ID: 1035369736

View in Genome Browser
Species Human (GRCh38)
Location 7:158372244-158372266
Sequence TCTGGGGACCAGCACTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035369736_1035369750 10 Left 1035369736 7:158372244-158372266 CCTCCCCAGTGCTGGTCCCCAGA 0: 1
1: 1
2: 4
3: 24
4: 328
Right 1035369750 7:158372277-158372299 CCAACGCTGGTCCCCGGAGCTGG 0: 3
1: 1
2: 4
3: 11
4: 98
1035369736_1035369744 4 Left 1035369736 7:158372244-158372266 CCTCCCCAGTGCTGGTCCCCAGA 0: 1
1: 1
2: 4
3: 24
4: 328
Right 1035369744 7:158372271-158372293 ATCCCCCCAACGCTGGTCCCCGG No data
1035369736_1035369754 25 Left 1035369736 7:158372244-158372266 CCTCCCCAGTGCTGGTCCCCAGA 0: 1
1: 1
2: 4
3: 24
4: 328
Right 1035369754 7:158372292-158372314 GGAGCTGGTCCCCCCAACGCTGG No data
1035369736_1035369743 -3 Left 1035369736 7:158372244-158372266 CCTCCCCAGTGCTGGTCCCCAGA 0: 1
1: 1
2: 4
3: 24
4: 328
Right 1035369743 7:158372264-158372286 AGAGCTGATCCCCCCAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035369736 Original CRISPR TCTGGGGACCAGCACTGGGG AGG (reversed) Intronic
900089575 1:914066-914088 TGTGGGGGCCAGGACAGGGGCGG - Intergenic
900290980 1:1923499-1923521 TCTGGGGACAAGAAGTGGAGTGG + Exonic
900603109 1:3511601-3511623 ACAGGGGCCCAGCACTGGTGTGG + Exonic
900613518 1:3554242-3554264 TCTGGGTTCCAACACTGGGCTGG + Intronic
900831846 1:4971157-4971179 ACTGGGGAGCACCGCTGGGGAGG + Intergenic
900926311 1:5708446-5708468 TCAGGAGACCAGCACTGGCATGG - Intergenic
901177755 1:7317095-7317117 TCTGGAGACCAACACTGTGAAGG + Intronic
901501686 1:9656245-9656267 GCTTGGGACCAGAAATGGGGTGG + Intronic
901536361 1:9884899-9884921 GCTGCAGGCCAGCACTGGGGTGG + Intronic
901624688 1:10617342-10617364 CCTGGACAGCAGCACTGGGGAGG - Intronic
902116353 1:14124882-14124904 TGTCGGGGGCAGCACTGGGGAGG + Intergenic
902576615 1:17381911-17381933 TCTGGAGGCCAGCACTCTGGGGG - Intronic
902894501 1:19469588-19469610 TCTGGGGACAGGCAGTGAGGCGG + Intronic
903261650 1:22134792-22134814 TCTGGGGTGCAGCAGAGGGGTGG - Intronic
904558632 1:31382044-31382066 TCTGGGCACCAGGCCTGGTGTGG + Intergenic
904832173 1:33312260-33312282 CCTAGGGCTCAGCACTGGGGAGG - Intronic
906745036 1:48215575-48215597 TCTTGGGGCCAGCATGGGGGTGG - Intergenic
913130500 1:115834312-115834334 TCTGGGGAGCAGCAATGGCCTGG + Intergenic
915115780 1:153598653-153598675 TCTGGGGTCCAGCGCTGGCCTGG - Intergenic
916727757 1:167538214-167538236 CCTGGAGACCAGAACTGGGTGGG + Intronic
919743283 1:200993212-200993234 TCTGGGCACCAGGAATAGGGAGG - Intronic
919963399 1:202495511-202495533 TCTGGGGATGTGCACTGTGGAGG - Intronic
920093719 1:203472160-203472182 TCTCAGGACCACCACGGGGGAGG + Intergenic
920181997 1:204137795-204137817 TCTGGGGAACTGGACTGGGGTGG - Intronic
920496863 1:206461149-206461171 CGTGGGGGCCACCACTGGGGAGG - Exonic
920872493 1:209805909-209805931 TCTGGGGACCAGCTTGAGGGAGG - Intronic
921035364 1:211372730-211372752 TCTTGGGGCCAGAACTGTGGAGG + Exonic
921189478 1:212697065-212697087 TCTGGGGAAAAACACTGGGTGGG + Exonic
921257657 1:213356997-213357019 TGTGGGCACCAGCACAGGGAGGG + Intergenic
922686595 1:227643565-227643587 TGTGGGTACCAGCTTTGGGGAGG - Intronic
922978460 1:229804491-229804513 TCAGGTGACCATCCCTGGGGGGG - Intergenic
923443098 1:234039994-234040016 TTTGGGTACCAGCACTTGGTGGG + Intronic
