ID: 1035369674

View in Genome Browser
Species Human (GRCh38)
Location 7:158372032-158372054
Sequence TGTGCGGAAGACCCCCTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035369670_1035369674 -4 Left 1035369670 7:158372013-158372035 CCCTCCTGGGCGCTGGCTGTGTG 0: 1
1: 0
2: 3
3: 29
4: 347
Right 1035369674 7:158372032-158372054 TGTGCGGAAGACCCCCTCGCAGG No data
1035369668_1035369674 3 Left 1035369668 7:158372006-158372028 CCATCAGCCCTCCTGGGCGCTGG 0: 1
1: 0
2: 3
3: 49
4: 399
Right 1035369674 7:158372032-158372054 TGTGCGGAAGACCCCCTCGCAGG No data
1035369671_1035369674 -5 Left 1035369671 7:158372014-158372036 CCTCCTGGGCGCTGGCTGTGTGC 0: 1
1: 0
2: 5
3: 22
4: 251
Right 1035369674 7:158372032-158372054 TGTGCGGAAGACCCCCTCGCAGG No data
1035369666_1035369674 9 Left 1035369666 7:158372000-158372022 CCTCTGCCATCAGCCCTCCTGGG 0: 1
1: 1
2: 5
3: 63
4: 556
Right 1035369674 7:158372032-158372054 TGTGCGGAAGACCCCCTCGCAGG No data
1035369664_1035369674 10 Left 1035369664 7:158371999-158372021 CCCTCTGCCATCAGCCCTCCTGG 0: 1
1: 0
2: 8
3: 71
4: 554
Right 1035369674 7:158372032-158372054 TGTGCGGAAGACCCCCTCGCAGG No data
1035369663_1035369674 19 Left 1035369663 7:158371990-158372012 CCACAGACACCCTCTGCCATCAG 0: 1
1: 0
2: 1
3: 35
4: 318
Right 1035369674 7:158372032-158372054 TGTGCGGAAGACCCCCTCGCAGG No data
1035369673_1035369674 -8 Left 1035369673 7:158372017-158372039 CCTGGGCGCTGGCTGTGTGCGGA 0: 1
1: 0
2: 2
3: 17
4: 164
Right 1035369674 7:158372032-158372054 TGTGCGGAAGACCCCCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035369674 Original CRISPR TGTGCGGAAGACCCCCTCGC AGG Intronic
No off target data available for this crispr