ID: 1035373395

View in Genome Browser
Species Human (GRCh38)
Location 7:158393038-158393060
Sequence CCTTCTCTGCAGCAGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 402}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035373395_1035373410 22 Left 1035373395 7:158393038-158393060 CCCTGTGCCTGCTGCAGAGAAGG 0: 1
1: 0
2: 5
3: 53
4: 402
Right 1035373410 7:158393083-158393105 CTCTGCACCCCAGGTGGCCCTGG 0: 1
1: 0
2: 2
3: 55
4: 431
1035373395_1035373406 13 Left 1035373395 7:158393038-158393060 CCCTGTGCCTGCTGCAGAGAAGG 0: 1
1: 0
2: 5
3: 53
4: 402
Right 1035373406 7:158393074-158393096 TCCAGGGGCCTCTGCACCCCAGG 0: 1
1: 0
2: 6
3: 51
4: 397
1035373395_1035373402 -4 Left 1035373395 7:158393038-158393060 CCCTGTGCCTGCTGCAGAGAAGG 0: 1
1: 0
2: 5
3: 53
4: 402
Right 1035373402 7:158393057-158393079 AAGGAAGGGGAGTCCTTTCCAGG 0: 1
1: 0
2: 3
3: 17
4: 224
1035373395_1035373408 16 Left 1035373395 7:158393038-158393060 CCCTGTGCCTGCTGCAGAGAAGG 0: 1
1: 0
2: 5
3: 53
4: 402
Right 1035373408 7:158393077-158393099 AGGGGCCTCTGCACCCCAGGTGG 0: 1
1: 0
2: 2
3: 36
4: 321
1035373395_1035373403 -3 Left 1035373395 7:158393038-158393060 CCCTGTGCCTGCTGCAGAGAAGG 0: 1
1: 0
2: 5
3: 53
4: 402
Right 1035373403 7:158393058-158393080 AGGAAGGGGAGTCCTTTCCAGGG 0: 1
1: 1
2: 3
3: 11
4: 217
1035373395_1035373404 -2 Left 1035373395 7:158393038-158393060 CCCTGTGCCTGCTGCAGAGAAGG 0: 1
1: 0
2: 5
3: 53
4: 402
Right 1035373404 7:158393059-158393081 GGAAGGGGAGTCCTTTCCAGGGG 0: 1
1: 0
2: 4
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035373395 Original CRISPR CCTTCTCTGCAGCAGGCACA GGG (reversed) Intronic
900134002 1:1106397-1106419 TATTCTCAGCAGCATGCACAAGG - Intronic
900339565 1:2181558-2181580 CCATCTCTGCAGCTGGCACGTGG - Intronic
900526375 1:3130819-3130841 TCTTTTCTGCTGCCGGCACACGG + Intronic
900529473 1:3145613-3145635 ACATCTCTGCAGGAGGCTCATGG - Intronic
900649176 1:3722671-3722693 GCCTCTCTGCACCTGGCACAGGG + Intronic
900649184 1:3722700-3722722 ACCTCTCTGCACCTGGCACAGGG + Intronic
900933005 1:5748343-5748365 CCTTGTCTTCAGCGTGCACAGGG - Intergenic
900965342 1:5953503-5953525 TCCTCTCTCCAGCAGGAACACGG + Intronic
901025365 1:6276232-6276254 CCTCCGCTTCAGCAGACACACGG + Intronic
901251913 1:7785049-7785071 CCTTCCCTGGAGCAGGGAAAGGG + Intronic
901335281 1:8443920-8443942 CCATCTCTGCAGCAGGCTTCTGG - Intronic
903546846 1:24129690-24129712 CCTTCTCTTTTTCAGGCACATGG + Intronic
904474844 1:30758011-30758033 CCTTCTCTGCACCAGGGCCAGGG + Intergenic
905777532 1:40678681-40678703 CCGACTCTGGAGCAAGCACAGGG - Intergenic
906023590 1:42653972-42653994 GCTTCTCTGAAGGAGACACATGG + Exonic
906150513 1:43584738-43584760 ACTGCTCTGCGGCAGCCACAAGG + Intronic
907567246 1:55446860-55446882 CCTGCTATGCACCAGGCACTAGG + Intergenic
907827256 1:58030699-58030721 CCTGCTCTCTTGCAGGCACAAGG - Intronic
908395330 1:63720100-63720122 CCTTCTGTTCACCAGGCAGATGG + Intergenic
909519362 1:76548923-76548945 CCTGCTATTCATCAGGCACAGGG - Intronic
909838339 1:80286111-80286133 CACTCTCACCAGCAGGCACAAGG - Intergenic
910108743 1:83659390-83659412 CCTTCTAAGCAGAAGGCACTGGG + Intergenic
910466379 1:87504737-87504759 CCTACCCTGCACCAGGCACTAGG - Intergenic
913529056 1:119720440-119720462 CCTTCCCTGTATCAGGGACAGGG + Intronic
914449010 1:147774056-147774078 CCTTCTACGCATCAGGCACTGGG + Intergenic
915138746 1:153752893-153752915 CCTTGTCGGGAGGAGGCACACGG - Intronic
915162945 1:153932644-153932666 CCAGCTCTGCAACGGGCACATGG - Exonic
916683065 1:167121683-167121705 CCTTCCCTGCAGCATACCCAAGG + Intronic
917681937 1:177376285-177376307 TCTTCTCTGCAGCATGAAAATGG - Intergenic
918388576 1:184036313-184036335 CCCTCCCCGCAGCAGACACAGGG + Intronic
919131510 1:193456652-193456674 TCTTCTCTGCAGCTGTCTCAGGG - Intergenic
919755572 1:201064156-201064178 CCTCCTCTGCACCAGGCCCTGGG + Intronic
919989344 1:202698325-202698347 TCTGCTCTTCAGCGGGCACAGGG - Intronic
920334433 1:205235141-205235163 CCTTATATGAAGCAGGCAGAGGG + Intronic
920536776 1:206742612-206742634 CCTTCTCAGCAAAAGCCACACGG - Intergenic
920703372 1:208234393-208234415 CATTTTCTGCAGCAGGCTCTTGG + Intronic
920949774 1:210561524-210561546 CCTTCTAGGCACCAGGCAGATGG - Intronic
922564055 1:226589753-226589775 GGTCCTCTGCAGCAGGGACAGGG - Intronic
