11:14905663-14905685 CCGCGGGGCTCTGTGTGTGGAGG - Intronic
1083428585 11:62602162-62602184 CTCCGGGGCTCTGTGGGGTGGGG - Intergenic
1083430658 11:62612425-62612447 CCGCGGGGCCCGGTGAGTACGGG - Exonic
1083657132 11:64234980-64235002 CCGAGGGGATCTGCGGGGTCCGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084490709 11:69476713-69476735 CAGCGGGGCTCCGGGGGCTCTGG - Intergenic
1084749301 11:71193709-71193731 CAGCGTGTCTCTGTGGTTTCAGG - Intronic
1085383752 11:76143558-76143580 CCACGGGGCTGTGTGGGTCGAGG - Intergenic
1089879706 11:121762076-121762098 CAGGGGAGCTCTGTGGGTGCAGG + Intergenic
1095128305 12:38508223-38508245 TTGCTGGGCTCTGTGGGTGCGGG - Intergenic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1097250937 12:57632099-57632121 CCGCCGGGCCCTGTGCGCTCTGG - Exonic
1098767995 12:74514429-74514451 CCATGGGGCTCTGTGGTTACTGG - Intergenic
1100532502 12:95473626-95473648 CCGCGAGGCTCTGTAGGCACTGG - Intronic
1101834951 12:108288597-108288619 CTGCAGGGCTCTGTGCGCTCTGG + Exonic
1103794532 12:123494298-123494320 CCTTGGAGCTCTGTGAGTTCAGG - Intronic
1103901537 12:124306091-124306113 ACTCGGGGCTCTCTGGGTTGGGG + Intronic
1103918837 12:124389196-124389218 GCCCGGGGGTCTGTGGGCTCTGG - Intronic
1108848236 13:54700207-54700229 CCTTGGGGCTCTGTGGTTTCTGG - Intergenic
1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG + Intergenic
1111485788 13:88896495-88896517 CCTTGGGGCTCTGTGGTTCCTGG + Intergenic
1114063125 14:19038027-19038049 CCACGGCGCTCTCTGGGTTACGG - Intergenic
1114099133 14:19361968-19361990 CCACGGCGCTCTCTGGGTTACGG + Intergenic
1117285405 14:54282053-54282075 CTCCGGGGCTCTGTGGTTCCTGG - Intergenic
1121521672 14:94590338-94590360 CCCTGGGGCTGTGTGGGTTTAGG - Intronic
1122132709 14:99614390-99614412 CACAGGGGCTCTGTGAGTTCAGG - Intergenic
1122385999 14:101348711-101348733 CTTTGGGGCTCTGTGGTTTCTGG - Intergenic
1122627360 14:103091366-103091388 CCGCTCGGCTGTGTGGGTCCCGG - Intergenic
1122694836 14:103547476-103547498 CCCCAAGGCTCTGTGGGATCTGG + Intergenic
1122786354 14:104166022-104166044 CCTGGGGGCACTGTGGGTGCAGG + Intronic
1123014149 14:105365591-105365613 CCACGGGGCTCAGAGGGGTCTGG - Intronic
1124036844 15:26061403-26061425 CCGAAGGGATCTGTGTGTTCAGG - Intergenic
1129539984 15:76341328-76341350 CCTCGGGACTCTGCGGGTTGGGG + Intronic
1132154992 15:99489423-99489445 CCGCAGGGCTGTGTGCCTTCTGG + Intergenic
1132554313 16:565923-565945 CCCCGGGGCTCTGTGGCTGGAGG + Intergenic
1132672466 16:1107480-1107502 CTGCGGGGCTCTGTGGCTGCAGG - Intergenic
1136022629 16:27449701-27449723 CTCCGGGGCTTTGTGGGATCAGG + Exonic
1138497389 16:57416590-57416612 CGAGGGGGCTCTGTGGGTCCTGG + Intergenic
1138540272 16:57683712-57683734 CCACGGGGCCCTGTGGGTTCCGG - Intronic
1139138618 16:64234149-64234171 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1142222690 16:88863481-88863503 CTGCGGGGCTCTGGGTGTTGAGG - Exonic
1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG + Intronic
1143081240 17:4383009-4383031 CCGCCGGGCTCTGTGGCTCACGG - Intergenic
1146033953 17:29390369-29390391 CGGCCGGGCTCTGTGGCTTCAGG + Intergenic
1148615480 17:48997292-48997314 CCGAGGGGCCCTGTGGCGTCGGG + Intergenic
