ID: 1035374103

View in Genome Browser
Species Human (GRCh38)
Location 7:158395939-158395961
Sequence CTCTGTGACCAGGGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035374103_1035374115 18 Left 1035374103 7:158395939-158395961 CCCTCTGCCCCCTGGTCACAGAG 0: 1
1: 0
2: 0
3: 37
4: 300
Right 1035374115 7:158395980-158396002 CCCAGTCCCGCCGCGACCCATGG 0: 1
1: 0
2: 0
3: 7
4: 126
1035374103_1035374118 20 Left 1035374103 7:158395939-158395961 CCCTCTGCCCCCTGGTCACAGAG 0: 1
1: 0
2: 0
3: 37
4: 300
Right 1035374118 7:158395982-158396004 CAGTCCCGCCGCGACCCATGGGG 0: 1
1: 0
2: 0
3: 1
4: 44
1035374103_1035374117 19 Left 1035374103 7:158395939-158395961 CCCTCTGCCCCCTGGTCACAGAG 0: 1
1: 0
2: 0
3: 37
4: 300
Right 1035374117 7:158395981-158396003 CCAGTCCCGCCGCGACCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035374103 Original CRISPR CTCTGTGACCAGGGGGCAGA GGG (reversed) Intronic
900462917 1:2809978-2810000 CACTGTGACCAAGGAGCAGTGGG - Intergenic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
900996134 1:6124611-6124633 CTGTGTGAGCCGGGGGCGGATGG - Exonic
901651398 1:10745152-10745174 CTCTGTTTCCTTGGGGCAGAGGG - Intronic
903126929 1:21254696-21254718 CTCTGAGGCCAGGAGGCTGAGGG - Intronic
903360053 1:22771443-22771465 GGCTGTGTCCAGTGGGCAGAGGG + Intronic
903885799 1:26540365-26540387 CTGTGTGACCAAGGGGCTTAAGG - Intronic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905890028 1:41513089-41513111 TTCTCTTCCCAGGGGGCAGAGGG + Exonic
906157792 1:43624106-43624128 CTGTGTGTCCAGGGGCCAGATGG - Intergenic
906193189 1:43912126-43912148 CTAGGTGAGCAGGGGACAGATGG + Intronic
906346613 1:45019511-45019533 CTCTCTGACCTGGGGAAAGAAGG - Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
906975792 1:50571386-50571408 CTGTGTGACCATGGGGCAAATGG + Intronic
908107366 1:60858906-60858928 CTTTTTTAACAGGGGGCAGAGGG + Intergenic
910500443 1:87883955-87883977 CTCTGTGTAAAGGGGTCAGAGGG + Intergenic
911939938 1:104031788-104031810 CTTTGTGTCCAGGGTGCAGCTGG - Intergenic
915342876 1:155185788-155185810 ATCTGTGACCCGTGGGCAGCAGG - Intronic
916039589 1:160950800-160950822 CTCTGGGATCAGTAGGCAGATGG + Intronic
917371849 1:174301480-174301502 CTCTGCCAGCAGAGGGCAGAGGG + Intronic
917680888 1:177366182-177366204 CTCTTTTACCATGAGGCAGAGGG + Intergenic
918234781 1:182570188-182570210 CTCTGTGAACAGAAAGCAGAGGG - Intergenic
919765616 1:201125408-201125430 CTCTGTGAACATGGGCTAGAGGG - Intronic
919814761 1:201430349-201430371 AGCTGGGACCAGGGGGCATAGGG - Intergenic
920166797 1:204041747-204041769 CTCTGTCCCCAAGGTGCAGAGGG + Intergenic
920243779 1:204573049-204573071 CTCTGTGTTCAGGGGACAGTGGG + Intergenic
922240363 1:223751572-223751594 CTCTCTGTCCACGGAGCAGAAGG - Intronic
922724639 1:227917269-227917291 CTCTGTGCCCAGGCGGGAGGGGG - Intergenic
922777028 1:228219553-228219575 CTGTGAGGCCAGGGGACAGAGGG + Exonic
922803892 1:228375996-228376018 CTGTGTGGCCAGGCGGCAGCTGG + Exonic
