ID: 1035361374

View in Genome Browser
Species Human (GRCh38)
Location 7:158315954-158315976
Sequence GGTCGCGGTGGCAGAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035361370_1035361374 -9 Left 1035361370 7:158315940-158315962 CCCATGAACAAGGTGGTCGCGGT 0: 1
1: 0
2: 1
3: 25
4: 249
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361359_1035361374 14 Left 1035361359 7:158315917-158315939 CCACCCTGCCGTTGCCCCATGGG No data
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361354_1035361374 27 Left 1035361354 7:158315904-158315926 CCTCTTTCCCCAGCCACCCTGCC No data
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361371_1035361374 -10 Left 1035361371 7:158315941-158315963 CCATGAACAAGGTGGTCGCGGTG No data
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361367_1035361374 -2 Left 1035361367 7:158315933-158315955 CCATGGGCCCATGAACAAGGTGG No data
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361357_1035361374 18 Left 1035361357 7:158315913-158315935 CCAGCCACCCTGCCGTTGCCCCA No data
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361355_1035361374 20 Left 1035361355 7:158315911-158315933 CCCCAGCCACCCTGCCGTTGCCC 0: 1
1: 0
2: 5
3: 51
4: 452
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361365_1035361374 0 Left 1035361365 7:158315931-158315953 CCCCATGGGCCCATGAACAAGGT No data
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361356_1035361374 19 Left 1035361356 7:158315912-158315934 CCCAGCCACCCTGCCGTTGCCCC 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361362_1035361374 10 Left 1035361362 7:158315921-158315943 CCTGCCGTTGCCCCATGGGCCCA No data
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361366_1035361374 -1 Left 1035361366 7:158315932-158315954 CCCATGGGCCCATGAACAAGGTG 0: 4
1: 140
2: 201
3: 200
4: 223
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361363_1035361374 6 Left 1035361363 7:158315925-158315947 CCGTTGCCCCATGGGCCCATGAA No data
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data
1035361361_1035361374 11 Left 1035361361 7:158315920-158315942 CCCTGCCGTTGCCCCATGGGCCC No data
Right 1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035361374 Original CRISPR GGTCGCGGTGGCAGAGTTGG AGG Intronic