1151943984 17:77309373-77309395 CTGTGGGCCTCTGTGGGCTCTGG + Intronic
1152227112 17:79097621-79097643 CCGTGGGGCTCCGGGGGCTCTGG - Intronic
1152560977 17:81078613-81078635 GAGCCGGGCTCTGTGGGTGCAGG + Intronic
1152566396 17:81102247-81102269 CCTCGGGGCTCTCAGGGTGCGGG + Intronic
1152687251 17:81700706-81700728 CCGGGAGGCTCTGTGGGGCCTGG - Exonic
1154310286 18:13261994-13262016 CCGTGGGGCTCTGTGCGTGGGGG + Intronic
1156327365 18:36086173-36086195 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1157725756 18:49962466-49962488 CCCAGGGGCTCAGTGAGTTCTGG + Intronic
1158215561 18:55097339-55097361 CAGCTGGGCTCTGAGGGCTCTGG - Intergenic
1160049727 18:75421576-75421598 ACGTGGAGCTCTGTGGGGTCAGG + Intronic
1160226106 18:77012276-77012298 CCGGGGGGCCCTGTGGGCACTGG + Intronic
1160703724 19:519571-519593 CCGCGGCGCTGTGTGGGGACCGG - Exonic
1160849820 19:1185037-1185059 CCCCGGGGCTCTGTGACCTCAGG + Intronic
1161171044 19:2812646-2812668 CTGCGGGGCTCTGGGGCGTCGGG + Intronic
1162887917 19:13710054-13710076 CTGAGGGGCTCTGTAGGTTTGGG + Intergenic
1163111222 19:15161723-15161745 TCGCTGACCTCTGTGGGTTCTGG - Intronic
1163188716 19:15659299-15659321 CTGCGGGGCTCGGTGTGGTCAGG - Exonic
1163193483 19:15696987-15697009 CTGCGGGGCTCAGTGTGGTCTGG - Exonic
1163216078 19:15878835-15878857 CTGCGGGGCTCGGTGTGGTCAGG + Exonic
1165027389 19:32971790-32971812 GCGTGGGGCTCTGTGGGGCCGGG - Intronic
1165774224 19:38395513-38395535 GCCAGGGGCTCTGAGGGTTCCGG - Exonic
1166727511 19:45037776-45037798 TCGCGGGGCTACGTGGCTTCAGG - Exonic
1166784993 19:45362412-45362434 CCGTGGGACTCTGTGGGATGTGG - Intronic
1166809578 19:45507419-45507441 GCGCGGGGCATTGTGGGTGCGGG + Exonic
1167137479 19:47625842-47625864 CCGTGGGGCTGTGTGGGGGCCGG + Intronic
1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG + Intronic
1168563556 19:57403834-57403856 CCTTGGGGCTCTGTGGTTGCTGG + Intronic
927743082 2:25590119-25590141 CCTTGGGGCTCTGTGGTTCCTGG - Intronic
927857505 2:26536691-26536713 CCGCTTGGCTCTGTGGGGGCTGG - Intronic
928286809 2:29997167-29997189 CTGAGGGGCTCTGTGTGTTTTGG - Intergenic
929201758 2:39244028-39244050 GCGCGGGGCACTGCGGCTTCCGG + Intergenic
929313468 2:40451554-40451576 GCGCTGGGCTCTGAGGATTCAGG - Intronic
930668226 2:54120837-54120859 CCTTGGGGCTCTGTGGTTGCTGG - Intronic
932607432 2:73174817-73174839 CTGCGGGGCCCTCTGGGATCTGG - Intergenic
932722024 2:74145441-74145463 CAGAGGGGCTCTGTGGTATCAGG + Intronic
932960388 2:76406487-76406509 CCTTGGGGCTCTGTGGTTGCTGG + Intergenic
935699183 2:105796186-105796208 CCTCTGGGCACTGTGGCTTCAGG + Intronic
937573503 2:123391887-123391909 CTGCGGGGCTCTGTGGGGGTGGG - Intergenic
941834132 2:169997428-169997450 CCTTGGGGCTCTGTGGTTGCTGG - Intronic
947524362 2:230869362-230869384 CCACTGGGCTCTGTGTGCTCAGG + Intronic
948424510 2:237878559-237878581 CAGCGGGGCTCTGAGGGTAGAGG - Intronic
948681921 2:239640931-239640953 CCAAGGGGCTCTGTGGGCACTGG - Intergenic
949035445 2:241813943-241813965 CCACGGGGCTCTCTGGGGACAGG - Intronic
1170458469 20:16554752-16554774 CTTTGGGGCTCTGTGGTTTCTGG + Intronic
1174191944 20:48747207-48747229 CCTCGGGGCTCTGAGGGTCCTGG - Intronic
