ID: 1035360632

View in Genome Browser
Species Human (GRCh38)
Location 7:158311057-158311079
Sequence TCTTGTTTTACCTCCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 254}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035360632_1035360636 -5 Left 1035360632 7:158311057-158311079 CCAGGATGGGAGGTAAAACAAGA 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1035360636 7:158311075-158311097 CAAGACAGGCGAGCACAGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 197
1035360632_1035360635 -8 Left 1035360632 7:158311057-158311079 CCAGGATGGGAGGTAAAACAAGA 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1035360635 7:158311072-158311094 AAACAAGACAGGCGAGCACAGGG No data
1035360632_1035360639 11 Left 1035360632 7:158311057-158311079 CCAGGATGGGAGGTAAAACAAGA 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1035360639 7:158311091-158311113 AGGGAGGGCGCAAATAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1035360632_1035360640 16 Left 1035360632 7:158311057-158311079 CCAGGATGGGAGGTAAAACAAGA 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1035360640 7:158311096-158311118 GGGCGCAAATAGAGTGGGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1035360632_1035360641 19 Left 1035360632 7:158311057-158311079 CCAGGATGGGAGGTAAAACAAGA 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1035360641 7:158311099-158311121 CGCAAATAGAGTGGGCAAGGAGG 0: 1
1: 0
2: 2
3: 7
4: 145
1035360632_1035360642 22 Left 1035360632 7:158311057-158311079 CCAGGATGGGAGGTAAAACAAGA 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1035360642 7:158311102-158311124 AAATAGAGTGGGCAAGGAGGAGG No data
1035360632_1035360638 10 Left 1035360632 7:158311057-158311079 CCAGGATGGGAGGTAAAACAAGA 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1035360638 7:158311090-158311112 CAGGGAGGGCGCAAATAGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 116
1035360632_1035360637 -4 Left 1035360632 7:158311057-158311079 CCAGGATGGGAGGTAAAACAAGA 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1035360637 7:158311076-158311098 AAGACAGGCGAGCACAGGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 287
1035360632_1035360634 -9 Left 1035360632 7:158311057-158311079 CCAGGATGGGAGGTAAAACAAGA 0: 1
1: 0
2: 1
3: 28
4: 254
Right 1035360634 7:158311071-158311093 AAAACAAGACAGGCGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035360632 Original CRISPR TCTTGTTTTACCTCCCATCC TGG (reversed) Intronic
900878262 1:5361615-5361637 TCTTGTTTGGAATCCCATCCAGG - Intergenic
904880229 1:33690856-33690878 TCATGCCTTACCTCCCCTCCTGG - Intronic
905059097 1:35124013-35124035 TCTTGCTCTATCACCCATCCTGG + Intergenic
905517220 1:38570647-38570669 TCAAGCTTTGCCTCCCATCCTGG - Intergenic
906113169 1:43337997-43338019 TCTTACTCTACCTCCCCTCCCGG - Intronic