923563684 1:235060833-235060855 GCTGGGAAACAGCACTGGCGGGG - Intergenic
1063143182 10:3274083-3274105 TCTGCGGCCCAGCACAGGGAGGG - Intergenic
1063196984 10:3752814-3752836 TGTGGGGCACAGCCCTGGGGTGG + Intergenic
1063537672 10:6900897-6900919 TCTGGGTACCTGCACTTGGTGGG + Intergenic
1064851791 10:19716337-19716359 TCAGTAGAACAGCACTGGGGGGG - Intronic
1065495136 10:26319800-26319822 TATGGGGACCAGAAGTGAGGAGG + Intergenic
1066200836 10:33141596-33141618 TGAGGGGCCCAGCACTGGAGGGG + Intergenic
1067044068 10:42974726-42974748 TCAGGGGTCCAGGCCTGGGGTGG - Intergenic
1067046797 10:42989709-42989731 TCTTGGGGCCGGCAGTGGGGAGG + Intergenic
1067365229 10:45621397-45621419 TCTGGGGACAAGCAGAGGGCTGG + Intronic
1067427853 10:46223073-46223095 TCTAGGGACAGGCACTGGGTGGG - Intergenic
1069782581 10:70966042-70966064 CCTGGGGACCATAACTGGGGGGG + Intergenic
1070763971 10:79045905-79045927 TCTGTGGGCCAGCATTGGGCAGG - Intergenic
1071991158 10:91101980-91102002 TCTGGGGCTCACCACTGGGTAGG + Intergenic
1072220948 10:93327107-93327129 TCTGGGGACCCTCACTCTGGGGG + Intronic
1073102842 10:101015852-101015874 TCTGGGGCCCAGCCCTGCTGAGG - Intronic
1073136183 10:101221908-101221930 CCTGGGGACCAGCACCCTGGAGG - Intergenic
1075674365 10:124286117-124286139 TCTGGGGAATAAGACTGGGGTGG + Intergenic
1075949366 10:126463564-126463586 TCTGGGGACCTGCAGAGGGTGGG - Intronic
1076543172 10:131227221-131227243 CATGGTGACCAGCACTGGGTTGG - Intronic
1077773821 11:5249684-5249706 TCTGGTGACCAGGACAAGGGAGG - Intronic
1077774324 11:5254608-5254630 TCTGGTGACCAGGACAAGGGAGG - Intronic
1078583701 11:12561193-12561215 TGTGGAGACCAGAACTGGGTTGG - Intergenic
1079103669 11:17557307-17557329 TCTGGTGACCAGCTCTGGTGAGG + Exonic
1079712875 11:23708386-23708408 TTTGTGGACCTGCCCTGGGGAGG + Intergenic
1083142505 11:60733618-60733640 TCAGGGTACCCGCTCTGGGGAGG + Exonic
1083200671 11:61119263-61119285 TCTGGCGGCCAGCACTGTGCCGG + Exonic
1083320345 11:61842218-61842240 ACTGGTGACCAGCTCAGGGGTGG - Intronic
1083603465 11:63962664-63962686 TCTGGGGGCCGCCTCTGGGGTGG + Intergenic
1083864256 11:65445230-65445252 TCTGGGACCGAGCACTGAGGGGG - Intergenic
1083893032 11:65606232-65606254 TCTTGGGGCCAACAGTGGGGTGG + Intronic
1084007635 11:66331762-66331784 TCTGGTGTCCAGGACAGGGGTGG + Intronic
1084164758 11:67370388-67370410 GCTGGGGGCCAGGACTGGTGGGG - Intronic
1084411108 11:69006322-69006344 TCTGGGGCCCAGCGTGGGGGAGG + Intronic
1084982522 11:72838272-72838294 TCTGGGGACTAACCTTGGGGAGG + Exonic
1085390358 11:76179075-76179097 TCTGTGGACCAGGCCTGGGTCGG + Intergenic
1085465667 11:76721746-76721768 TCTGGGGACCCGTACTGTGGGGG + Intergenic
1087602958 11:100339228-100339250 TCTGGGTACCTGCACTCGGTGGG + Intronic
1087786612 11:102361673-102361695 TCCAGGGACCTGCTCTGGGGAGG + Intronic
1088598308 11:111455841-111455863 TCTGGGCACCGGCACTGGGGCGG + Exonic
1089442844 11:118531058-118531080 GCTGGGGACCAGCCGGGGGGTGG + Exonic
1089500155 11:118927206-118927228 TCTGGGGACCATCTGTGAGGAGG - Intronic
1089524661 11:119089145-119089167 AGTGGGGACAAGAACTGGGGAGG - Intronic
1089604257 11:119632566-119632588 TCTGGGGAGCACCCCTGGGTTGG + Intronic
1091086816 11:132728910-132728932 ACTGGGGCCCAGCATTGGGGTGG - Intronic
1091548289 12:1518950-1518972 TCTGGAGCCCAGGACTGGGTAGG + Intergenic
