ID: 1035362827

View in Genome Browser
Species Human (GRCh38)
Location 7:158324768-158324790
Sequence TGGTTCTGGGTCAGTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035362827_1035362838 18 Left 1035362827 7:158324768-158324790 CCCATAGCACTGACCCAGAACCA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1035362838 7:158324809-158324831 AAGCTGTGGACCGAACAAGGTGG No data
1035362827_1035362832 -6 Left 1035362827 7:158324768-158324790 CCCATAGCACTGACCCAGAACCA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1035362832 7:158324785-158324807 GAACCATCCAATTGGAGCACCGG 0: 1
1: 0
2: 1
3: 2
4: 63
1035362827_1035362835 4 Left 1035362827 7:158324768-158324790 CCCATAGCACTGACCCAGAACCA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1035362835 7:158324795-158324817 ATTGGAGCACCGGAAAGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 106
1035362827_1035362837 15 Left 1035362827 7:158324768-158324790 CCCATAGCACTGACCCAGAACCA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1035362837 7:158324806-158324828 GGAAAGCTGTGGACCGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035362827 Original CRISPR TGGTTCTGGGTCAGTGCTAT GGG (reversed) Intronic
901194368 1:7432253-7432275 TGTTTCTGGGTCTGTGGAATAGG - Intronic
905128406 1:35732765-35732787 TGCTGCTGGCTCAGTGCTTTGGG + Intronic
907464430 1:54625318-54625340 TGGAGCAGGGTCAGTGCTCTGGG + Intronic
910121172 1:83791995-83792017 TGGTCCTGAGTCAGAGCTTTAGG + Intergenic
910439692 1:87239861-87239883 TGGTGCAGGGTCAGGGCTCTGGG - Intergenic
911053640 1:93693097-93693119 GGGTTCTGAGTCAGTGCCTTAGG - Intronic
911545345 1:99209723-99209745 TGGTTCTGGCTCTGCGCTGTTGG - Intergenic
915775722 1:158483769-158483791 TGGAGCTGAGTCAGGGCTATAGG + Intergenic
916041937 1:160969175-160969197 TGCTTCTGGGTGGGGGCTATAGG - Intergenic
919810327 1:201405248-201405270 GTGCTCTGGGCCAGTGCTATGGG + Exonic
920703374 1:208234406-208234428 AGGCTCTTGGACAGTGCTATGGG + Intronic
922131911 1:222788286-222788308 TGGTTCAGACACAGTGCTATTGG + Intergenic
922868534 1:228881498-228881520 TGTTTCTGTCTCAGTGCTCTAGG - Intergenic
923351774 1:233114433-233114455 TGGTGCTGGGCCAGTGTCATGGG + Intronic
924783866 1:247176670-247176692 GGGTCCTGGGTCAGGGATATTGG - Intergenic
1065111623 10:22445416-22445438 TTGTTCAGGGTCATTGCTGTTGG + Intronic
1065799607 10:29339845-29339867 TGGTTTTGCATCAGTGCTTTGGG + Intergenic
1065871832 10:29962519-29962541 AGGTTCTGGGTCTGTGATTTTGG + Intergenic
1066674218 10:37871687-37871709 TGTTACTGAGTCAGTGTTATGGG + Intergenic
1067823171 10:49549006-49549028 TGGTTCAGTGTCACTGCAATGGG - Intergenic
1067892743 10:50150508-50150530 TGGTGCTGGGTGGCTGCTATGGG + Intergenic
1068054385 10:51993269-51993291 TGGCTCTGGCTCAGTAGTATAGG + Intronic
1075472490 10:122702603-122702625 TGTTTCTGGGACAGTGTTTTGGG - Intergenic
1076265045 10:129103181-129103203 TGTTTCTGTGTGGGTGCTATTGG + Intergenic
1077089291 11:771208-771230 TGGGTCTGAGTCAGTGCCATGGG + Intronic
1077458897 11:2699093-2699115 TGGTTCTGAGTCCGCGCTATTGG - Intronic
1077707606 11:4503154-4503176 TGGGTGTGGGTCAGTGGTTTTGG + Intergenic
1079087207 11:17454919-17454941 TGGTACTGGGTCAGAAATATAGG + Intronic
1081124755 11:39308983-39309005 TGGTTCCGAGTCTTTGCTATTGG - Intergenic
1087641626 11:100760995-100761017 TTGTACTGGGGCAGTGGTATGGG + Intronic
1088708446 11:112484510-112484532 TGGGTCAGGGTTAGTGCTAGGGG + Intergenic
1088892765 11:114058316-114058338 TGGGTCTGGGGCAGTGCCAGAGG + Intergenic