908546401 1:65166547-65166569 TCTTGCTTTATCTCCCAGGCTGG + Intronic
909953006 1:81742106-81742128 TCCTGTTTTAGCTTCAATCCTGG + Intronic
912794806 1:112686461-112686483 TCTTGTTTTCCCTTCCTCCCCGG + Intronic
913094995 1:115507815-115507837 TCTGGTTTCAACTCACATCCTGG + Intergenic
913545141 1:119860535-119860557 TGTTCTTTTAGCTCCCATCAAGG - Intergenic
914221284 1:145684236-145684258 TCTTGCTTTATCGCCCAGCCTGG + Intronic
914473851 1:148007103-148007125 TCTTGCTTTATCGCCCAGCCTGG + Intergenic
918155773 1:181845111-181845133 TCTGGACTTACCTCCCACCCAGG + Intergenic
918620401 1:186597511-186597533 TCTTGTTTTATCGCCCAGGCTGG + Intergenic
919038422 1:192348046-192348068 TCTTGCTTTACCACCCAGACTGG + Intronic
920034177 1:203055410-203055432 TCTGGTTTTGCCTCCCTTCCAGG + Exonic
920668011 1:207980560-207980582 TCATGTTTTTCCTCACCTCCTGG + Intergenic
921010983 1:211141046-211141068 TCTTGTTCTGTCACCCATCCTGG + Intergenic
922290268 1:224203823-224203845 TCTTTTCTTACCTCCCTCCCGGG + Intergenic
923578117 1:235180169-235180191 TCTTGTTTTATCACCCAGGCTGG + Intronic
923718778 1:236449638-236449660 TTTTGTTCTACTTCCCATCCGGG + Intronic
923782743 1:237040676-237040698 TATTATTTTACCTACCATCTGGG + Intergenic
1063544872 10:6971086-6971108 TCTTGTGTTCCCACCCATCCTGG + Intergenic
1063821850 10:9845271-9845293 TCTTGTTTTCCATCTCAACCAGG + Intergenic
1066516431 10:36165922-36165944 TCTTGTTCTGCCACCCAGCCTGG - Intergenic
1068274746 10:54779602-54779624 TCTTGATTTACATACCAGCCCGG - Intronic
1070489670 10:76964844-76964866 TCATATTTTGCCTCCCATTCAGG + Intronic
1080209060 11:29764346-29764368 TAGTGTTTTACTTCACATCCAGG + Intergenic
1082168668 11:48975003-48975025 TCTTATTTGACCTCCTATGCTGG - Intergenic
1083053547 11:59798235-59798257 TCTTGCTCTATCTCCCAGCCTGG + Intronic
1083835368 11:65263247-65263269 TCTTGTTTTATCACCCAGGCTGG + Intronic
1084292881 11:68187024-68187046 TCTTGCTTTGCCACCCAGCCTGG + Intronic
1084786138 11:71442684-71442706 TCTTGTTCTACCACCCAGGCTGG + Intronic
1084905940 11:72347425-72347447 TCTTGTTCTACCACCCAGGCTGG - Intronic
1085944684 11:81254024-81254046 TCTTGTTTCAGCTCTCATACTGG + Intergenic
1086834662 11:91605411-91605433 TCTTGTTTTGTCGCCCATACTGG - Intergenic
1089917958 11:122177339-122177361 TTTTCTTCTACCTTCCATCCTGG - Intergenic
1093153706 12:15654779-15654801 TCCTGTTTTGCCTTCCTTCCTGG - Intronic
1094055702 12:26267669-26267691 TCTTGTTCTATCTCCCAGGCTGG + Intronic
1094158348 12:27362011-27362033 TTTTTTTTTGCCTCCCATTCTGG - Intronic
1095673209 12:44885247-44885269 TCTTGCTTTATCTCCCAGGCTGG - Intronic
1096048989 12:48589807-48589829 TCTTGATTTAACTCTCAGCCTGG - Intergenic
1097894548 12:64811308-64811330 TGTTGTGTTCCCTCCCATGCAGG - Intronic
1098887227 12:75972727-75972749 TCTTGTTCTACCACCCAGGCTGG + Intergenic