922902625 1:229148414-229148436 CTTTGTGCCCAGGGAGCAGCTGG - Intergenic
923333178 1:232944638-232944660 CTATGTGGCAAGGGTGCAGATGG - Intergenic
923549955 1:234955598-234955620 CCCTGGGGGCAGGGGGCAGAGGG + Intergenic
1064910304 10:20394147-20394169 CTCTGGGACCAGGTGGCAGGTGG - Intergenic
1066438037 10:35412181-35412203 TCCTGTGACTAGGGGGCAGAGGG + Intronic
1067275181 10:44827712-44827734 CTCTCTGGCCAGGGGCCAGGGGG + Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1068859367 10:61830948-61830970 TTCTGTGACCTGGTGGCGGAAGG - Intergenic
1068921822 10:62493028-62493050 CTTTTTGACCACGGGGAAGAAGG + Intronic
1069960026 10:72074005-72074027 CTCTGGGAGCTGGGGGGAGAGGG + Intronic
1070244802 10:74720834-74720856 CTCTTAGACCTGGGAGCAGAAGG - Intergenic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1070590567 10:77797743-77797765 CACAGGGACCAGGAGGCAGAAGG + Intronic
1070703609 10:78621186-78621208 TTCTGTTACCAGTGGGAAGATGG - Intergenic
1073012357 10:100371407-100371429 CTCTGTGGCCAGGGTGTAGCTGG - Intergenic
1073098600 10:100995607-100995629 CTCTGTGAACTGGGGATAGAGGG + Intergenic
1073438281 10:103535701-103535723 CTCTGGCCCAAGGGGGCAGAAGG + Intronic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1075068482 10:119305296-119305318 CTCAGAGACCTGGGGGAAGATGG + Intronic
1075081064 10:119384222-119384244 CTCTGAGAACAGGGGACAGAAGG - Intronic
1075900351 10:126038072-126038094 CTCTGTGATCTGGGGCCAGAGGG - Intronic
1076783412 10:132736917-132736939 CTGAGGGATCAGGGGGCAGAGGG - Intronic
1077484046 11:2830766-2830788 CTCTGTGGCCAGGGTGCTGGAGG - Intronic
1078480200 11:11668790-11668812 CTCTGGGACCATGGGGAAGATGG + Intergenic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1080034072 11:27693068-27693090 CACTGTGACCAGGATGCATAGGG - Intronic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1081676009 11:44969749-44969771 CTCTCTCACCAGGTGGGAGAGGG + Intergenic
1083381030 11:62268690-62268712 ATCAGAGACCAGAGGGCAGATGG - Intergenic
1084355113 11:68633347-68633369 CTGTGTGTTCACGGGGCAGAAGG + Intergenic
1084464217 11:69312944-69312966 CACAGTGACCAGGGCACAGAAGG - Intronic
1084491910 11:69483577-69483599 GTCTGTGACCCGGGCTCAGAGGG + Intergenic
1085255443 11:75170077-75170099 ATGTGTGAGCAGGGGGCTGAGGG - Intronic
1085387891 11:76167646-76167668 CACTGTGACCACGGGACAGGTGG + Intergenic
1088172801 11:107017734-107017756 CTCGGTGAGCGGGGGGCGGAAGG - Exonic
1088895195 11:114073127-114073149 CTGGGTGACCAGGGGGCTCATGG + Intronic
1089836681 11:121376517-121376539 ATCTGGGGCCAGGTGGCAGAAGG - Intergenic
1091342007 11:134823311-134823333 CCCAGGGACAAGGGGGCAGAGGG + Intergenic
1091843648 12:3638206-3638228 GTCTCTGACCAGGGGGTACAGGG - Exonic
1092200927 12:6582231-6582253 TTATGTGAGCCGGGGGCAGATGG - Exonic
1092204216 12:6606076-6606098 CTCCGTGCCCAGGAGGCACATGG + Intronic