922678567 1:227570117-227570139 CTTTCTGTGGAGCAGGCACTAGG + Intronic
923350637 1:233101889-233101911 TCTACTCTACAGCAGGCAGAAGG - Intronic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
1063458312 10:6200712-6200734 CTTGCTCTGCAGCAGGCAAAAGG - Intronic
1063662973 10:8046527-8046549 CCTTCTCGGCAGCAGCCGCTAGG - Intergenic
1064406542 10:15069342-15069364 TCCTCCCTGCAGCAGCCACAGGG + Intronic
1064716288 10:18180251-18180273 GCTTCTCTGCAACAGACAGAGGG + Intronic
1067054726 10:43043982-43044004 CCTTCTCTGCAAAAGCCCCAAGG + Intergenic
1067448385 10:46366895-46366917 CCTTCTCCCCAGCAGGCATTTGG + Intergenic
1067452621 10:46391638-46391660 CCTTCTGTGCTGCATGCAGAGGG - Exonic
1067584611 10:47468117-47468139 CCTTCTGTGCTGCATGCAGAGGG + Exonic
1067588990 10:47493871-47493893 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1067636115 10:48001962-48001984 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG + Intronic
1067764086 10:49072220-49072242 CCAGCTCTACAGCAGGCACAGGG - Intronic
1069818136 10:71211578-71211600 CCTTCCCTGTGCCAGGCACAGGG - Intergenic
1069838840 10:71326720-71326742 CCTTCCCAGCTGCAGGCACTTGG + Intronic
1070132675 10:73665967-73665989 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1071479844 10:86056928-86056950 CCAGCTCTGCAGGAAGCACAAGG - Intronic
1071523915 10:86347266-86347288 GCTTCTCTGCCACAGGCACTTGG - Intronic
1071609009 10:87018107-87018129 CCTTCTCCCCAGCAGGCATTTGG + Intergenic
1072546785 10:96446209-96446231 CCTTCTCTGCATCAGCACCAAGG + Intronic
1072922245 10:99585969-99585991 CCTTCCCTGCAGCATGCTGATGG + Intergenic
1073119445 10:101112641-101112663 GCTTCTGTGCAGGAGGCACGTGG - Intronic
1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG + Intronic
1074611430 10:115025720-115025742 CCTTATCTGTACCAGGCACATGG - Intergenic
1075418458 10:122282987-122283009 CCTTCTCAGCAGCCTGCACCTGG - Intronic
1075632358 10:124008457-124008479 CCTTCTCTATAGCCGGCACTGGG - Exonic
1076242866 10:128923058-128923080 CCATCTCTTCAGCAGGCAGTGGG + Intergenic
1076495635 10:130895878-130895900 CCTTCCCTGCCGCTTGCACAAGG + Intergenic
1076563792 10:131384730-131384752 CCTTCGCTCCAACACGCACAGGG + Intergenic
1076586193 10:131549273-131549295 CCTTCTGTGCAGCAGGTCCTGGG - Intergenic
1076616804 10:131760466-131760488 TCTTCTCTGCTCCAGACACATGG + Intergenic
1076809977 10:132881420-132881442 CCTCCTTTCCAGCAGGGACATGG - Intronic
1076844292 10:133061468-133061490 CCGTCTCTGCAGCCGGCACCCGG - Intergenic
1077338235 11:2014832-2014854 CCTTCTCTGCCCTAGGCCCAGGG + Intergenic
1077341306 11:2027599-2027621 ACAGCTCTGCAGCAGGCACCTGG + Intergenic
1078062784 11:8059221-8059243 CCTTCTCTGTAGCAGGCTCAGGG + Intronic
1078423643 11:11232265-11232287 CCTACTATGCACCAGGCACTAGG + Intergenic
1078436590 11:11330562-11330584 CCATCCCTGCAGCTGGCAGAGGG - Intronic
1079146619 11:17858024-17858046 TGTTCCCTGCAGCAGGCACAGGG - Intronic
1079251288 11:18790105-18790127 CCCTCTCTGCACCAGGCATCAGG + Intronic
1079259424 11:18864039-18864061 GATGCTCTGCAGCAGGGACAGGG + Intergenic
1079326597 11:19498175-19498197 TCTTCTCTGGAGGAGCCACATGG - Intronic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1083759452 11:64807721-64807743 CATTCCCTGAAGCAGGCACAGGG - Intronic
1084297851 11:68224844-68224866 GCTCCTCAGCAGCAGGCACCCGG + Intergenic
1084455666 11:69266816-69266838 CTTTCTCTGCACCAGGTGCAGGG - Intergenic
1084492026 11:69484097-69484119 CCTTCCCTGGAGCTGACACAGGG - Intergenic
1084937551 11:72595231-72595253 CCTTCTCTGCTGAGGGCAAAGGG - Intronic
1085021521 11:73213187-73213209 CCTTCTACGCTGCAGTCACATGG - Intergenic
1085055003 11:73398293-73398315 GCCTGTCTGCAGCAGGCACAGGG + Intergenic
1085358962 11:75868148-75868170 GTTTTTCTGCAGCAGTCACATGG + Intronic
1086060591 11:82695886-82695908 CCTTCCCTGCAGCATCCACCCGG - Intergenic
1086925196 11:92632555-92632577 ACTTCTCTTCTGCAGGCAGAAGG + Intronic
1087144833 11:94800972-94800994 CCATCTCTGAACCAGGAACAGGG - Intronic
1088783760 11:113162353-113162375 CCTACACTGCAGCAGGCACCTGG - Intronic
1089011724 11:115137051-115137073 GCTTCTCTGCAGGTGGCCCAGGG - Intergenic
1090936789 11:131350209-131350231 CCTCCCCTCCACCAGGCACATGG + Intergenic
1202821219 11_KI270721v1_random:70014-70036 CCTTCTCTGCCCTAGGCCCAGGG + Intergenic