1099178582 12:79452343-79452365 TTTTGTTTTCCGTCCCATTCTGG - Intergenic
1099220452 12:79907866-79907888 TCTTGCTTTGTCTCCCAACCTGG - Intronic
1101345265 12:103880376-103880398 TCTTACCTTACCTCCCACCCTGG - Intergenic
1103762438 12:123260919-123260941 TCTTGTTTTGCCACCCAGGCTGG - Intergenic
1104110607 12:125700750-125700772 TCCTCTTCTGCCTCCCATCCAGG - Intergenic
1104163266 12:126201290-126201312 TTTTGCTTTCCCTCGCATCCCGG + Intergenic
1104378341 12:128285111-128285133 TCTTGTTCTGTCTCCCATGCTGG - Intronic
1105331323 13:19418977-19418999 TCTTGATTTAACTCTCAGCCTGG - Intergenic
1105463669 13:20616971-20616993 TCTTGTTCTGCCTCCCAGGCTGG + Intronic
1105880514 13:24601880-24601902 TCTTGATTTAACTCTCAGCCTGG + Intergenic
1105919376 13:24947289-24947311 TCTTGATTTAACTCTCAGCCTGG - Intergenic
1105953023 13:25250042-25250064 TCTTGTATTACCTATTATCCTGG + Intronic
1110437655 13:75493347-75493369 TCTTGTTTTCCATCTCCTCCTGG + Intergenic
1110443809 13:75554085-75554107 TCTTGTTCTATCTCCCAGGCAGG + Intronic
1110789376 13:79570250-79570272 TCTTGTTTTATCACCCAGTCTGG + Intergenic
1110997552 13:82132329-82132351 TCTTGATTTAACTCTCAACCTGG + Intergenic
1111454132 13:88456925-88456947 TCTTGCTTTATCTCCCAGGCTGG - Intergenic
1111734819 13:92124900-92124922 TCTTGTGTTATCTCCCCTTCTGG + Intronic
1113522075 13:110948321-110948343 TCTTGTTTTTCCTTTCAGCCAGG + Intergenic
1114502915 14:23184456-23184478 TCTTGCTCTACCTCCCAGGCTGG - Intergenic
1114832893 14:26166228-26166250 TCTTGTTTTACCTCCAATATTGG + Intergenic
1115639175 14:35321374-35321396 TCTTGCTTTGCCACCCAGCCTGG - Intergenic
1115773798 14:36693661-36693683 TCTTGTTTTGTCGCCCAGCCTGG + Intronic
1116734772 14:48675159-48675181 TCTTGATTTGCCTCTCAGCCTGG - Intergenic
1117068426 14:52033716-52033738 TCTTTTTTTCCCTCCTATTCAGG + Intronic
1117538782 14:56726824-56726846 CCTTGTTTTATCTCACTTCCAGG - Intronic
1118143987 14:63116200-63116222 TCTTTTTTTACTTCCCTTCAAGG - Intergenic
1119414516 14:74460604-74460626 TCCTGTTTTCCCTTCCATCCTGG + Intergenic
1120216741 14:81688544-81688566 TCTTTTTTTTCTTTCCATCCAGG - Intergenic
1122853056 14:104547107-104547129 CCTGGTTTTCCCTCCCGTCCAGG + Intronic
1125629951 15:41139097-41139119 TCTTGTTTTGTCTCCCAGGCTGG - Intergenic
1125905784 15:43391227-43391249 TCTTGTTCTATCTCCCAGGCTGG + Intronic
1126058159 15:44751773-44751795 TCTTGTTTTGTCACCCATGCTGG + Intronic
1126294468 15:47121981-47122003 TCTTGCTTTATCTCCCAGGCTGG - Intergenic
1126659851 15:51022103-51022125 TCTTGATTTGCCTCTCAGCCTGG + Intergenic
1127129991 15:55852494-55852516 TCTTGTTTTTCTTCCCAACCTGG + Exonic
1128957617 15:71964923-71964945 TCTTGTTTTATCACCCAGGCTGG - Intronic
1129055003 15:72812963-72812985 TCTGGTCTTATCTCTCATCCTGG + Intergenic
1131767553 15:95695948-95695970 AATTGTTTTACTTCCCTTCCTGG + Intergenic
1132022484 15:98374520-98374542 TCTCGTTTTATCACCCATGCTGG - Intergenic