1091778540 12:3199983-3200005 TCTGGGGAGAAGGACTGGAGGGG - Intronic
1091798503 12:3310482-3310504 TGTGGGGCCCAGCAGTGCGGGGG - Intergenic
1091825586 12:3510193-3510215 CCTGGGGTCCTGCTCTGGGGTGG + Intronic
1092084308 12:5743079-5743101 TGTGGGGACCTTCACTTGGGTGG - Intronic
1092203546 12:6602133-6602155 GCTGGGGGACAGCTCTGGGGAGG - Exonic
1094348463 12:29497587-29497609 CCTGGGCACCAGGACTGCGGAGG - Intronic
1096586036 12:52620519-52620541 TCAGCACACCAGCACTGGGGTGG + Intergenic
1096693004 12:53332784-53332806 TCTGGGGCCCAGCACCATGGTGG - Intronic
1097719703 12:63006686-63006708 TATGGGCATCAGCACGGGGGAGG + Intergenic
1099319546 12:81129040-81129062 TCTGTAGACCAGCTCTGGTGTGG + Intronic
1100579305 12:95923378-95923400 TCTGGGGTCCAGCCCTGGCCTGG - Intronic
1100879190 12:98997237-98997259 ACTGGGGACCAGGATTGGGCAGG + Intronic
1101609720 12:106279384-106279406 TCTGGGTACCTGCACTTGGTGGG + Intronic
1103036583 12:117661862-117661884 TCTGGGAAGCAGGATTGGGGAGG + Intronic
1103536855 12:121639160-121639182 TCTGGGGACATGCAGAGGGGTGG - Intronic
1103741311 12:123093638-123093660 TCTGGGGGCCAGCCCTGGGAGGG + Intronic
1106375479 13:29182833-29182855 TCTGGGAACAACCACTGTGGGGG + Intronic
1107449085 13:40492460-40492482 CCTGGGGACCAGCATCTGGGAGG - Intergenic
1107452027 13:40518508-40518530 TATGTGGATCAGAACTGGGGTGG - Intergenic
1112433129 13:99370561-99370583 TCTGGGGACAGGGAATGGGGAGG - Intronic
1113472657 13:110557877-110557899 TCTGGGGACCAGGTCTGTGCTGG + Intronic
1113639407 13:111946423-111946445 TCTGTGGGCCAGCACTGCAGGGG + Intergenic
1113724378 13:112587678-112587700 GCTGGGGGCCAGGACCGGGGCGG - Intronic
1115405531 14:33011335-33011357 TGTGGGGACCAGCCCTGGAGAGG + Intronic
1115800688 14:36990291-36990313 GCTGGGGAACAGCACTGCTGGGG - Intronic
1116734502 14:48671452-48671474 TCTCTGGACCAGCCCTGTGGAGG - Intergenic
1117074794 14:52091129-52091151 TGTGGGCACCAGCACTGGCGTGG - Intergenic
1118483859 14:66195684-66195706 TCTGGGTACCTGCACTTGGTGGG + Intergenic
1118647953 14:67858222-67858244 TCTGGGTACCCGCACTTGGTGGG + Intronic
1119352148 14:73974896-73974918 TCTGGGTACCTGTGCTGGGGGGG - Intronic
1121442597 14:93958207-93958229 TCTACTGACCCGCACTGGGGTGG + Intronic
1122246003 14:100404127-100404149 TATGGGGCCCAGCACTGGGCTGG - Intronic
1124121471 15:26892418-26892440 CCGGGGGCCCAGCAGTGGGGGGG + Intronic
1124165109 15:27319436-27319458 ACTGCTGACCAGCACTGTGGTGG + Intronic
1124222305 15:27861387-27861409 TCTGGGGAGCAGCCCAGGAGAGG + Intronic
1124251215 15:28107421-28107443 TCAGCGGACCCGCGCTGGGGTGG - Intergenic
1124402545 15:29362116-29362138 TCTGTGGAACAGCACTGAGTGGG - Intronic
1124911335 15:33924072-33924094 TCTGTGGACCAGAAAAGGGGGGG - Intronic
1125539048 15:40459247-40459269 GCAGGGGGCCAGCTCTGGGGAGG + Exonic
1125589714 15:40846649-40846671 TTTGGGGGCCAGAACTGGGCTGG + Intronic
1125593577 15:40870720-40870742 TCTGGGGACAGGCCCTGGTGGGG + Intergenic
1126846438 15:52764997-52765019 TCTGGGTAGCAGCCCTGGGCTGG - Intronic
1128310804 15:66630901-66630923 TCTGCGGAGGAGTACTGGGGAGG + Intronic
1129112376 15:73344885-73344907 TCTTGGGGCCAGCCCTGGGATGG - Intronic
1130315905 15:82796342-82796364 ACTGGGGACCAGCTCTGGCCAGG - Intronic
1130549583 15:84881419-84881441 TGTGGGGACCAGCACTGCCCTGG + Intergenic
1131114042 15:89783493-89783515 TCTGGGGACCAGCTGTGGGAGGG - Intergenic