1202824291 11_KI270721v1_random:82788-82810 ACAGCTCTGCAGCAGGCACCTGG + Intergenic
1091744230 12:2981080-2981102 CCCACTCTGCATCAGGCACTGGG - Intronic
1094852008 12:34386528-34386550 GCTTCTCTGGATCAGGCCCACGG - Intergenic
1096185957 12:49580700-49580722 CCTTTCCTGCAGAAGCCACAAGG - Intronic
1096453938 12:51769964-51769986 CCTTCTGTGAAGCAGGCATCTGG - Exonic
1096803940 12:54128746-54128768 CCCTCTCAGCAGTAGGCACAAGG - Intergenic
1097018666 12:56004874-56004896 CCTTTTGTCCAGCTGGCACAGGG - Exonic
1097137600 12:56871672-56871694 TCTTCTCCGTGGCAGGCACAGGG - Intergenic
1097637845 12:62144114-62144136 CCTTCTCTGCAGGAAACAAATGG + Intronic
1098544584 12:71697439-71697461 CCTGCTCTGCTGGAGACACATGG + Exonic
1098568897 12:71967227-71967249 CCTTCTTCTCTGCAGGCACAAGG + Intronic
1101289899 12:103357496-103357518 CCTTGCCTGCAGCAGACAGATGG - Intronic
1101599996 12:106201030-106201052 CTTTCTCTGCACCCAGCACAGGG + Intergenic
1102222415 12:111203587-111203609 CCCACTCTGCTCCAGGCACATGG - Intronic
1102251304 12:111389411-111389433 TCCTCTCTGCTGCAGCCACATGG - Intergenic
1103009764 12:117449149-117449171 CCTTCTATGCAGTGGGCACAGGG - Intronic
1103136333 12:118511014-118511036 CCTACTATGCACCAGGCACAAGG - Intergenic
1103447277 12:121002349-121002371 GGTTCTCAGCAGCAGGCCCAGGG - Exonic
1103949976 12:124545268-124545290 CCACCTCCGCAGCAGGCCCAGGG + Intronic
1104461772 12:128962174-128962196 CCCTCACTGGAGCACGCACACGG - Intronic
1104483327 12:129127932-129127954 GCTTCTGTGCAGCTGTCACATGG + Intronic
1104592786 12:130098163-130098185 CAGGCACTGCAGCAGGCACAAGG - Intergenic
1104849420 12:131864224-131864246 CCTACTCTGTTCCAGGCACAGGG + Intergenic
1104880362 12:132066786-132066808 ACTTCTCAGCTGCAGGCGCAAGG + Exonic
1104946724 12:132417929-132417951 CCTGCTCTGCTGCAGACACTTGG + Intergenic
1105356149 13:19661817-19661839 CCTTCTCTGCAGCATGAATGAGG - Exonic
1105557645 13:21461305-21461327 CCTTCTCGGCAGAAGGCAAAGGG - Intergenic
1105968076 13:25402921-25402943 CCATCTTTGAAGCAGACACAGGG - Intronic
1107416446 13:40205710-40205732 CTGTCTATGCAGCAGACACAAGG - Intergenic
1107600978 13:42012172-42012194 CCTTCTCTGCGGCCAGCCCAAGG + Intergenic
1108416027 13:50199051-50199073 TCTTCTCTGCTGCAGGCTCCTGG + Intronic
1110063769 13:71074381-71074403 CCTTCTATGCTGTATGCACATGG + Intergenic
1113344635 13:109465285-109465307 GCTTTTCTGCAGCATGCACATGG - Intergenic
1113442305 13:110338660-110338682 CCATCTCTGCAGCTGGGAAAAGG + Intronic
1114649222 14:24273005-24273027 CCTTCTTTGCAGTAGGCACAGGG - Intergenic
1117564505 14:56979195-56979217 CCTTCTCTGTGGCACGCACTTGG + Intergenic
1118849596 14:69573592-69573614 CCTTCTCTTCTTCAGGCACTGGG + Exonic
1119643898 14:76334879-76334901 GCTGGTCTGCAGCAGGGACAGGG + Intronic
1121007573 14:90500145-90500167 CTTTCTCTGCACCAGGCACTGGG - Intergenic
1122082930 14:99279149-99279171 CTCTCACTGCAGCAGCCACAGGG + Intergenic
1122129854 14:99598644-99598666 CTCTCTGGGCAGCAGGCACAGGG + Intronic
1122247832 14:100416825-100416847 ACTTTTCTGTAGCAGGCACTTGG + Intronic
1122483717 14:102064308-102064330 CCTTCTCTGGATCAGGCACCAGG + Intergenic
1122838571 14:104443368-104443390 CCTGCTCTGCAGCTGCCACTGGG - Intergenic
1123965335 15:25450172-25450194 TCTTCTCTGCTGGAGTCACATGG - Intergenic
1124434204 15:29634153-29634175 CCTCCCCTACAGCAGGCACTTGG - Intergenic
1124636358 15:31367279-31367301 ACCTCTCTGCAGCAGGCTGAGGG + Intronic
1128345379 15:66849690-66849712 CAGTCTCTGCAATAGGCACAGGG - Intergenic
1128346281 15:66854509-66854531 CCTCCTCTGTTGCAGGCACAGGG - Intergenic
1128633958 15:69291125-69291147 CCTCCTCTGCAGCAGGCTGGAGG - Intergenic
1130948294 15:88565991-88566013 CTGACTCTGCAGCAGGCACTGGG + Intergenic
1132057090 15:98660476-98660498 CCTCCTATGCACCAGGCACTGGG - Intronic
1132892344 16:2210492-2210514 CCTCCTCAGCACCAGGGACATGG - Intronic
1133056040 16:3145906-3145928 CCCTCTCTGCAGCCGGCCCCCGG + Exonic
1133738552 16:8633777-8633799 CCTTCTCTGCATGAGGCACTGGG - Intronic
1133899349 16:9958873-9958895 CCTTCTGTACAGCCAGCACAAGG - Intronic
1133964831 16:10523177-10523199 CCTTCCCTGCAGCCAGGACATGG + Intergenic
1134452885 16:14374158-14374180 CCCACTCTGCACCAGGCCCAAGG + Intergenic
1135380281 16:21990345-21990367 CCTTCTCTGATGCATGCACTGGG + Intronic