1092695457 12:11166586-11166608 TGGTTGTTGGCCAGTGCTAGGGG - Intronic
1093177909 12:15934128-15934150 AGGTTCTGGTTCTGTGATATGGG - Intronic
1094381045 12:29843223-29843245 TGGTTCTGAGTAAGTGCTGTGGG + Intergenic
1099637063 12:85226945-85226967 TGGTTCTAAGTCTTTGCTATTGG + Intronic
1107128603 13:36871120-36871142 TGGCACTGGGCCAGTGCTAGAGG - Intronic
1108069108 13:46609259-46609281 TTGTTCTGGGACAGAGTTATAGG + Intronic
1108344703 13:49534085-49534107 GGGTTCTGTGTGAGTGCTCTGGG - Exonic
1115929035 14:38469953-38469975 TTCTTCTTGGTGAGTGCTATTGG + Intergenic
1115957886 14:38801757-38801779 TGGTTCTGGGTGGGTGCATTAGG - Intergenic
1117995016 14:61470230-61470252 GGGTTCTGGGTCACTATTATAGG + Intronic
1118466876 14:66039135-66039157 TGGCTCTGGGTTAGTGATTTGGG + Intergenic
1120066486 14:80047006-80047028 GGGTTCTGGTTCACTGCTGTAGG - Intergenic
1120796498 14:88638958-88638980 TTGTTCTGGGTAAGTGCTTTTGG - Intronic
1124465453 15:29935595-29935617 TGGTTTTGGGATTGTGCTATAGG - Intronic
1128725651 15:69986698-69986720 TTGTTCTGGGTCAGGGCTGCTGG - Intergenic
1133455910 16:5942353-5942375 TGCTTCTGGGTGAGAGCTACAGG + Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1137348992 16:47693954-47693976 TGGTGGTGGGTCAGTGCTGGGGG + Intronic
1137777444 16:51067888-51067910 GGGATCTGGGTCAGTGACATTGG - Intergenic
1137984581 16:53097096-53097118 TGGTTATGGGTAGGTGCTGTGGG - Intronic
1139590198 16:67929051-67929073 TGGTTCTGGCTCAGGCCTCTGGG - Exonic
1144186308 17:12799438-12799460 TGGTTTTCAGTCAGTGCTAAAGG + Intronic
1144780844 17:17807660-17807682 TGGTGCTGGGGCAGTGCTGAGGG + Intronic
1153951535 18:10061680-10061702 TGCTGCTGGGTCTGTGATATGGG - Intergenic
1154396021 18:13989970-13989992 TGTTTTTAGGTCAGTGCCATAGG - Intergenic
1158254264 18:55527902-55527924 TAGTTCAGGCTCAGTGCAATTGG - Intronic
1158697876 18:59718778-59718800 TGAATCTGGGTCAGTGCTCATGG + Intergenic
1160049958 18:75423698-75423720 TGGGCTTGAGTCAGTGCTATTGG - Intronic
1162454162 19:10772670-10772692 TCGTTCATGGACAGTGCTATGGG + Intronic
1164729753 19:30494543-30494565 TAGTACTGGGTCAGCTCTATGGG + Intronic
1165603188 19:37076219-37076241 TGATTCTGGGTCACTACTTTTGG - Intronic
1165847450 19:38827323-38827345 TGCTTCTGGTTCAGTCCTAAAGG + Intronic
1167786955 19:51644893-51644915 GGGTTCTGGGACAGAGCTGTGGG + Intronic
925339781 2:3128102-3128124 TGGATCTGGGACAGAGCTAATGG - Intergenic
929029714 2:37638992-37639014 TGTTTCTGGGGCATTGCTAATGG + Intergenic
933148802 2:78889762-78889784 TGGTTCTTGGTTAGTGCCACTGG - Intergenic
1170046268 20:12088623-12088645 TGGTTCTGGGCCCCTGCTATAGG + Intergenic
1171364604 20:24615410-24615432 TGGTTCTGGATGGGTGCTAGAGG - Intronic
1172303107 20:33863456-33863478 TGGTTTAGGGTCTGTGCTCTTGG - Intergenic
1174484567 20:50852983-50853005 GGGTTCTGGGTGAGTGCCAAGGG + Intronic
1175358457 20:58388800-58388822 TGTTTATGGGTGAGTGATATGGG - Intergenic
1179264789 21:39793827-39793849 TGGTTCTGGGTAACAGCTCTGGG + Intronic
1184411337 22:44328123-44328145 AGGCTCTGGGTCAGTAATATTGG + Intergenic
950107278 3:10396312-10396334 TGTGTCTGTGTCAGTGCAATGGG - Intronic
954882102 3:53843479-53843501 AGGGTCTGGGTCAGGGCCATAGG + Intronic
955222852 3:57037506-57037528 TAGTTCTAGGTCAGAGCTTTAGG + Intronic
955571578 3:60312493-60312515 TGGTTTTGGGTTAGTTCTAATGG - Intronic
957990165 3:87616689-87616711 TGGTTCTAGTTCAGTCTTATAGG + Intergenic
960228458 3:115195446-115195468 TGATTCTGTGTCTCTGCTATTGG + Intergenic
961118231 3:124350050-124350072 TTGAGCTGGGTCAGGGCTATGGG - Intronic