1131693673 15:94854047-94854069 TTTGTGGACCAGCCCTGTGGAGG + Intergenic
1132629783 16:911619-911641 TTGGGGGGGCAGCACTGGGGAGG + Intronic
1132629807 16:911689-911711 CTGGGGGAGCAGCACTGGGGAGG + Intronic
1135993127 16:27229444-27229466 TGTGGGGCCCAGCACTTGGCAGG + Intronic
1136579417 16:31142710-31142732 GCTGGGGACCGGCGCTGGGCCGG - Intronic
1137248800 16:46728203-46728225 CCTTGGCCCCAGCACTGGGGCGG + Intronic
1138157007 16:54715184-54715206 ACTGGGGCTCAGCACTGGTGGGG + Intergenic
1138438808 16:57022186-57022208 GCTGGGGACCAGCTCTGGCCTGG - Intronic
1138549934 16:57741938-57741960 GCTGGGGCCCAGCTCAGGGGTGG + Intronic
1139553691 16:67692122-67692144 TCTGGGGATCAGAAGTGGGCAGG + Intronic
1140600614 16:76471155-76471177 TCTGTGGACATGCAGTGGGGTGG + Intronic
1141436074 16:84000654-84000676 CCAGGGGAACAGCACTGAGGTGG + Intronic
1141906361 16:87029290-87029312 TCTGGAGCACAGCACTGAGGTGG + Intergenic
1141961793 16:87413799-87413821 TCTGGGCACCAGTCCTGGGGTGG + Intronic
1142000484 16:87661501-87661523 TTGGGGGTCCAGGACTGGGGAGG + Intronic
1142153147 16:88521510-88521532 TTGGGGGAACAGCACGGGGGAGG - Intronic
1142153189 16:88521651-88521673 TTGGGGGAACAGCACAGGGGAGG - Intronic
1142480771 17:216930-216952 TCTTGGGACCAAGACTGGGTTGG - Intronic
1143706749 17:8703376-8703398 TCTGGGTACCTGCACTTGGTGGG + Intergenic
1145769966 17:27485867-27485889 TCGGGGGAGCAGCCCTGGGTGGG - Intronic
1147176123 17:38657324-38657346 TCTGGGCTTCAGCATTGGGGTGG - Intergenic
1147374389 17:40015415-40015437 TTTGGGGCCCAGCTCTAGGGGGG - Intronic
1147516347 17:41121746-41121768 TCTTGGGATTAACACTGGGGAGG + Intergenic
1147967524 17:44200828-44200850 CCAGGGGAACAGCACTGGGTCGG - Intergenic
1148165535 17:45481807-45481829 GCTGGGAAGCAGCAGTGGGGAGG + Intronic
1148489742 17:48015277-48015299 CCTGGGCAGCAGCAATGGGGAGG - Intergenic
1148495941 17:48053681-48053703 CCAGGGGAGCAGCAGTGGGGAGG + Intronic
1150266136 17:63833538-63833560 TCTGGGGCCCAGGATTGGGGTGG - Intronic
1150293926 17:63998127-63998149 TCTGGGAACCAGCAAGGGGAGGG + Intergenic
1150396762 17:64828525-64828547 GCTGGGAAGCAGCAGTGGGGAGG + Intergenic
1150446731 17:65232155-65232177 TATGGGGACCAGGGATGGGGAGG + Intergenic
1150917498 17:69451585-69451607 TCTTGGGACCAGCATTTGAGGGG + Intronic
1151018474 17:70584679-70584701 TCTGGGTACCCGCACTCGGTGGG + Intergenic
1151358469 17:73573976-73573998 TCTGGGGAGTGGCACTGGAGTGG - Intronic
1151552334 17:74829369-74829391 TGTGTGGCCCAGCACTGAGGTGG - Intronic
1151940060 17:77286693-77286715 CCTGTGGACAAACACTGGGGCGG - Intronic
1154202071 18:12307024-12307046 GCCGAGGAGCAGCACTGGGGTGG + Intergenic
1154205003 18:12328690-12328712 CTTGAGGACCTGCACTGGGGTGG + Intronic
1156485478 18:37462992-37463014 TCTGTGGACCTGCACTCTGGGGG + Intronic
1157382009 18:47227099-47227121 TTTGGGGAGCAGCAGTTGGGAGG - Intronic
1157475224 18:48019733-48019755 TCTGGGGACCAGCAGAGAGGAGG - Intergenic
1160122940 18:76146594-76146616 TCAAAGGCCCAGCACTGGGGGGG + Intergenic
1160517862 18:79488423-79488445 TCTGAGGGACAGCCCTGGGGAGG - Intronic
1161034255 19:2075638-2075660 GATGGGGACCAGCAGTGGAGTGG - Intronic
1161068335 19:2248858-2248880 TCTGGGGTCCTGTTCTGGGGAGG + Intergenic
1161220591 19:3116340-3116362 TCTGGCCTCCAGCACTGGGCGGG - Intronic