1135732619 16:24907331-24907353 CCTACTGTGTACCAGGCACAGGG + Intronic
1136013424 16:27379499-27379521 CCCTCCCTGCAGAAGCCACATGG - Intergenic
1137534097 16:49304490-49304512 CCCTCTCTGCACCAACCACATGG + Intergenic
1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG + Intergenic
1139291559 16:65863212-65863234 CATTCTCTGTAGCAGGCAGTAGG - Intergenic
1140886616 16:79249901-79249923 CCTGCTTTGCATCAGGCACTGGG - Intergenic
1141039046 16:80655784-80655806 CCTTCTCTCCAGGAGACGCAGGG + Intronic
1141064730 16:80904803-80904825 CCTGCTCTGCCCCATGCACAGGG - Intergenic
1141103994 16:81218169-81218191 CATTTTCTGCAACAGCCACACGG + Intergenic
1141827905 16:86493874-86493896 ACTTCTCTGCACCCGGCACTGGG + Intergenic
1141940861 16:87275087-87275109 CCTTCTCAGCAGCACCCAGATGG + Intronic
1142016771 16:87753031-87753053 CCTTCCCTGGAGCAGGGACAAGG + Intronic
1142185089 16:88691090-88691112 CCTCATCTGCCGCAGGCCCAAGG - Intergenic
1142348534 16:89569469-89569491 CCTTCTCTGGAGGTGGCCCAGGG + Intergenic
1142667308 17:1470397-1470419 CCTGCTCTGCAGCCCCCACAAGG + Intronic
1143334760 17:6163876-6163898 CCTTCTGTGGAGCAGGCACCAGG + Intergenic
1143660611 17:8322370-8322392 CCCTGACTGCAGGAGGCACAGGG + Exonic
1143682551 17:8488124-8488146 CCTGCTCTGGAGCAGGCAGATGG + Intronic
1144678292 17:17175722-17175744 CCTGAGCTGCAGCAGCCACATGG - Intronic
1144771351 17:17761404-17761426 CCTACTCTGTGCCAGGCACAGGG + Intronic
1146145665 17:30414019-30414041 CTGGCTCTGCAGCAGACACATGG - Intronic
1146268627 17:31470008-31470030 CCTGCTCTGTGTCAGGCACATGG - Intronic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1147481744 17:40771795-40771817 CCTCCTCTAGAGCATGCACATGG + Exonic
1148884813 17:50764728-50764750 CCTGCTTTGCACCAGGCACTGGG + Intergenic
1149651008 17:58276449-58276471 CCTTCTCTGCAGGGGCCAGAGGG + Intronic
1150212671 17:63450001-63450023 CCTTCTCTGTGCCAGGCACTAGG + Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1150611810 17:66739441-66739463 CCTGCTCTGCACCAGGCACTGGG + Intronic
1151777026 17:76211778-76211800 CCTTCTCTGCATCATGCAGGAGG - Intronic
1152432237 17:80254997-80255019 CCTTCCAGGAAGCAGGCACAAGG + Intergenic
1152784909 17:82242493-82242515 CCTGCCCGGCAGCAGGCCCAGGG + Intronic
1152812273 17:82387539-82387561 TTTTCACTGCTGCAGGCACAGGG + Intergenic
1155280914 18:24238743-24238765 TCTTCTCTGCTCCAGACACATGG + Intronic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1157449047 18:47772035-47772057 CCTGCTCTGCCCCAGGCCCAAGG + Intergenic
1157689928 18:49673221-49673243 CCTTCTCTGGGGCAGACATAAGG + Intergenic
1158524222 18:58197881-58197903 CCTTCCCTCAAGCAGGCTCAGGG - Intronic
1159584409 18:70269899-70269921 CTTTCTCCTCAGCAGGCAGATGG + Intergenic
1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG + Exonic
1161258901 19:3324744-3324766 CTCTCTCTGCTGCAGCCACACGG + Intergenic
1161273138 19:3401294-3401316 TCCTCCCTGCAGCAGGCAGAGGG - Intronic
1161503913 19:4633762-4633784 ACATCTTTGCAGGAGGCACAGGG - Intergenic
1161767569 19:6215910-6215932 CCTTTTCCCCAGGAGGCACAGGG - Intronic
1163795577 19:19335949-19335971 CCTGCCCTGCAGCAAGCTCAAGG + Intronic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165418265 19:35708536-35708558 CCTTCTCTTCAGCACTCATATGG - Intronic
1165434621 19:35789213-35789235 CCTTCTCTCCTGCAGGCACCCGG - Intergenic
1166696901 19:44856989-44857011 CCTTCCCTGGAACTGGCACAAGG + Intronic
1166745184 19:45138500-45138522 CATTCTGGGCTGCAGGCACAGGG - Exonic
1167169170 19:47819850-47819872 CCTTCCCTGCTGCAGGGCCAGGG + Intronic
1167199264 19:48052912-48052934 CTTTCTCTGCAACAGGCAGGAGG - Intronic
1168200815 19:54814196-54814218 TTTTCTCTGCAGCAGGCAGTGGG - Exonic
1168270223 19:55245750-55245772 TCTTCTCTGCACCGGGCACTGGG + Intronic
1168426630 19:56244438-56244460 CCTTCCCTGCACCAGTCACGAGG - Intronic
1168538317 19:57190559-57190581 CCTTCTGTGCAGCAAGCAGCAGG + Intergenic
1168578432 19:57533499-57533521 CCCTCTCTGCTGGAAGCACAAGG + Intronic
924979842 2:209658-209680 CCCTCCCTGCCCCAGGCACAGGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926064938 2:9831067-9831089 TCTTCTCTCTAGCAGGAACATGG + Intergenic
927875518 2:26652931-26652953 TCTTCACTGCTGCAGGGACAGGG + Intergenic
928143638 2:28752084-28752106 CCTTCCCAGCAGCGGGAACAAGG - Exonic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