1132766814 16:1538521-1538543 TCTGGTCTTTCCTCCCCTCCAGG + Intronic
1133835719 16:9365784-9365806 TCCTGTTTTACCTTCTATCCTGG - Intergenic
1133930394 16:10227504-10227526 TCTGGTTTCACCTTCCCTCCTGG - Intergenic
1134399201 16:13893273-13893295 TTTTTTTTTGCTTCCCATCCTGG + Intergenic
1134817179 16:17215308-17215330 TCTTGTTTTGCCACCCGTGCTGG - Intronic
1136191857 16:28621451-28621473 TCTTGTTTTATTGCCCAGCCTGG - Intronic
1137956912 16:52840827-52840849 TCTTTTCTTTCCTCCCTTCCTGG - Intergenic
1144037938 17:11384165-11384187 TCTTGTTTTATTCCCAATCCAGG + Intronic
1144061616 17:11588009-11588031 TCTTGTTTGACCTCCTAGACTGG - Intergenic
1144355197 17:14438688-14438710 TCTGGTTCTACCACCCACCCTGG + Intergenic
1145120375 17:20254184-20254206 TTTTGTTTTAACTCCAATCCTGG + Intronic
1147201527 17:38805243-38805265 TCTTGTTGTATCTCCCAGGCTGG - Intronic
1148499706 17:48080449-48080471 TCTTGGATTACCTGCCATCCAGG - Intronic
1148929109 17:51113648-51113670 TCTTGCTTTGCCACCCATGCTGG - Intronic
1150470318 17:65431770-65431792 TCTTCTATCCCCTCCCATCCTGG + Intergenic
1151211618 17:72548668-72548690 TCTTGCTTTGCCTCCCAGGCTGG - Intergenic
1155287211 18:24302202-24302224 TCTTGTTCTGCCTCCCAGGCTGG - Intronic
1155338699 18:24792293-24792315 CCTTCTTTTCCCTCCCCTCCTGG + Intergenic
1155357064 18:24963095-24963117 TCTTATTTAGCCTCCCTTCCAGG - Intergenic
1155967284 18:32048097-32048119 TCTTGTTTTATCACCCAGGCTGG - Intronic
1158060674 18:53336844-53336866 TCTTGTTCTATCTCCCAGGCTGG - Intronic
1159399509 18:67912466-67912488 GTTTGTTTTTCCTCCCAACCTGG + Intergenic
1163264245 19:16208742-16208764 TCTTGTTTTCCTTCCCAACATGG + Intronic
1163416504 19:17190033-17190055 TCTTGTTTTGCCGCCCAGGCTGG - Intronic
1163559743 19:18011829-18011851 TCTTGTTTTGTCTCCCAGACTGG - Intronic
1166793161 19:45409725-45409747 TTTTTTTCTCCCTCCCATCCAGG - Exonic
1166890300 19:45987712-45987734 TCTTGCTTTATCTCCCAGGCTGG + Intergenic
925606076 2:5661535-5661557 GCTTGTTTGATCTTCCATCCAGG + Intergenic
926061158 2:9806038-9806060 TCTTCATTTTCCTCCCATTCTGG + Intergenic
927352374 2:22132215-22132237 TCTTGTTCTGTCGCCCATCCTGG + Intergenic
928822967 2:35384839-35384861 TCTTGTTTTCCCTCCCAGGCTGG - Intergenic
929345614 2:40880520-40880542 TCTTGTTTTGTCACCCAGCCTGG + Intergenic
930083668 2:47476370-47476392 TGTTGATTTACCTCCCATATTGG - Exonic
930191462 2:48464111-48464133 GCTTGTTTTGCTTCCCAGCCTGG - Intronic
931862255 2:66367855-66367877 TCTTATTTAACCTCCTAACCTGG - Intergenic
932207873 2:69899757-69899779 TCTTGTTTTGCCACCCATACTGG + Intronic
932536826 2:72606656-72606678 TCTTGTTTTGTCTCCCAGACTGG + Intronic
933520756 2:83369562-83369584 TCTTGCTCTGCCTCCCATGCTGG + Intergenic
936467579 2:112766936-112766958 TCTTGCTCTGCCTCCCATGCTGG - Intergenic
937330731 2:121026670-121026692 TCTTGGTTTCCCTCCAAACCTGG + Intergenic