1161299237 19:3534913-3534935 TCGGGGGACAAGCGCTGGGAAGG - Intronic
1161701936 19:5800499-5800521 CCCGGGGACCAGCCCTGTGGGGG - Intergenic
1163005325 19:14393781-14393803 CCTGGGGACTAGCAGTGTGGCGG - Intronic
1163639906 19:18456305-18456327 TCTGTGGACCAGCACAGGGTTGG + Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1168108698 19:54180143-54180165 GCTGGGGAACAGCACTGGTCAGG + Intronic
925004748 2:433321-433343 TCAGGCCACCAGCACTGAGGGGG - Intergenic
926158873 2:10474303-10474325 TCTGGGTGCCCGTACTGGGGGGG - Intergenic
926612361 2:14959066-14959088 TATGGCAACAAGCACTGGGGTGG + Intergenic
927131431 2:20063701-20063723 TCTGGGGGTAAGAACTGGGGAGG + Intergenic
927462491 2:23311073-23311095 TCTTGAGACCAGAACTGGTGGGG - Intergenic
928470343 2:31568934-31568956 TCTAGGCACCTGCTCTGGGGTGG - Intronic
929300966 2:40303358-40303380 TCAGGGGGCCAGCACTGGCTGGG + Intronic
931393509 2:61865231-61865253 GATGCTGACCAGCACTGGGGAGG - Intergenic
933154508 2:78958278-78958300 TCAGGGGACAAGCACAGTGGAGG - Intergenic
937248540 2:120509609-120509631 TCTGGGGACCAGGACTGGAAGGG + Intergenic
937362461 2:121238575-121238597 TCTGGGGATCAGCCCTGCGAGGG - Intronic
937515739 2:122653476-122653498 TCTGGGGACAGGCAGTGTGGTGG - Intergenic
938083241 2:128381297-128381319 TCTGGAGACCAGGCCTGAGGAGG + Intergenic
938936593 2:136132789-136132811 GCTGGGTACCAGTCCTGGGGTGG + Intergenic
940017102 2:149118231-149118253 TCTGGGGACCACCACTACCGAGG + Intronic
941917526 2:170822327-170822349 CCTGGGGACCAGGTCTGGGGCGG - Intronic
944859731 2:203803724-203803746 TCTGGGGACCTGCCCAGTGGTGG - Intergenic
945451505 2:210000859-210000881 TCTGCGGCCCCGCACTTGGGTGG - Intergenic
946024205 2:216662032-216662054 TCTGGGGCCCAGGGCTGAGGAGG - Intronic
946116046 2:217463345-217463367 TCTGGGGACCAGAGCTGGGATGG - Intronic
946200603 2:218068789-218068811 ACTGGTGACCAGCACTCAGGTGG + Intronic
946309943 2:218877896-218877918 GCTGGGCACCAGGACTGGGCTGG + Intergenic
946842916 2:223836328-223836350 TCTGGTGACCTGCACTTGGGTGG - Intronic
948676961 2:239602458-239602480 TCTGGGAACCAGCTCTGCTGTGG - Intergenic
948883932 2:240873738-240873760 CCTGGGGACCAGCACAGCAGAGG + Intronic
1171183178 20:23105883-23105905 TCTAGCAACCAGCACTGGGCTGG - Intergenic
1171561924 20:26134502-26134524 TATGGGAACCAGCCCTTGGGTGG - Intergenic
1171754251 20:29087147-29087169 TCTGGGGCCAAGGGCTGGGGGGG - Intergenic
1172196566 20:33095890-33095912 ACATGGGACCAGAACTGGGGTGG - Intronic
1172487026 20:35304481-35304503 CCTGGGTAGCAGCACTGGGAAGG - Intronic
1172591394 20:36120633-36120655 TCTAGGCCCAAGCACTGGGGTGG - Intronic
1173845211 20:46183929-46183951 TGTGGTGAGCAGGACTGGGGTGG - Intronic
1173943430 20:46931686-46931708 TCAGGGCACCATCTCTGGGGTGG + Intronic
1174479977 20:50824414-50824436 TCTGGAGACCAGGTCTGGAGAGG + Intronic
1174758779 20:53185962-53185984 TCTTGGGACTGGCACTTGGGTGG + Intronic
1175289804 20:57868170-57868192 TCTGGGGAGCAGGAGTGAGGGGG - Intergenic
1175521615 20:59605493-59605515 GCTGGGGCCCGGCAGTGGGGAGG - Intronic
1175755599 20:61527845-61527867 TCAGGGCAGCAGCACTGGGCAGG + Intronic
1176672149 21:9744883-9744905 GGTGGGGACCAGGACTGTGGGGG + Intergenic
1178711797 21:34923788-34923810 TCCAGAGACCAGCAGTGGGGAGG - Intronic
1179647655 21:42785120-42785142 TTTGGGGACCACCACAGGGCGGG - Intergenic
