ID: 1035370260

View in Genome Browser
Species Human (GRCh38)
Location 7:158375431-158375453
Sequence GTGGCCAAACCCAGCCATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035370257_1035370260 -4 Left 1035370257 7:158375412-158375434 CCAGGCTCAAGCTCCTGGTGTGG 0: 1
1: 0
2: 2
3: 9
4: 220
Right 1035370260 7:158375431-158375453 GTGGCCAAACCCAGCCATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035370260 Original CRISPR GTGGCCAAACCCAGCCATCT CGG Intronic
No off target data available for this crispr