937446429 2:121962627-121962649 TCTGTTTTTACTTGCCATCCTGG + Intergenic
937544221 2:122996300-122996322 TTTTGTTTTATCTTCCATTCTGG - Intergenic
938916208 2:135942872-135942894 TGTTGCTTTTCCTCCCATCAAGG + Intronic
941191340 2:162386806-162386828 TTCTGTTTTACCTACCATGCTGG + Intronic
942069626 2:172304541-172304563 TCTTGTTTTGCCACCCAGGCTGG - Intergenic
944224390 2:197335506-197335528 TCTCGTTTTGCCTCCCAGACTGG + Intergenic
945951462 2:216042784-216042806 TCTTGGTTTATCTCCCAAGCTGG + Intronic
946212645 2:218159873-218159895 TCTTGTTTTTCTCCCCCTCCAGG - Intergenic
947508471 2:230728637-230728659 TCTTGCTTTATCACCCATTCTGG + Intronic
947789637 2:232857245-232857267 TCTTCTTTTTCCCCCCATCAGGG + Exonic
1169356150 20:4907385-4907407 TCTTTTATTGCCTCCTATCCTGG + Intronic
1169440864 20:5632820-5632842 TCTTGTTTTATCACCCAGGCTGG + Intergenic
1169539385 20:6582649-6582671 TCTTGTTCCACCTCCAATCCTGG + Intergenic
1169657990 20:7946766-7946788 TCTTGCTTTCACTCTCATCCTGG + Intergenic
1170935765 20:20807784-20807806 TCTTGTTTTGCCACCCAGGCTGG + Intergenic
1172266199 20:33616695-33616717 TCTTGTTTTGTCACCCATGCTGG - Intronic
1174552935 20:51374647-51374669 TCTTATGATGCCTCCCATCCTGG + Intergenic
1176675163 21:9770828-9770850 TCTTGTTTTGCCGCCCAGGCTGG - Intergenic
1176741673 21:10609617-10609639 TCTTGATTTAACTCTCAGCCTGG + Intergenic
1178073781 21:28996934-28996956 TTTTTTTTTAACTCCCAACCTGG - Intergenic
1180000850 21:44994922-44994944 TCTTGTTTTCCTTCCCCTCTTGG - Intergenic
1180563552 22:16642889-16642911 TCTTGATTTAACTCTCAGCCTGG + Intergenic
1180989921 22:19929466-19929488 TCTTGTTCTGCCTCCCAGGCTGG - Intronic
1181823616 22:25495126-25495148 TCTTCCTTTGACTCCCATCCTGG - Intergenic
1182546946 22:31081986-31082008 GCTTGTTCCCCCTCCCATCCTGG - Intronic
1182695456 22:32196080-32196102 TTTTCTTTTACCTCCCATATAGG + Intronic
1183915808 22:41117775-41117797 TCCTGTTTGTCCTCCCATCTGGG - Exonic
1184153098 22:42649612-42649634 TCTTATTCTCGCTCCCATCCGGG - Intergenic
1185051377 22:48555962-48555984 TCTTGTTCTAGCTCCCTCCCTGG + Intronic
949153221 3:795628-795650 TCTTGCTTTATCTCCCAGGCTGG - Intergenic
949166055 3:942432-942454 TCTTGATTTGCCTTTCATCCTGG - Intergenic
954010798 3:47636136-47636158 TCTTGTTTTATATCCCTTTCAGG - Exonic
954084288 3:48231704-48231726 TCTTGTTCTGCCACCCAGCCTGG - Intergenic
954094873 3:48318168-48318190 TCTTGCTTTATCTCCCAGGCTGG + Intronic
954905046 3:54054382-54054404 TCTTGCTTTGCCTCCTGTCCTGG + Intergenic
956464594 3:69506563-69506585 TCTCGTTTTACCACCCAGGCTGG + Intronic
956920486 3:73923493-73923515 TCCTGTTTTACATCCCATGGTGG - Intergenic
957615713 3:82524038-82524060 TTTTGTTTTACCTCCCTTCTAGG - Intergenic
957893564 3:86390167-86390189 TCTTGGTTTATCTCCCAGGCTGG + Intergenic
958985446 3:100775452-100775474 TCTTGTTTTCTCTCCAAGCCTGG - Intronic