1181027295 22:20133333-20133355 CCTGGGGACCAGCACTGGGCTGG - Intronic
1181600933 22:23951593-23951615 CCTGGGAACCCCCACTGGGGAGG + Intergenic
1182230442 22:28833794-28833816 TCTGGGTTCAAGCACTGGTGAGG + Intergenic
1182426864 22:30278228-30278250 ACTGGGGAGGAGCACTGGGCTGG + Intergenic
1183026277 22:35067913-35067935 TCTGGGGACATGCCTTGGGGTGG - Intronic
1183028214 22:35082411-35082433 GCTCGGGAGCAGCAGTGGGGTGG + Intronic
1183649341 22:39145295-39145317 TCTGGGCTCCTGCACTGCGGAGG - Intronic
1184099723 22:42335798-42335820 TCAGGGTGCCAGCTCTGGGGTGG + Intronic
1185120228 22:48961903-48961925 TCAGGAGACCAGCATGGGGGAGG + Intergenic
949473084 3:4417151-4417173 TCCGGTGACCAACACTGGTGAGG - Exonic
949931395 3:9081213-9081235 CCAGGGGACCAGCACTGGGGAGG - Intronic
950171051 3:10839373-10839395 ACTTGGGACCAGGAGTGGGGAGG - Intronic
950574394 3:13823099-13823121 TCTGGTGACCAGCCCTGGCCAGG - Intronic
950799840 3:15541535-15541557 TCTGGAGGACAGCACTGGGCTGG - Intergenic
952172972 3:30829929-30829951 TCTGAGAAACAACACTGGGGAGG + Intronic
952764977 3:36945620-36945642 TCTGTCGATCATCACTGGGGAGG - Intergenic
953532613 3:43752210-43752232 TCTTGGCACCAGCAAAGGGGAGG + Intergenic
953869068 3:46610412-46610434 TCGGGAGACTAGCACTGAGGAGG + Intronic
954127984 3:48543443-48543465 TCTGGGTGCCAGCCCTTGGGAGG - Intronic
954692216 3:52401684-52401706 TCAGGGACCCAGCACTGGGCTGG - Exonic
954699118 3:52442383-52442405 TCTGGCGGTCAGCTCTGGGGAGG + Intronic
955330570 3:58043832-58043854 TCTGATGCCCAGTACTGGGGTGG - Intronic
955400153 3:58585699-58585721 GCTGGGGTCCTGCACTGTGGAGG - Intronic
956781403 3:72606107-72606129 TGTGTGGACCAGCTCGGGGGAGG - Intergenic
959486673 3:106934706-106934728 TCTGGGGTCCAGCCCTATGGTGG - Intergenic
960374060 3:116877152-116877174 TCTGGGTACCAGCAATGGTCAGG + Intronic
961043282 3:123692473-123692495 TGTGGGGATCAGGACTGGGAGGG + Intronic
963044736 3:141094269-141094291 TCTGGCCTCCAGCACTGGGCCGG + Intronic
965039688 3:163490458-163490480 TCTGGGTATCAGCACTTGGTGGG + Intergenic
966123775 3:176551832-176551854 TCTGGGGTTCAGCCCTGAGGCGG - Intergenic
966871080 3:184290954-184290976 TCTGTGGACCAGGGCTGGTGGGG + Intronic
968406249 4:341788-341810 TGTGGGCACCAGCTCTGGAGAGG - Intronic
976557852 4:86469382-86469404 TCTGGGCACTGGTACTGGGGAGG - Intronic
977589401 4:98809687-98809709 CCTGGGGACCTGCACAGAGGAGG + Intergenic
978455742 4:108889321-108889343 TCTGGGCACCATCACAGGGATGG + Intronic
980053970 4:128062153-128062175 TCTGGGGACAGGTGCTGGGGAGG - Intronic
980116453 4:128684204-128684226 TCTTGGGACCAGTTATGGGGAGG - Intergenic
980299720 4:130973033-130973055 TCTGGGTACCTGCACTTGGTAGG - Intergenic
982167628 4:152629147-152629169 TCTCTGCATCAGCACTGGGGAGG - Intronic
984825825 4:183923932-183923954 TCTGTGGACCAGCATTGAGTTGG + Intronic
985402587 4:189606965-189606987 GGTGGGGACCAGGACTGTGGGGG - Intergenic
985547018 5:514941-514963 TCTGGGAGCCAGCCCTGGGGAGG - Intronic
986003326 5:3647527-3647549 TCTGTGGACCAGAACTGGTCTGG - Intergenic
988594343 5:32577770-32577792 GCTGGGGCCCAGCACTAGGCTGG - Intronic
992000997 5:72436627-72436649 TCTTTGCTCCAGCACTGGGGTGG - Intergenic
995858237 5:116615757-116615779 TCTGGCGGGCAGCAGTGGGGTGG + Intergenic
996975102 5:129423420-129423442 TCCTGAGACCAGCACTTGGGTGG + Intergenic