930439798 2:51391271-51391293 CCTTCCCAGCAGCAGCTACATGG - Intergenic
930747510 2:54900272-54900294 GCTTCTGTGTGGCAGGCACAGGG + Intronic
931722552 2:65078004-65078026 CCCTGTCAGCAGCAGGCCCAGGG + Intronic
931891229 2:66674788-66674810 CCTTCTGTGGAGCAGGCATTGGG + Intergenic
932343845 2:70983048-70983070 CCTTCCTTCCAGCAGGCACTGGG + Intronic
933165563 2:79070918-79070940 CCTTGTCTTCAGCAGCCACAAGG + Intergenic
933168671 2:79100681-79100703 CCATCACTCCAGAAGGCACAGGG - Intergenic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
934655514 2:96115155-96115177 CCCCCGCTGCAGCAGCCACAGGG - Exonic
935492748 2:103740736-103740758 CCTGCTCTGCATCAAGCACAAGG + Intergenic
938152468 2:128899398-128899420 GCTTCTCAGCAGGATGCACAGGG + Intergenic
940346659 2:152636008-152636030 CCTTATCTGCAGCAAGCCTAAGG - Intronic
941367759 2:164627760-164627782 ACTTCTCTGCATCAAGAACAAGG - Intergenic
941759814 2:169229426-169229448 CCTTCCCTGGAGCAAGGACAAGG + Intronic
942015929 2:171815192-171815214 TCTTCTCTGCAGCAGTCTCCTGG - Exonic
942982745 2:182101814-182101836 CCTTCCCTTCAGCAGTAACAGGG - Intronic
943728570 2:191277763-191277785 CCTTCTCAGCTGCAGGTACAGGG - Intronic
944061431 2:195573064-195573086 CCTACTCTGAATCAGTCACATGG + Intergenic
944140040 2:196446226-196446248 TCTTCTCTTCAGTATGCACATGG + Intronic
945049429 2:205809103-205809125 CCTTCTCAAAAGCAGCCACATGG + Intergenic
945445981 2:209939250-209939272 CCTTCTGTAAAGCAGGCAGAAGG + Intronic
946144047 2:217715224-217715246 CTTCCTCTACAGCAGGCCCATGG + Intronic
946176425 2:217924623-217924645 CCTACTATGCACCAGGCACTGGG + Intronic
946370731 2:219279783-219279805 CCTTCTCTTCTGCAGCCCCAAGG + Exonic
948311926 2:236993899-236993921 TCTTTCATGCAGCAGGCACAGGG - Intergenic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1169026009 20:2372121-2372143 ACTTCTCAGCTGGAGGCACAGGG - Intergenic
1169100002 20:2939366-2939388 CATTCTCTGCAGCTGTAACATGG + Intronic
1169436162 20:5593547-5593569 CCTACTCTGTAGCAGGCAATGGG + Intronic
1170593794 20:17790757-17790779 CCCTCTCTGCCACTGGCACAGGG + Intergenic
1171115798 20:22523909-22523931 CCTTCCCTGGAGCAGGCTGAAGG + Intergenic
1171284387 20:23925137-23925159 CCTTCTCTGCATCATGCATCTGG + Intergenic
1171284779 20:23928211-23928233 ACTTGCCTGCAGGAGGCACAAGG - Intergenic
1171350734 20:24501313-24501335 TATCCTCTGCAGCATGCACAGGG + Intronic
1172628329 20:36361519-36361541 TCTTCTCTGCAGCAGCCAGAAGG - Intronic
1172876896 20:38169873-38169895 CCGTCCCTGCAGCCGGCACGGGG + Intergenic
1173200325 20:40949974-40949996 CTTTTCATGCAGCAGGCACAGGG - Intergenic
1173384094 20:42572421-42572443 CCTTCTCTGCTGTGGCCACATGG + Intronic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1173793740 20:45844306-45844328 CATTCTCTGCAGCTGGCTCAGGG + Exonic
1173925581 20:46778783-46778805 CCTCCTCTGCACCAGGCATTGGG + Intergenic
1175503842 20:59468443-59468465 CATGCTCTGCCACAGGCACAAGG - Intergenic
1175795018 20:61765897-61765919 CCTTCCCTGGAGCAGTCACCTGG + Intronic
1175930106 20:62489863-62489885 CCTTCTCTGCAGCCTGCGCTGGG + Intergenic
1176100026 20:63360647-63360669 CCTTTTCTGCAGGAAGGACAAGG - Intronic
1176103801 20:63376418-63376440 CTTCCTCTGCAGCAGGGACTGGG - Intronic
1176162881 20:63657511-63657533 CCTTCACCACAACAGGCACATGG + Intergenic
1176285497 21:5016923-5016945 TCCTCTCAGCAGCAGGCACTGGG + Intergenic
1176511871 21:7754834-7754856 CCTATTCTGCAACAGGCACGAGG - Intronic
1178409380 21:32350906-32350928 CCTCAGCTGCTGCAGGCACAGGG - Exonic
1178645984 21:34385360-34385382 CCTATTCTGCAACAGGCACGAGG - Intronic
1178931136 21:36820219-36820241 CCTCCGCTGCAGCTGGCACGGGG - Intronic
1179608018 21:42530820-42530842 CATTCTCTGCAGCAGGTACGTGG - Intronic
1179871684 21:44246552-44246574 TCCTCTCAGCAGCAGGCACTGGG - Exonic
1181855276 22:25777038-25777060 TCTACTATGCAGCAGGCACTCGG - Intronic
1182713941 22:32340317-32340339 CCTTCTGTGCACAAGGCACTGGG + Intergenic
1182859799 22:33549197-33549219 TCTTCTCTGCACCATGCACTGGG - Intronic
1182933160 22:34194286-34194308 ACTTCTCTGCAGCTTTCACACGG - Intergenic
1183619631 22:38964953-38964975 CCTTCCCTCCAGCTGGCCCAGGG + Intronic
1183697527 22:39431584-39431606 CCTGCTCTGCCGCAGGAAAATGG - Exonic
