ID: 1035361795

View in Genome Browser
Species Human (GRCh38)
Location 7:158318254-158318276
Sequence GAGTGGGAAAGGGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3543
Summary {0: 1, 1: 3, 2: 23, 3: 326, 4: 3190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035361779_1035361795 23 Left 1035361779 7:158318208-158318230 CCCGCTCCTTTGCCTTCCTCAGA 0: 1
1: 0
2: 2
3: 76
4: 469
Right 1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG 0: 1
1: 3
2: 23
3: 326
4: 3190
1035361785_1035361795 -6 Left 1035361785 7:158318237-158318259 CCATTCAGTGCAAGCAGGAGTGG 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG 0: 1
1: 3
2: 23
3: 326
4: 3190
1035361780_1035361795 22 Left 1035361780 7:158318209-158318231 CCGCTCCTTTGCCTTCCTCAGAC 0: 1
1: 0
2: 5
3: 52
4: 467
Right 1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG 0: 1
1: 3
2: 23
3: 326
4: 3190
1035361782_1035361795 11 Left 1035361782 7:158318220-158318242 CCTTCCTCAGACACGCACCATTC 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG 0: 1
1: 3
2: 23
3: 326
4: 3190
1035361781_1035361795 17 Left 1035361781 7:158318214-158318236 CCTTTGCCTTCCTCAGACACGCA 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG 0: 1
1: 3
2: 23
3: 326
4: 3190
1035361783_1035361795 7 Left 1035361783 7:158318224-158318246 CCTCAGACACGCACCATTCAGTG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG 0: 1
1: 3
2: 23
3: 326
4: 3190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035361795 Original CRISPR GAGTGGGAAAGGGGGGAGGA GGG Intronic
Too many off-targets to display for this crispr