ID: 1035372423

View in Genome Browser
Species Human (GRCh38)
Location 7:158387876-158387898
Sequence CTGCAGATGTCAGACCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035372417_1035372423 -6 Left 1035372417 7:158387859-158387881 CCAGCCCACCAGCTGCCCTGCAG 0: 1
1: 1
2: 3
3: 70
4: 686
Right 1035372423 7:158387876-158387898 CTGCAGATGTCAGACCCGCCAGG No data
1035372415_1035372423 5 Left 1035372415 7:158387848-158387870 CCTCTGAATTCCCAGCCCACCAG 0: 1
1: 0
2: 2
3: 28
4: 348
Right 1035372423 7:158387876-158387898 CTGCAGATGTCAGACCCGCCAGG No data
1035372418_1035372423 -10 Left 1035372418 7:158387863-158387885 CCCACCAGCTGCCCTGCAGATGT 0: 1
1: 0
2: 0
3: 22
4: 300
Right 1035372423 7:158387876-158387898 CTGCAGATGTCAGACCCGCCAGG No data
1035372416_1035372423 -5 Left 1035372416 7:158387858-158387880 CCCAGCCCACCAGCTGCCCTGCA 0: 1
1: 0
2: 1
3: 46
4: 522
Right 1035372423 7:158387876-158387898 CTGCAGATGTCAGACCCGCCAGG No data
1035372413_1035372423 9 Left 1035372413 7:158387844-158387866 CCCGCCTCTGAATTCCCAGCCCA 0: 1
1: 0
2: 6
3: 42
4: 513
Right 1035372423 7:158387876-158387898 CTGCAGATGTCAGACCCGCCAGG No data
1035372414_1035372423 8 Left 1035372414 7:158387845-158387867 CCGCCTCTGAATTCCCAGCCCAC 0: 1
1: 0
2: 2
3: 48
4: 380
Right 1035372423 7:158387876-158387898 CTGCAGATGTCAGACCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035372423 Original CRISPR CTGCAGATGTCAGACCCGCC AGG Intronic
No off target data available for this crispr