1183796862 22:40126185-40126207 GCCTCTGTGCAGCAGGAACAGGG - Intronic
1183976086 22:41513131-41513153 CCCTCTCTGCAGCAGGGTTAGGG + Intronic
1184401253 22:44275901-44275923 CCTTCTGTGCACAAGGCACGGGG + Intronic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
1185388287 22:50546558-50546580 CCGGCGCTGCAGCAGGGACAGGG - Intergenic
949930901 3:9077688-9077710 CCTGCCCTGCAGCCAGCACAGGG + Intronic
951810836 3:26697837-26697859 CCTTCTATGTACAAGGCACAGGG - Intronic
951926251 3:27911897-27911919 CCTACTATGTATCAGGCACAGGG - Intergenic
952496930 3:33924281-33924303 TCTTCTCTGGGGCAAGCACAGGG + Intergenic
953025762 3:39144004-39144026 CCCTCCCTGCAGCAGCCACAGGG + Exonic
954535210 3:51354757-51354779 CCTTCTCTGTATCAGGCCCTGGG - Intronic
954962750 3:54580641-54580663 TATTTTCTGCAGCAAGCACAGGG - Intronic
955158211 3:56438485-56438507 CCTTCTGTGCAGCAAGCAGCAGG + Intronic
955867356 3:63399212-63399234 CCCTCAATGCAGCAGGCACTGGG - Intronic
956426778 3:69144469-69144491 TTTACTATGCAGCAGGCACAAGG + Intergenic
957542812 3:81596787-81596809 CCTACCCTCCAGCAGTCACATGG + Intronic
957912180 3:86634358-86634380 CATACTCTGCAGTGGGCACAAGG + Intergenic
958892578 3:99796814-99796836 CCTTCTCTGTACCAAGCACTGGG + Exonic
960148237 3:114226052-114226074 CCTGTCATGCAGCAGGCACATGG + Intergenic
961435375 3:126912905-126912927 CCTTCCCTGCAGAAGGCCGAGGG + Intronic
961455659 3:127022693-127022715 CCAGCTGTCCAGCAGGCACAGGG - Intronic
961551958 3:127674450-127674472 CCCTCTCTCCAGCACTCACAAGG - Exonic
967438380 3:189477785-189477807 CCCTCTCTGCGGCAGGGCCAAGG - Intergenic
967969388 3:194987959-194987981 TCTTCTCTACATCAGACACACGG + Intergenic
968120351 3:196121531-196121553 CCATCTCTCCAGCAGGCAGGAGG + Intergenic
968576974 4:1371500-1371522 CCTTATCAGCAGCAGGAAAACGG - Intronic
969046581 4:4340878-4340900 CCTACTTGGCAGCAGCCACATGG - Intergenic
969267327 4:6073154-6073176 CCTTCCCTCCAGCAGGCAGCAGG + Intronic
969267338 4:6073194-6073216 CCTTCCCTCCAGCAGGCAGCAGG + Intronic
969420881 4:7095123-7095145 CTTTCTTGGCAGCAGCCACATGG + Intergenic
969875206 4:10131227-10131249 CCTTCTCTGCACCAGGCTCCGGG - Intergenic
969932371 4:10643207-10643229 CTTTCTCTGCAGCCATCACAGGG - Intronic
970307363 4:14747581-14747603 CCTTCTCTGTTTCAGGAACATGG + Intergenic
970814445 4:20137560-20137582 CCTTATCTCCAGTAGCCACAGGG + Intergenic
971257053 4:25024182-25024204 CCTGCTTGGCACCAGGCACAGGG - Intronic
974476075 4:62382306-62382328 CCTTATCAGCAGCAGGAAAAAGG - Intergenic
977025927 4:91819968-91819990 CCTTATCAGCAGCAGGAAAATGG - Intergenic
977656123 4:99522740-99522762 CCTTGTTTGCAGGAGGCATAAGG - Intronic
978312564 4:107401237-107401259 CCTAATTTGCAGCATGCACATGG - Intergenic
979010852 4:115366299-115366321 CCTTCTCTTCACCAGCAACATGG - Intergenic
980556325 4:134410293-134410315 TTTTCTCTGCTCCAGGCACATGG + Intergenic
981421500 4:144555559-144555581 CCATCTCTTCTGCAGCCACATGG + Intergenic
982091892 4:151887233-151887255 CCTTCTCTGCATCTGGCAGCTGG - Intergenic
983542295 4:168924933-168924955 CCTTTTCTCCAGCATGCACCAGG + Exonic
984076943 4:175195071-175195093 CTTTCTGTGCAGCAGGCAGCAGG + Intergenic
985559223 5:574070-574092 CCTGCTCTGGAGGATGCACAGGG - Intergenic
985591713 5:768925-768947 CCTCCTCTGCAACACGGACATGG + Intergenic
985609629 5:879884-879906 CCTCCTCTGCAACACGGACATGG + Exonic
985639478 5:1056998-1057020 GCCTCACTGCAGCAGGCAGATGG - Intronic
985679494 5:1248574-1248596 CCATGGCTGCATCAGGCACATGG - Intergenic
985868890 5:2538327-2538349 CCTCCTCTGCAGCCTGCTCAAGG + Intergenic
986481463 5:8192782-8192804 CTTTCTGTGCAGCAAGCACCAGG - Intergenic
987709830 5:21492669-21492691 CCGAGTCTGCAGCAGGCAGAAGG + Intergenic
988749783 5:34181494-34181516 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
990530647 5:56670015-56670037 GCTTTTCTGCACCATGCACAAGG - Intergenic
990848475 5:60173096-60173118 GTTTCTCTCCAGTAGGCACATGG + Intronic
991012800 5:61901388-61901410 CCTTCTCTGCATCAGGGAAATGG + Intergenic
991405334 5:66295620-66295642 CCATCTCTGAAGCCAGCACAAGG - Intergenic
991738042 5:69644698-69644720 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991760152 5:69911726-69911748 CCGAGTCTGCAGCAGGCAGAAGG + Intergenic