1097106683 12:56630093-56630115 GTCTGTGGCCAGGGGCCTGAGGG - Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1102152759 12:110699957-110699979 CTCTTGGACCAGGAGGAAGAAGG - Intronic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1104155627 12:126128610-126128632 CACTGTCACCAGGGGTCAGCAGG - Intergenic
1104299534 12:127551670-127551692 CTGTGATACCAGGGTGCAGAGGG + Intergenic
1104481685 12:129113319-129113341 CTTTCTGTCCAGGGGGCAGATGG + Intronic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106145260 13:27044418-27044440 CTGTCTGACCAGGGTGCAGCAGG - Intergenic
1106699106 13:32209889-32209911 GCCTGTGTCTAGGGGGCAGAAGG - Intronic
1113882309 13:113634136-113634158 CTCTGTGTCCGGCTGGCAGACGG + Intronic
1114268808 14:21089113-21089135 CTCTGTGTCCAGGAAGCAGAGGG - Exonic
1115906536 14:38208886-38208908 CTCTGAGAGCAAGAGGCAGATGG + Intronic
1117119311 14:52551945-52551967 ATCTGTGAGCAGGGGGAAGCTGG - Intronic
1117311158 14:54524634-54524656 CTTTGTGAGCCTGGGGCAGAAGG - Intronic
1120698709 14:87674018-87674040 GTGTGGGACCAGGGGGCACATGG - Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121302192 14:92880725-92880747 CAATGTGACCAGGAGGCAGGTGG - Intergenic
1121583887 14:95049750-95049772 CTCTTGAACCTGGGGGCAGATGG - Intergenic
1121625680 14:95384076-95384098 CTCTGGGACAAGGGGACAGGAGG + Intergenic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1122048768 14:99041291-99041313 CTGGGTGTCCAGGGGTCAGATGG - Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1129175386 15:73836210-73836232 CTTTGTCAGCATGGGGCAGAAGG + Intergenic
1129217234 15:74107351-74107373 GGCTGTGACCAGGGTGCAGGTGG + Intronic
1129248595 15:74295591-74295613 CCCGGTGAGCAAGGGGCAGATGG + Intronic
1129297663 15:74608804-74608826 CTCTGTCACCAGCTGGCTGAGGG - Intronic
1130907493 15:88251000-88251022 CCCTGAGCCCAGGGTGCAGATGG + Intronic
1131887054 15:96927350-96927372 CCATGTGACCAGGGGGTTGAAGG + Intergenic
1132679737 16:1134818-1134840 CTCTGTGTGCAGGTGGCAGCGGG - Intergenic
1132812472 16:1807949-1807971 CTATAGGACCAGGTGGCAGAGGG + Exonic
1132847157 16:2005917-2005939 CTCTGAGGCCAGGGAGCAGCTGG + Intronic
1132948683 16:2547804-2547826 CTCTGAGCCCCAGGGGCAGAAGG + Intronic
1132965904 16:2654323-2654345 CTCTGAGCCCCAGGGGCAGAAGG - Intergenic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133210249 16:4259791-4259813 CTCTGTAACCAGGGGGCTCTGGG + Intronic
1133236011 16:4387758-4387780 CTCTGCTACCAGGGGCCAGAGGG + Intronic
1133246928 16:4455226-4455248 CTCTGTGACCATGGGCAAGCCGG - Intronic
1133537420 16:6715326-6715348 TTCTGGGACCAGGGTGCGGAGGG + Intronic
1134090114 16:11387047-11387069 CCCTGTGCCCAGGAGGCAGGGGG + Intronic
1135081255 16:19437949-19437971 CTCTGTGGCCAGGGGGATGGTGG + Intronic
1137982070 16:53078416-53078438 CTGTGTCATCAGGTGGCAGAAGG - Intronic
1138542469 16:57696631-57696653 CTCTGTGACCACAGGACATATGG + Intronic
1141059435 16:80852430-80852452 GTCTGCCACCAGGGGGCAGGTGG - Intergenic
1141581581 16:85003130-85003152 CTCAGAGTCCAGGGGGCAGGAGG + Intronic
1142488237 17:260485-260507 CACTGTCTCCAGGGGACAGAGGG + Intronic