997341645 5:133149806-133149828 TCTGGGCAGCAGCCCTGCGGGGG + Intergenic
997392094 5:133525449-133525471 GCTGGGGAACACCACTGGGCAGG - Intronic
997439551 5:133899566-133899588 TCTGGGGTCCTGCTCAGGGGAGG - Intergenic
998071358 5:139200419-139200441 TTTGGAGACCAGGCCTGGGGTGG - Intronic
998136319 5:139676352-139676374 TCTGGGGAGGAGGGCTGGGGAGG - Intronic
998267406 5:140676689-140676711 TGTGGGGCTCAGCATTGGGGTGG - Exonic
999124565 5:149237692-149237714 TCTGGGAGCCAGCATTGTGGAGG - Intronic
999258851 5:150225461-150225483 TCTGGGGGCCAGCACTAAGATGG + Intronic
1001300666 5:170531396-170531418 TCTGAGGACCACCAATGAGGTGG + Intronic
1001851397 5:174969976-174969998 TCTGGGAAGCAACACTGGTGGGG + Intergenic
1002191121 5:177478177-177478199 TGTGGGGCCCTGCACTGAGGAGG + Intergenic
1003175511 6:3750666-3750688 AATGGGGACCAGCCCTGGCGGGG + Intronic
1003242222 6:4354496-4354518 TGTGTGGAACAGCACTGGAGTGG + Intergenic
1006097703 6:31666180-31666202 GACGGGGACCAGGACTGGGGTGG - Exonic
1006297601 6:33176927-33176949 TCTGAGGTCATGCACTGGGGTGG + Intronic
1006314001 6:33279689-33279711 TCTGGGGACAAGCCATGGTGGGG + Intronic
1006823595 6:36917675-36917697 TCTGTCTGCCAGCACTGGGGTGG + Intronic
1008121431 6:47621871-47621893 TCAAGGGACCAGCAGTGGGCGGG + Intronic
1010081705 6:71871328-71871350 TCTTGGGATCAACACCGGGGAGG + Intergenic
1015879023 6:137852330-137852352 CCTGGGAAGCAGCACTGGGTGGG - Intergenic
1016082976 6:139878263-139878285 TCTGGGTACCTGCATTGGGTGGG + Intergenic
1016183510 6:141175163-141175185 TCTGGGGCCCACCACTGAGCCGG - Intergenic
1017140308 6:151183994-151184016 TCTGGTACCCAGCCCTGGGGTGG - Intergenic
1018416522 6:163606578-163606600 TCCTGGGACCAGGTCTGGGGTGG + Intergenic
1018845401 6:167552007-167552029 TCTGGGGACCGGGACAAGGGGGG + Intergenic
1019408712 7:897503-897525 TGAGGGGCCCAGCATTGGGGGGG + Intergenic
1021256995 7:18404926-18404948 TCAGGGAACCAGCCCTGGGCAGG + Intronic
1021386370 7:20035651-20035673 TCTGGGTACCTGCACTTGGTGGG + Intergenic
1021825601 7:24547673-24547695 TCTACAGACCAGCACTGAGGAGG - Intergenic
1022090387 7:27104081-27104103 TGTGGGAAACAGCACTGCGGGGG + Intergenic
1022875281 7:34521494-34521516 TCAAGAGACCAGCACTGAGGGGG - Intergenic
1024557428 7:50615515-50615537 TCTGGGAACCGGCTCTGGGAAGG - Intronic
1024564192 7:50668082-50668104 TCTGGGAGCCAGCACTGGCTGGG - Intronic
1026223658 7:68422190-68422212 TCTTGAGAGCAGGACTGGGGAGG - Intergenic
1028767577 7:94577287-94577309 TTTGGGGAGCAGAAGTGGGGAGG - Intergenic
1028927128 7:96370566-96370588 GCTGGGGAGCATCACTGGTGGGG - Intergenic
1029551887 7:101240893-101240915 TTTGGGCAGCAGCTCTGGGGAGG + Exonic
1029710059 7:102294637-102294659 CTTTGGGACCAGAACTGGGGAGG - Intronic
1033116477 7:138630391-138630413 TCTGCCCACCAGCACTGGCGCGG + Intronic
1034445541 7:151112209-151112231 TCTGGGGAAAAGGACTGGGAAGG + Intronic
1034885582 7:154795928-154795950 TCTGAGGGCCAGCCCTGGGGTGG - Intronic
1035369705 7:158372161-158372183 TCTGGGGACCAGCACGGGGTGGG - Intronic
1035369736 7:158372244-158372266 TCTGGGGACCAGCACTGGGGAGG - Intronic
1035369786 7:158372384-158372406 TCTGGGGACCAGCATTGGGGAGG - Intronic
1035478061 7:159157808-159157830 ACTTGGGACCCTCACTGGGGAGG + Intergenic
1035643500 8:1201073-1201095 CCCAGAGACCAGCACTGGGGAGG + Intergenic
1036202906 8:6784269-6784291 TTTGGGGACCTGCAGTGGGTTGG + Intergenic