991787180 5:70206374-70206396 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991789618 5:70224424-70224446 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991814367 5:70499534-70499556 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991817502 5:70520826-70520848 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991839383 5:70786777-70786799 CCGAGTCTGCAGCAGGCAGAAGG + Intergenic
991879626 5:71206764-71206786 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
991882066 5:71224793-71224815 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
992583321 5:78204771-78204793 CCTTCTCTGCCTCAGTGACAGGG - Intronic
992612012 5:78516032-78516054 CCTTCTCTTCAGAAGACAAAAGG + Intronic
992891126 5:81205304-81205326 GCTTCTCTTAAGCAGGCTCAGGG - Intronic
994460578 5:100064764-100064786 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
994484728 5:100378175-100378197 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
995023069 5:107388138-107388160 CCTCCTCTGCTGCAGGAAAAGGG + Intronic
996220030 5:120919889-120919911 CCTCTCCTGCAGCAGGCACATGG - Intergenic
999019489 5:148147752-148147774 CCTTCTCTAAAGCTTGCACAAGG + Intergenic
999128064 5:149261316-149261338 CCTTTACTGCAGCAGGATCATGG - Intergenic
999135729 5:149317639-149317661 CCTTCTTTCCAGCAGACACATGG + Intronic
999261358 5:150240873-150240895 CCTTCTTTCCAGCAGGGAGAGGG - Intronic
1001294305 5:170488351-170488373 CCTCATCTGCACCAGGCATAAGG - Intronic
1001723190 5:173873453-173873475 CCTGTTCTGCCACAGGCACAAGG - Intergenic
1001970339 5:175950185-175950207 CCTCCTCTGAAGCTGGCCCATGG + Intronic
1002054842 5:176592884-176592906 GCTTCTCTGCACCAGGCCCCAGG + Intronic
1002247100 5:177893576-177893598 CCTCCTCTGAAGCTGGCCCATGG - Intergenic
1002394992 5:178945801-178945823 CCTTCCCTGCATCTGGAACACGG - Intronic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1002696091 5:181092177-181092199 CCTCCTCCACATCAGGCACAGGG + Intergenic
1003254615 6:4464012-4464034 CCTTCACTGCAGAAACCACAAGG + Intergenic
1003570133 6:7250564-7250586 CATACACTGCAGCAAGCACAGGG - Exonic
1004171667 6:13300066-13300088 CCTGCACTGCAGTAGACACAAGG + Intronic
1005547850 6:26887837-26887859 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
1005700042 6:28391562-28391584 TCTTCTCTGGAGCAAGCAGAGGG + Exonic
1006058208 6:31401084-31401106 CCTTTGCTGGAGCTGGCACACGG + Intronic
1006070593 6:31495295-31495317 CCTTTGCTGGAGCTGGCACACGG + Intronic
1006255638 6:32830086-32830108 CCACCTGTGCAGCAGGGACAGGG + Exonic
1006471882 6:34234257-34234279 CCTACTCTGTAGCAGGAACTGGG - Intergenic
1007224687 6:40304688-40304710 CATACTCTGCAGCAGGGTCATGG + Intergenic
1007652077 6:43429092-43429114 CCTTCTCAGCAACACACACAAGG - Intronic
1009018610 6:57928918-57928940 CCGAGTCTGCAGCAGGCAGAAGG - Intergenic
1009705077 6:67239256-67239278 CCTACTGGGCACCAGGCACAGGG + Intergenic
1010029389 6:71257361-71257383 CCGCATCTGCAGCAGGCAGAAGG + Intergenic
1010927663 6:81763447-81763469 CCTTCTAGGCATCAGGCCCATGG + Intergenic
1011245890 6:85320958-85320980 CCTTCTCTGCAGCTGACCCTGGG - Intergenic
1011284252 6:85706547-85706569 TCTGCTCTGGAGCAGGTACAGGG + Intergenic
1011416965 6:87132073-87132095 ACTTCACTTCAGCAGGCAAAAGG - Intergenic
1011720327 6:90149643-90149665 CCTTCTCTCCATCATGCACAGGG - Intronic
1011725524 6:90206568-90206590 CCATCCCTGCAGCATGAACAAGG - Exonic
1015513721 6:134064286-134064308 CCTGCATTGCACCAGGCACATGG - Intergenic
1017212328 6:151870752-151870774 CCTTCTGTGCACCATGCACTGGG - Intronic
1018156857 6:160992548-160992570 CATTCTCTGGAGCGGGCAAAAGG - Intronic
1018340846 6:162849420-162849442 CTTTCTCAGCAGCAGGCACTGGG - Intronic
1018369972 6:163158764-163158786 CTCACACTGCAGCAGGCACAGGG + Intronic
1019191803 6:170255714-170255736 CCTTCTCTGCAGTGGTCACAGGG + Intergenic
1019408583 7:896957-896979 CCTTGCTGGCAGCAGGCACAGGG - Intergenic
1019463906 7:1175952-1175974 TCTTCCCCGGAGCAGGCACACGG - Intergenic
1020130451 7:5556225-5556247 CCTGGCCTGCAGCAGGCAGAGGG - Intronic
1021347610 7:19547701-19547723 TCTTCTCATCAGGAGGCACAGGG + Intergenic
1022969769 7:35506058-35506080 CTTACTCTGCAGCAGGCACCAGG + Intergenic
1022971277 7:35519717-35519739 CCTTATCTGTGCCAGGCACAGGG - Intergenic
1024087895 7:45911858-45911880 CCTTCTCTGCTCCAAGCAGAAGG - Intergenic
1025927734 7:65972884-65972906 CCAAGTCTGCAGCAGGCAGAAGG - Intronic