961581645 3:127888119-127888141 TCATGTTTTACCAACCATCTGGG + Intergenic
962148287 3:132864952-132864974 TCTCTTTTTACCTTTCATCCAGG + Intergenic
963227530 3:142877463-142877485 TATTTTTTAACCTCCCTTCCAGG - Intronic
963925323 3:150944867-150944889 TCTTGCATCACTTCCCATCCTGG - Intronic
964463018 3:156957820-156957842 TCTTGTTTTGTCACCCAGCCTGG + Intronic
964926632 3:161965985-161966007 TCTTGCCTTAACTCGCATCCTGG - Intergenic
966042185 3:175505232-175505254 TCTTGCTTTGCCACCCAGCCTGG - Intronic
966867416 3:184266766-184266788 TCTTGTTTTGCCACCCAGGCTGG - Intronic
967375192 3:188793210-188793232 TCTTGCTTTGTCTCCCAGCCTGG + Intronic
968854459 4:3109022-3109044 TCTTGTTTTACCACCCATGCTGG - Intronic
970063327 4:12061783-12061805 TCTTATTTTACCTCTCTTCAGGG + Intergenic
970235852 4:13957369-13957391 TCTTGTTGTCCCTCACATCAGGG - Intergenic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
971678350 4:29665230-29665252 TCTGGTTTAACATCCAATCCAGG - Intergenic
972526549 4:39918151-39918173 TCTTGTTCTGTCTCCCATGCAGG - Intronic
972562420 4:40240439-40240461 TCTTGCTCTATCTCCCATGCTGG - Intronic
974399323 4:61381615-61381637 TATTTTTTTCCCTCCCATCTGGG - Intronic
975861302 4:78679918-78679940 TCTTGTTTTATCACCCAGGCTGG - Intergenic
976004850 4:80417477-80417499 TCCTATTTAACCTCACATCCAGG - Intronic
978316318 4:107441349-107441371 TCTACTTTTACCTCTCAGCCTGG + Intergenic
978798652 4:112733184-112733206 TCTTGTTTTGTCGCCCATGCTGG - Intergenic
980674495 4:136057628-136057650 TCTTGTTTTATCACCCAGGCTGG - Intergenic
980933438 4:139203489-139203511 TCTTGTTCTATCACCCATGCTGG + Intergenic
981105687 4:140878194-140878216 TCTTGTTTTATCACCCAGGCTGG + Intronic
981478330 4:145210473-145210495 TCTTGTTTTACATTCCAGACTGG + Intergenic
983815293 4:172118668-172118690 TCTTGCTCTATCTCCCATGCTGG - Intronic
984522759 4:180820741-180820763 TTTTCTTTTACCTCCCATACTGG - Intergenic
985287032 4:188346417-188346439 TCATGTTTTACCTGCAATCAGGG + Intergenic
985367822 4:189251744-189251766 TCTTGATTTAGCTCTCATCTTGG - Intergenic
985400393 4:189587864-189587886 TCTTGTTTTGCCGCCCAGGCTGG + Intergenic
985982907 5:3487204-3487226 TCTTGCTTTACCACCCAGACTGG - Intergenic
986292271 5:6409873-6409895 TCCTGTTGTACCTGCCATCCAGG + Intergenic
987462589 5:18230913-18230935 TTTTATTTTACATCCTATCCTGG + Intergenic
989148058 5:38268375-38268397 TTTTTCTTTACCTCCCACCCTGG - Intronic
991147455 5:63323537-63323559 TTTTCTTCTACCTGCCATCCAGG - Intergenic
993171272 5:84421827-84421849 TCTTGTTTTGTCTCCCAGGCTGG - Intergenic
994369235 5:98949792-98949814 TCTTGTTTTGTCACCCATGCTGG + Intergenic
995836502 5:116405266-116405288 TCTTCTCTTTCCTCCCATCCTGG + Intronic
996203726 5:120704348-120704370 TCTTTTTTTCCCTCCTTTCCTGG + Intergenic
998134362 5:139666984-139667006 TCTTGTGTTCCCTCACCTCCAGG + Intronic