1036772443 8:11588424-11588446 GCTGGGGTAGAGCACTGGGGCGG + Intergenic
1036782289 8:11658120-11658142 TCTGCAGACCAGGGCTGGGGAGG - Intergenic
1038395020 8:27240261-27240283 TCTGGGGACCAGGCCCAGGGAGG - Intronic
1039466331 8:37787884-37787906 TCTGGGGAGCAGGACTGGGAGGG + Intronic
1041096125 8:54351886-54351908 TCTGGGGGCTTTCACTGGGGTGG + Intergenic
1045552318 8:103183485-103183507 TGGGGGGACCAGATCTGGGGAGG + Intronic
1048593034 8:135839083-135839105 TCTGGGGACCATCATTAGGAGGG - Intergenic
1049248592 8:141576174-141576196 TCTGGGTACCAGGACTGATGAGG + Intergenic
1049566354 8:143341153-143341175 TGTGGGGAGATGCACTGGGGCGG - Intronic
1049675217 8:143886183-143886205 CCTGGGGCCCAGCACAGTGGTGG - Intergenic
1049955294 9:687576-687598 GCTGGGCAACAGCACTGGGAGGG - Intronic
1051366161 9:16322990-16323012 GCAGGGGCCCAGCACTGGGCAGG - Intergenic
1051372980 9:16374061-16374083 CCAGAGGACCAGCACTGGAGAGG + Intergenic
1052821436 9:33140713-33140735 CCTGTGGAACAGCACTGGTGGGG - Intronic
1053008684 9:34621351-34621373 TCTGGGACCCAGCCCTGGGAGGG - Intergenic
1057379174 9:94553637-94553659 AATGGGAACCAGCACTTGGGTGG - Intergenic
1058618838 9:106862706-106862728 TCTGGGGTTCAGCAGGGGGGAGG + Intergenic
1058662869 9:107282843-107282865 TCTGGGGGCCAGCACCCGCGGGG - Intergenic
1059443646 9:114324956-114324978 TCTAGGGGCCAGCCCAGGGGTGG - Intronic
1059444846 9:114331733-114331755 TCTAGGGGCCAGCCCAGGGGTGG - Intronic
1059691208 9:116687499-116687521 TGTGGGGACCGGATCTGGGGGGG + Intronic
1060088207 9:120720603-120720625 TCTGGGGACAGGCACTGGGTGGG - Intergenic
1060300412 9:122371545-122371567 TCTGGGGCCCAGAACAGGTGAGG - Intronic
1060696134 9:125710645-125710667 ACTGAGGAACAGCACTGGGGAGG + Intergenic
1060943827 9:127558314-127558336 TCTGGGGCCCTGCACGGGTGCGG + Intronic
1060978003 9:127776707-127776729 ACTGAGGCCCAGCAATGGGGAGG + Intronic
1060982552 9:127802306-127802328 GCTGAGGCCCAGAACTGGGGAGG - Intronic
1061246682 9:129404358-129404380 CCCGGGGACCAGCACTGGTCAGG - Intergenic
1061376211 9:130226305-130226327 TCTTGGGACCGGCCCTGGGCTGG + Intronic
1061941605 9:133887036-133887058 TCTGGGAACCACCACTGCTGAGG - Intronic
1062183516 9:135203866-135203888 ACTGAGGCCCAGCAGTGGGGAGG + Intergenic
1062245190 9:135562484-135562506 TCAGGGGTCCAGGACTGGGTGGG + Intronic
1062323590 9:136002433-136002455 CCTGGGGAGAAGCACTCGGGTGG - Intergenic
1062378281 9:136274799-136274821 TCTGGGCACAGGCAGTGGGGTGG - Intergenic
1062460238 9:136659906-136659928 TCAGGGGCCCAGCACAGAGGGGG - Intronic
1062538074 9:137029519-137029541 TCTGGTGGCCAGTGCTGGGGAGG - Intronic
1062652828 9:137587090-137587112 TCTAGGGAGCGGCACCGGGGGGG - Exonic
1185618188 X:1435991-1436013 TCTGGGGAGGCGCACTGGGGAGG - Intronic
1188526989 X:31097600-31097622 TTTGGGTACCAGCACTTGGTGGG + Intergenic
1190259083 X:48786726-48786748 TTTGGGGACCAGCTGTGGGTTGG - Intronic
1192768040 X:74162433-74162455 TGTGGGGACCAGGTTTGGGGAGG + Intergenic
1195259977 X:103122418-103122440 TCTGGGAAGCAGGAATGGGGAGG - Intergenic
1200039353 X:153354580-153354602 TCTGGGGCCCAGCACAGAGCAGG - Intronic
1200118994 X:153781632-153781654 TCCGGGGCCCAGCACTGGCTGGG + Intronic
1200250697 X:154552354-154552376 TCTCAGGACCAGTACTGGGAAGG + Intronic
1200780354 Y:7210082-7210104 TCACGGGACCACCACTGTGGAGG + Intergenic