1179501660 21:41813040-41813062 CTGGGGGGCTCTGGGGGGTCAGG + Intronic
1179543272 21:42098211-42098233 TCGTGGGGCTCTCTGGGATCCGG - Intronic
1180177679 21:46098305-46098327 GCGGGGGGCTCGGCGGGTTCGGG + Intronic
1180481618 22:15760656-15760678 CCACGGCGCTCTCTGGGTTACGG - Intergenic
1180782736 22:18529881-18529903 CGGCGGGGCACTGTGGGGCCGGG + Intronic
1181126295 22:20703908-20703930 CGGCGGGGCACTGTGGGGCCGGG + Intergenic
1181239626 22:21469219-21469241 CGGCGGGGCACTGTGGGGCCGGG + Intergenic
1181482961 22:23212541-23212563 CCACTGGGCTCTGTGGGGCCTGG + Intronic
1182667599 22:31970879-31970901 CCGCCAGGCTCCGTGGGTTTTGG + Intergenic
1183872304 22:40749024-40749046 CCTTGGGGCTCTGTGGTTGCTGG + Intergenic
1184333825 22:43841700-43841722 CCTGGGGGCTCTGTGGATTAGGG - Intronic
1184684322 22:46089245-46089267 CCCCTGGGCCCTGTGGGTGCTGG + Intronic
1185266496 22:49906860-49906882 CTGCCGGGCCCTGTGGGTGCTGG - Intronic
1185317917 22:50186619-50186641 CTGCGGGTCTCTGGGGGTGCTGG + Intronic
950452635 3:13073732-13073754 CCGCGGAGCTCTCGGGGCTCTGG + Intergenic
953147340 3:40290878-40290900 CCTTGGGGCTCTGTGGTTGCTGG - Intergenic
961661195 3:128469631-128469653 CCACGGGGCTCTGCAGTTTCCGG + Intergenic
968504320 4:964892-964914 CCGTGGGGCACCGTGGGGTCAGG - Intronic
968572108 4:1347280-1347302 CCCCGGGGCTCTGCGGGCGCCGG + Intronic
968739377 4:2319628-2319650 CGGCTGGGCTCTGTCGGCTCAGG + Intronic
969527054 4:7709174-7709196 CCCCGCGGCTCTGCGGGTTCTGG - Intronic
971249046 4:24956797-24956819 TGGCGGGTCTCTTTGGGTTCTGG + Intronic
975066913 4:70077387-70077409 CAGCGGGACTCTGTGGGTGTAGG - Intergenic
978466827 4:109017056-109017078 CTTCGGGGCTCTGTGATTTCTGG + Intronic
979485202 4:121262847-121262869 GCTCAGGGCTCTGTGGGTTCTGG + Intergenic
988503012 5:31799177-31799199 ACGTGGGGCCCTGTGGGGTCTGG + Exonic
992645254 5:78805768-78805790 CCGGGTGGCTCTGTGGGTTCCGG + Intronic
994366989 5:98928403-98928425 CCGGGTGGCTCTGTGAGTGCCGG - Intronic
999874257 5:155784593-155784615 CCATGGGGCTGTGTTGGTTCTGG + Intergenic
1002385037 5:178860199-178860221 CCGAGGGCCTCTGTGGGCGCGGG + Intronic
1002892779 6:1350529-1350551 CCAAGGGGCTCTGTGTGTTTTGG - Intergenic
1003569902 6:7248848-7248870 CCGCCGGGCTCTCTGGGTTAAGG - Exonic
1005285760 6:24325128-24325150 CCACGGGGCTCTGGAGATTCTGG - Intronic
1005380425 6:25228732-25228754 CCGCCTAGCTCTGTGGGCTCAGG + Intergenic
1006593133 6:35172706-35172728 CTGGGAGGCTTTGTGGGTTCTGG - Intergenic
1007137162 6:39533382-39533404 CAGCGAGACTCTGTGGGTGCAGG - Intronic
1007432836 6:41786526-41786548 CCGCGGCGCGGGGTGGGTTCGGG - Intronic
1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG + Intergenic
1015938266 6:138424260-138424282 CCGCGGGGCTCTGGGCGCTGCGG - Exonic
1018091334 6:160348660-160348682 CCGCGGCGCTCGGGGGGCTCTGG - Exonic
1018961713 6:168454213-168454235 CCTCTGGGCTCTGTGTGTCCCGG + Intronic
1019606535 7:1912905-1912927 GGGCGGGGCTGTGTGGGCTCCGG + Intronic
1019624886 7:2011080-2011102 CACCTGGGCTCTGTGGGGTCAGG + Intronic
1019736543 7:2652723-2652745 CCTCAGGGCTCTGTGGTCTCTGG + Intronic
1021343030 7:19488433-19488455 CTTTGGGGCTCTGTGGTTTCTGG - Intergenic
1026986708 7:74559467-74559489 CCCTGGGGCTCTGTGTGTGCGGG - Intronic