998243281 5:140470651-140470673 TCTTGCTTTATCTCCCAGGCTGG + Intronic
998328988 5:141306676-141306698 TCTTGTTTTGCCACCCAGGCTGG - Intergenic
1001171154 5:169420049-169420071 TCTTTTTTGGCCTCCTATCCTGG - Intergenic
1003244202 6:4370505-4370527 TCTTGCTTTATCACCCATGCTGG + Intergenic
1003494257 6:6650362-6650384 TCTTGTTCTGCCTCCCAGGCTGG + Intronic
1004971354 6:20913959-20913981 TCTTGTTTTGTCACCCAGCCTGG - Intronic
1005111250 6:22284290-22284312 TCTTGTTCTATCTCCCAGGCTGG - Intergenic
1009647166 6:66420368-66420390 TCTTGTTTTCCCTAGCATGCAGG - Intergenic
1011459289 6:87586936-87586958 TCTTGCTTTACCACCCACGCTGG + Intronic
1011512852 6:88120384-88120406 TTTCGTTTTGCCTCCTATCCAGG - Intergenic
1011966091 6:93159105-93159127 TCTTGATTTGACTCTCATCCTGG + Intergenic
1014668070 6:124264363-124264385 TATTGTTTTCCATACCATCCGGG - Intronic
1015240752 6:131020991-131021013 TCTTGTTTTATTTCCCAAGCTGG + Intronic
1017108159 6:150907486-150907508 TCTGTTTTCACATCCCATCCTGG - Intronic
1019231370 6:170567453-170567475 TCTTGTTCTGTCTCCCATGCTGG - Intronic
1020639419 7:10737010-10737032 TCTTGTTCAGCCTCCCATTCAGG + Intergenic
1021857429 7:24871103-24871125 TCTTTTGTTTCCTCACATCCTGG - Intronic
1023076350 7:36486257-36486279 TCTTGGTTATCCTTCCATCCAGG - Intergenic
1023812707 7:43924799-43924821 TCTTGCTTTGTCTCCCAGCCTGG + Intronic
1024113978 7:46174568-46174590 TCTTGTGTTTCTTCCTATCCAGG - Intergenic
1024406412 7:48986840-48986862 TCTTGATTTACGTCTCATCTTGG + Intergenic
1025863085 7:65351966-65351988 TCTTGCTTTTTCTCCCATACTGG + Intergenic
1026134848 7:67650892-67650914 TCTTGCTTTATCTCCCAGGCTGG + Intergenic
1026973732 7:74483514-74483536 TCTTGTTCTGCCACCCAGCCTGG - Intronic
1027596389 7:80179459-80179481 ACTTGTTTTACCTGCCATTTGGG + Intronic
1028177658 7:87676195-87676217 TCTTGTTCTATCACCCAGCCTGG - Intronic
1028267160 7:88739890-88739912 TCTTGTTTTGTCTCCCACGCTGG - Intergenic
1029204949 7:98864115-98864137 TTTTGTTTTTCCTGCCAGCCGGG + Intronic
1029234380 7:99101340-99101362 TCTTGTTCTATCACCCATGCTGG - Intronic
1030097317 7:105911879-105911901 TGTTGTTTTAACTCCCATCATGG + Intronic
1031592212 7:123607514-123607536 TCTTGTTTTATCACCCAAACTGG + Intronic
1032388876 7:131542896-131542918 TCTTGTTTTCCCTTACAGCCTGG + Intronic
1033608051 7:142941836-142941858 TCTTGCTCTACCACCCAGCCTGG + Intronic
1033824347 7:145171216-145171238 TCTTATTTTCCCTCTGATCCAGG - Intergenic
1035360632 7:158311057-158311079 TCTTGTTTTACCTCCCATCCTGG - Intronic
1035392103 7:158511278-158511300 TCAAGTTTTACCCCCTATCCTGG + Intronic
1035616013 8:1002540-1002562 GCTTGTTTGGCCTCCCCTCCTGG + Intergenic
1036390828 8:8323099-8323121 TCTTGTTTCAGCCCTCATCCTGG - Intronic
1036444571 8:8810334-8810356 TCTTGCTTTGCCGCCCATACTGG - Intronic
1037134417 8:15444903-15444925 TCTGCTCTTACCTCCCTTCCAGG - Intronic