1026207057 7:68267015-68267037 CCTTCCCTGCCCCATGCACAGGG - Intergenic
1028450532 7:90977251-90977273 CTTTCTGTGCAGCAGGCAAATGG - Intronic
1029600130 7:101558533-101558555 CCCTCTCTGCAGCTTGCAAAGGG - Exonic
1029982382 7:104890931-104890953 CCTACTCTGTTGCAGGCACGAGG - Intronic
1030289351 7:107856914-107856936 CCTTCCCTGGAGCAGGCTCTCGG + Intergenic
1031614741 7:123867152-123867174 CTTTCTCTGCAGCAAGCAACAGG - Intronic
1031965539 7:128025648-128025670 CCTCCTCTGTAGCAGGCACTTGG - Intronic
1032153592 7:129450760-129450782 CCTTCTCTGCAGCCTATACAGGG + Intronic
1032153870 7:129452699-129452721 CCTTCTCTGCAGCCCATACAGGG + Intronic
1032443332 7:131959173-131959195 CCTTCTGGGCTTCAGGCACAGGG - Intergenic
1033032688 7:137843156-137843178 TCTTCTATGCAACAGGCACTGGG - Intronic
1034593304 7:152162967-152162989 TCTTCTGTGAAGCAGGGACATGG - Exonic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1036008344 8:4692623-4692645 CCTTGTCTGCTGCAGCCTCACGG - Intronic
1037062295 8:14529464-14529486 CTTTCTTTGCAACAAGCACAGGG + Intronic
1037750935 8:21682007-21682029 CCCACTCTGCTGCAGCCACAGGG - Intergenic
1037836490 8:22217681-22217703 CCTACTATGCACCAGGCACCTGG - Intergenic
1038493744 8:27987620-27987642 CCTTCTCTGCAGCTGTTGCAGGG - Exonic
1039822507 8:41146368-41146390 CCTTATCTGCAGAAAGCACAAGG - Intergenic
1040525583 8:48221282-48221304 ACTTCTCTGGAGAAGGCATATGG + Intergenic
1040974291 8:53172768-53172790 CCTACTCTGTGCCAGGCACAGGG + Intergenic
1041904090 8:63012805-63012827 CCTTCTGTGCACCAGGCTCCAGG + Intergenic
1043369189 8:79571553-79571575 CCTTCTCTGGGGCACGCACTGGG - Intergenic
1043483753 8:80678798-80678820 CCTTTTCTGCACCATGCTCAGGG + Intronic
1043525839 8:81095712-81095734 CCTAGTATGTAGCAGGCACAGGG - Intronic
1043684384 8:83068287-83068309 CCTTCTCTGTAGCAGAAAAAAGG + Intergenic
1046584992 8:116140278-116140300 CCTTCTCTGAAGAATGCACTTGG - Intergenic
1047071463 8:121348801-121348823 CTCTCTCTGCAGCTGGCACGTGG - Intergenic
1047998863 8:130360010-130360032 ACTTCTGTGTAGCAGGCCCAAGG - Intronic
1049350312 8:142160796-142160818 CCTCCTCTGCACCAGGCAACGGG - Intergenic
1049508684 8:143017315-143017337 CTGTCTCTGCAGCCGGCACCTGG - Intergenic
1049551037 8:143259938-143259960 CCTTCTGTGCAGCAGGCTCCTGG + Intronic
1049775447 8:144401789-144401811 CCCTCTCTGCAGCAGGGAGAAGG + Intronic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1050625600 9:7500785-7500807 CCTTCTCTGCTGCAGAGACCCGG - Intergenic
1051259787 9:15251916-15251938 CCTACTATGCACCAGGCACAGGG + Intronic
1052989942 9:34513201-34513223 CCTTCTAAGGAGCTGGCACAGGG - Intronic
1056539010 9:87555358-87555380 CCTTCTCTGTCACAGACACAAGG + Intronic
1056795164 9:89654100-89654122 CCTTCCCTGCTGCAGCCACCCGG - Intergenic
1056929488 9:90862238-90862260 CCCTTCGTGCAGCAGGCACAGGG - Exonic
1057933725 9:99218987-99219009 CCTTCTGTACACCAGGCATATGG - Intronic
1059172154 9:112135792-112135814 CCTTTTCTGCACTAGGCACAGGG + Intronic
1059742084 9:117161680-117161702 CCTCCTCTTCAGCCTGCACAGGG - Intronic
1059871563 9:118584027-118584049 GCTTATCTCCAGCAGGCAGATGG - Intergenic
1060497487 9:124129303-124129325 CCTGCTCTGCAGCAGAAAGAGGG + Intergenic
1060773965 9:126355391-126355413 GCTACACTGCAGCAGGCCCAGGG + Intronic
1060795656 9:126510908-126510930 CCTTCTCTGGAGCGGGCACAGGG + Intergenic
1061087194 9:128405983-128406005 CCTTCTCAGCAGCAGGAGCTGGG + Intergenic
1061200121 9:129133178-129133200 CCTTCCCTGAGGCAGGCAGATGG + Intronic
1061389600 9:130310111-130310133 CCTACTCAGAAGCAGGCAGAGGG - Intronic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1185463249 X:341882-341904 TCTTCTCAGGAGCAGTCACACGG - Exonic
1189462045 X:41250783-41250805 CCTTTTCTGGTGCAGGCACGTGG + Intergenic
1192436928 X:71148737-71148759 GCTGCTCTGCAGGCGGCACATGG - Intronic
1193896927 X:87126445-87126467 CATTCTTTGCAGCAGCCACGTGG + Intergenic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic
1195314606 X:103665615-103665637 CTCTGCCTGCAGCAGGCACAGGG + Intergenic
1197285740 X:124593212-124593234 CCCTCTCTGCTGCATGCCCAGGG - Intronic
1198405144 X:136304896-136304918 TCTTCTTTCCAGTAGGCACAAGG - Exonic
1198522768 X:137469665-137469687 TCTTCTCTGCTACAGCCACAGGG - Intergenic
1199838693 X:151620959-151620981 CTTTCTCTTCATCAGGCAGAAGG - Exonic