ID: 1035365116

View in Genome Browser
Species Human (GRCh38)
Location 7:158344270-158344292
Sequence AGCTGTCTTCAGCAGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035365106_1035365116 12 Left 1035365106 7:158344235-158344257 CCCAAGAAGCCACCAGCCAGACC 0: 1
1: 1
2: 2
3: 30
4: 243
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data
1035365110_1035365116 3 Left 1035365110 7:158344244-158344266 CCACCAGCCAGACCAGGCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 212
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data
1035365107_1035365116 11 Left 1035365107 7:158344236-158344258 CCAAGAAGCCACCAGCCAGACCA 0: 1
1: 1
2: 2
3: 24
4: 322
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data
1035365102_1035365116 24 Left 1035365102 7:158344223-158344245 CCCCACACAGGCCCCAAGAAGCC 0: 1
1: 0
2: 3
3: 21
4: 276
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data
1035365104_1035365116 22 Left 1035365104 7:158344225-158344247 CCACACAGGCCCCAAGAAGCCAC 0: 1
1: 0
2: 1
3: 40
4: 290
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data
1035365113_1035365116 -4 Left 1035365113 7:158344251-158344273 CCAGACCAGGCTCGGGAAGAGCT 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data
1035365103_1035365116 23 Left 1035365103 7:158344224-158344246 CCCACACAGGCCCCAAGAAGCCA 0: 1
1: 0
2: 0
3: 28
4: 212
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data
1035365114_1035365116 -9 Left 1035365114 7:158344256-158344278 CCAGGCTCGGGAAGAGCTGTCTT 0: 1
1: 0
2: 1
3: 16
4: 109
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data
1035365112_1035365116 0 Left 1035365112 7:158344247-158344269 CCAGCCAGACCAGGCTCGGGAAG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data
1035365105_1035365116 13 Left 1035365105 7:158344234-158344256 CCCCAAGAAGCCACCAGCCAGAC 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1035365116 7:158344270-158344292 AGCTGTCTTCAGCAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035365116 Original CRISPR AGCTGTCTTCAGCAGGAACA AGG Intronic
No off target data available for this crispr