1038564554 8:28608827-28608849 TCTTGCTCTATCTCCCAGCCTGG - Intronic
1039014256 8:33128587-33128609 TCTTTTTTTATCTCCCAGCCAGG + Intergenic
1039858763 8:41438490-41438512 TCTTGTTTTGCCACCCATCGGGG - Intergenic
1040581577 8:48703026-48703048 TCTTGCTTTATCACCCAGCCTGG + Intergenic
1042481432 8:69308082-69308104 TCTTGTTCTATCTCCCAGGCTGG + Intergenic
1045116747 8:98991047-98991069 TCTTGTTTTATCGCCCAGGCTGG + Intergenic
1047860998 8:128966620-128966642 TTTAGTTTTATCTCCCATCCTGG + Intergenic
1051664233 9:19453348-19453370 TCTTGGTTTACATCCCATGCTGG - Intergenic
1052719601 9:32157263-32157285 TCTTGATTTCCCTCTCAGCCTGG + Intergenic
1053018900 9:34680941-34680963 TCTGGTTTTACTTCTCATCTTGG + Intergenic
1053601333 9:39612716-39612738 TCCTGTTTTAACTCCCTTCTTGG + Intergenic
1053858979 9:42366510-42366532 TCCTGTTTTAACTCCCTTCTTGG + Intergenic
1054252203 9:62729721-62729743 TCCTGTTTTAACTCCCTTCTTGG - Intergenic
1054375001 9:64442877-64442899 TCTTCTTTTACCACACAGCCAGG + Intergenic
1054566318 9:66764222-66764244 TCCTGTTTTAACTCCCTTCTTGG - Intergenic
1055864254 9:80793781-80793803 TCTAGTTTTCCCACCCACCCTGG - Intergenic
1056443148 9:86640204-86640226 TCTTGCCTTCCCTCCCATGCTGG + Intergenic
1057782807 9:98063569-98063591 TCTTGTTTTGTCACCCATGCTGG + Intronic
1058223595 9:102332964-102332986 TCTTGATTTACCTCTCACCCTGG - Intergenic
1060652300 9:125339009-125339031 TCTTGTTTTATCACCCATGCTGG + Intronic
1061688348 9:132303045-132303067 TCTTGTTCTATCTCCCAGACTGG + Intronic
1061958380 9:133975367-133975389 ACTTGGCTTACCTCCCATCTTGG + Intronic
1062703437 9:137920224-137920246 TCTTGCTTTGTCTCCCATGCTGG + Intronic
1187282237 X:17866596-17866618 TTTTGTTTTACCTCCAATTCTGG + Intergenic
1189308008 X:40001797-40001819 TCTTGATTTACCTGCCATCTCGG - Intergenic
1192267393 X:69548087-69548109 TTTTGTTTTCCCACCCATCCTGG - Intergenic
1193023325 X:76816558-76816580 TAATGTTTTACCACACATCCTGG - Intergenic
1193137101 X:77984355-77984377 TCTTGTTTTGCCGCCCAGCCTGG + Intronic
1193462096 X:81803404-81803426 TCTGCTTTTACCTCACATCTTGG + Intergenic
1194218100 X:91156668-91156690 TCTTGATTTAACTCTCAACCTGG - Intergenic
1194242443 X:91468961-91468983 TCTTCATTTCCCTCTCATCCTGG + Intergenic
1194966188 X:100291339-100291361 TCTTGTTTAAAGTACCATCCAGG + Intergenic
1195822122 X:108956787-108956809 TCTTGGTGTACCTACCATTCTGG - Intergenic
1196143948 X:112296545-112296567 TTTTGTTTTCCCTTCCATCTGGG + Intergenic
1197282982 X:124559636-124559658 TCTTGTTCTGTCTCCCATTCTGG - Intronic
1197997325 X:132391944-132391966 TATTGTTTGACCTACCATACAGG + Intronic
1200227987 X:154429773-154429795 TGCTGTTTTCCTTCCCATCCAGG + Intronic
1200554611 Y:4620457-4620479 TCTTGATTTAACTCTCAACCTGG - Intergenic
1201502014 Y:14655282-14655304 TTTTTTTTTCCCTCTCATCCTGG + Intronic
1201910412 Y:19128081-19128103 ACTTGTTTTATTTCCCATCCTGG - Intergenic