966140760 3:176753097-176753119 TGTTTCTGTGGCAGTGATATTGG + Intergenic
968201314 3:196757887-196757909 GGTTTCTGGGTCAGTTTTATTGG + Intronic
968480148 4:829610-829632 AGGTTCTGGGTGGGTGCTGTGGG - Intergenic
972458967 4:39281726-39281748 TGGTTATGGGTCAGTAGTCTAGG + Intronic
980039855 4:127926714-127926736 TGTATCAGGTTCAGTGCTATGGG - Intronic
982519175 4:156391683-156391705 TTTTTCTGGGTCAGTGCTGTAGG - Intergenic
983334904 4:166379079-166379101 TGGCTCTGAGTCGGAGCTATAGG + Intergenic
988920786 5:35940079-35940101 TGGATCTGGGTTTGTGGTATTGG + Intergenic
991619962 5:68534773-68534795 TGGCTGTGGGTCCGTGGTATTGG + Intergenic
993395064 5:87375901-87375923 TCGTTCTGTGTCATTACTATGGG - Intronic
993849777 5:92992371-92992393 TAATTCTGGGTCAGAACTATAGG - Intergenic
995041868 5:107597418-107597440 TGGTGATGGGTCAGTGCCAGTGG - Intronic
1001218572 5:169878933-169878955 TGGTGTTGGGTCTGTGCTCTTGG + Intronic
1001331910 5:170768086-170768108 TGGTTCTGGGTCAGGGTTCAAGG - Intronic
1001825883 5:174744634-174744656 TGGCTCTAGGTCAGTGCTCTTGG + Intergenic
1002212780 5:177608525-177608547 TGTCTCTGTGTCAGTGCAATGGG + Exonic
1003977771 6:11360121-11360143 TGGTTCCAGGGCACTGCTATTGG + Intronic
1004907018 6:20245357-20245379 TGGTTGTGGGTCATTGGTCTTGG + Intergenic
1005644044 6:27824541-27824563 TGGTTCTGAGTCAGTTCTGGGGG + Intergenic
1007949118 6:45854303-45854325 TGGTGCTGGTTCAGTGCCAGGGG - Intergenic
1010222814 6:73462314-73462336 GGGTTCGGGGTCAGTGCCTTGGG + Intronic
1015309310 6:131748445-131748467 TATTTCAGGGTCAATGCTATTGG + Intergenic
1015316547 6:131823690-131823712 TGGTTCTGGGACAGGGAGATGGG - Intronic
1016767038 6:147806585-147806607 AGGTTCTAGTTCAGTGGTATAGG - Intergenic
1017210177 6:151847159-151847181 TGGTTATGGGTCAATGCAGTGGG + Intronic
1017681474 6:156868541-156868563 TGGTTCCGGGACTGTGCCATTGG + Intronic
1020856795 7:13437150-13437172 TACTTCTGGGTCATTGCTATGGG + Intergenic
1028369662 7:90076624-90076646 TGGTTCTGAGTCTTTGCTATTGG - Intergenic
1030919332 7:115361527-115361549 TGGTTCTAAGTCTTTGCTATTGG + Intergenic
1032675149 7:134123191-134123213 TGGTACTGGGTCAGGGCTACAGG + Intergenic
1035362827 7:158324768-158324790 TGGTTCTGGGTCAGTGCTATGGG - Intronic
1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG + Intergenic
1036411839 8:8508999-8509021 TGGTTAGGGATCAGTGCTAAAGG + Intergenic
1037944628 8:22980877-22980899 TGTTTTTGGGTCACGGCTATGGG - Intronic
1046658091 8:116918604-116918626 TGATTTTGAGTCAGTGCTTTGGG - Intergenic
1047060905 8:121224101-121224123 TGGTTTTGGTTCATGGCTATGGG + Intergenic
1049805563 8:144537223-144537245 TGCTTCTGGGGCTGTGCTAGGGG + Intronic
1058011389 9:99981467-99981489 TGGGCCTGGGTTGGTGCTATAGG - Exonic
1058625332 9:106928103-106928125 TGGTGATGAGTCAGTGCTACTGG + Exonic
1059844572 9:118260192-118260214 TGGTTCCGAGTCTTTGCTATTGG + Intergenic
1203489295 Un_GL000224v1:87969-87991 TGGTTCTGGGTTAGGGCTTGGGG + Intergenic
1203501916 Un_KI270741v1:29864-29886 TGGTTCTGGGTTAGGGCTTGGGG + Intergenic
1189521704 X:41775609-41775631 TGGTTCCGAGTCTTTGCTATTGG - Intronic
1191117177 X:56864483-56864505 TTGGTTTGGGTCAGTGCTAAAGG + Intergenic
1191210883 X:57883395-57883417 TGGTTCTGGGTCACTAGTAGTGG - Intergenic
1195542377 X:106077079-106077101 TGGGTCTTGGGCAGTGCTAGAGG - Intergenic
1196044595 X:111244520-111244542 GTGTTCTGGGTTAGTGTTATAGG + Intergenic
1197864049 X:130999254-130999276 AGGTCCTGGATAAGTGCTATGGG - Intergenic
1199888101 X:152043490-152043512 TGCTTCTGGGTTAGAGCTAAAGG - Intergenic