1027374606 7:77537417-77537439 CCGCGGGGCTTGGCGGGGTCGGG + Exonic
1030722035 7:112882002-112882024 CTTTGGGGCTCTGTGGTTTCTGG + Intronic
1031939847 7:127776936-127776958 CCTTTGGGATCTGTGGGTTCAGG + Intronic
1032446937 7:131992155-131992177 CCGAAGGGCTCTGTGAGGTCAGG + Intergenic
1032649038 7:133857783-133857805 CCTTGGGGCTCTGTGGTTGCTGG - Intronic
1033267370 7:139897725-139897747 CTGCAGGGCTCTGTGAATTCAGG + Intronic
1034469767 7:151248952-151248974 CCGCGGGCCTCGGCGGCTTCGGG - Exonic
1034844536 7:154431938-154431960 GCCCTGGGCTCTGTGGTTTCAGG + Intronic
1035356694 7:158280010-158280032 CCGCGGGGCTCTGTGGGTTCGGG - Intronic
1035812482 8:2504348-2504370 TGGCAAGGCTCTGTGGGTTCTGG - Intergenic
1036768506 8:11563810-11563832 CCGCGGGGCACAGTGGGCCCAGG - Intronic
1039470077 8:37807996-37808018 CAGAGAGGCTCTGTGGGCTCTGG - Intronic
1040080318 8:43277190-43277212 CCGCGTGGCGCCGTGGGTCCCGG - Intergenic
1040495168 8:47959962-47959984 CCGCGGTGCTGGGTGGGTACCGG - Exonic
1040568991 8:48591672-48591694 CCGGGGGGCACGGAGGGTTCCGG + Intergenic
1041350849 8:56946607-56946629 CCCTAGGGCTCTTTGGGTTCAGG - Intergenic
1046093732 8:109533901-109533923 CAGCTGAGCTCTCTGGGTTCTGG - Intergenic
1049223184 8:141437057-141437079 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223214 8:141437131-141437153 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223229 8:141437168-141437190 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG + Intergenic
1049223274 8:141437279-141437301 CCGTGGGGAGCTGTGGGTCCTGG + Intergenic
1049423405 8:142526674-142526696 CCCCGGGGCTGGGTGGGCTCTGG - Intronic
1049777957 8:144415133-144415155 CCGCGAGTCTGTGTGGGCTCCGG + Intronic
1049794977 8:144493118-144493140 CCGCTGGGCCATGTGGATTCAGG - Intronic
1051331835 9:16031849-16031871 CCCCAGGGCTCTGTGGGATGTGG + Intronic
1053004144 9:34593244-34593266 GCCCGGGGCTCTGTCGGATCGGG - Intergenic
1054887270 9:70212393-70212415 GAGCGAGGCTCTGTGGGTTTGGG + Intronic
1059104911 9:111502453-111502475 CTCTGGGGCTCTGTGGTTTCTGG + Intergenic
1060051883 9:120383720-120383742 CCGCGGGGCTCTGGGAGCTCTGG + Intergenic
1060763501 9:126275790-126275812 CCGCAGGGCGCTCTGGGCTCCGG - Intergenic
1061155052 9:128854791-128854813 CCGCGGTCATCTGTGGGTCCTGG - Intronic
1061259104 9:129469799-129469821 GGGCGGGGCTCTGGGGCTTCTGG + Intergenic
1061543139 9:131289002-131289024 AAGCGGGGCTCTGGGGGCTCTGG - Intergenic
1061904919 9:133691854-133691876 CCCCAGGGCTCTGCGGGTCCTGG - Intronic
1061943324 9:133894497-133894519 CCGGGGAGCTCTGGGGTTTCTGG - Intronic
1062452016 9:136619796-136619818 CAGCTGGGCTCTGTGGGTCGGGG - Intergenic
1188647966 X:32592802-32592824 CCTTGGGGCTCTGTGGTTCCTGG + Intronic
1190055680 X:47179896-47179918 CCATGGTGCTGTGTGGGTTCAGG - Exonic
1199991890 X:152992076-152992098 ACTCGGGGCTATGTGGGCTCAGG + Exonic
1200062669 X:153490514-153490536 CAGCGGGGACCTCTGGGTTCAGG - Intronic
1200079180 X:153567101-153567123 CACCGGGGCTCTCTGTGTTCTGG - Intronic
1200241583 X:154497892-154497914 CAGCTGGGCTCGGTGGCTTCAGG - Intergenic
1201171791 Y:11273764-11273786 CAGCGAGGCTCTGTGGGTGTAGG + Intergenic
1201225025 Y:11810399-11810421 CCTCAGGGCACTGTGGGATCTGG - Intergenic