1143572835 17:7771257-7771279 ATCTGGGAACAGGGAGCAGAGGG + Intronic
1143586844 17:7854697-7854719 CTCTCTGCCCCAGGGGCAGAGGG + Exonic
1143594565 17:7906581-7906603 CTGTGTGAGCCTGGGGCAGACGG + Exonic
1143673539 17:8413367-8413389 CTCTGTGCCCATGAGGCAGGCGG + Intronic
1144493912 17:15735469-15735491 CCCTGTGACCAGGGCACAGCGGG - Intronic
1144906349 17:18641210-18641232 CCCTGTGACCAGGGCACAGCGGG + Intronic
1144962267 17:19051589-19051611 CACTGGGAGCTGGGGGCAGAGGG - Intergenic
1144972894 17:19122931-19122953 CACTGGGAGCTGGGGGCAGAGGG + Intergenic
1146208134 17:30922196-30922218 GTCTGGGTCCAGGGGGCCGAGGG - Intronic
1146948684 17:36891037-36891059 TTATGTGGCCAGGGGGCAGGGGG + Intergenic
1147125068 17:38361755-38361777 ACCTGTGAACAGGGGGCTGAAGG - Exonic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150655705 17:67038047-67038069 CACGGTGACCAGCGTGCAGAGGG - Intergenic
1151309830 17:73286209-73286231 GTCGGTGACCAGGGGGGAGCGGG - Exonic
1151409747 17:73914394-73914416 CTTTGTGCCCAGTGGGCAAAAGG - Intergenic
1151700580 17:75740613-75740635 ATCTGTTTCCAGAGGGCAGAAGG + Intronic
1152621786 17:81368541-81368563 CTCTGTGCCCAGTGGGCCCATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156396690 18:36705541-36705563 CTCTGCCACCAGTGGGCACAGGG - Intronic
1157305105 18:46511347-46511369 CCCTGTGAACCAGGGGCAGAAGG - Intronic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1162857195 19:13477902-13477924 CTCTGAGCCCAGGGGGCCCATGG - Intronic
1162958353 19:14112299-14112321 CTCCCTGGCCAGGGGGCAGAAGG - Intronic
1163637479 19:18444056-18444078 CTCAGAGCCAAGGGGGCAGAGGG - Exonic
1164536422 19:29089316-29089338 CTCTTTGATCAGGGGTGAGAGGG - Intergenic
1164881007 19:31732849-31732871 CTCTGTGAGCATGGGGCAGCTGG + Intergenic
1165959013 19:39519059-39519081 CTCTGTGCCCAGAGGGGTGATGG + Exonic
1166110158 19:40617177-40617199 CTCTGTGACCAGGGTTACGAGGG + Exonic
1167695579 19:51013952-51013974 CTCTAAGACCAGAGGGCCGAGGG - Exonic
1167708291 19:51094802-51094824 CTCAGAGACCAGCGGGCAGGTGG + Intergenic
1167710763 19:51109079-51109101 CCCTGTGTCTAGGGTGCAGACGG - Intergenic
1167785025 19:51629485-51629507 CTCGGGGTCCAGGGGGCTGAGGG + Exonic
1167787126 19:51645909-51645931 CTCGGGGTCCAGGGGGCTGAGGG + Exonic
925831980 2:7904587-7904609 CTGTGTGAGCAGGGGACAGAGGG - Intergenic
925983197 2:9193438-9193460 CTCTGGGAACACGGGGCTGAGGG - Intergenic
930191341 2:48463244-48463266 CCCAGTGATCAGGAGGCAGAGGG + Intronic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
936273129 2:111067914-111067936 GTCAGTGGCCAGGGGCCAGATGG + Intronic
936956765 2:118030216-118030238 CTCTTTGAGCAGGGGGCGGTGGG - Intergenic
937293951 2:120798692-120798714 CTCTGTGAGGAGGGGCCAGCTGG + Intronic
938422618 2:131156596-131156618 CCCTGTGAGGTGGGGGCAGAAGG + Intronic
939332076 2:140777268-140777290 CTCTGTGAGCTAGGGGCAAAGGG - Intronic
940146630 2:150552086-150552108 CTTTGTTACAAGGTGGCAGATGG - Intergenic
940594603 2:155773962-155773984 CTCTGTGTACAGGGGTCATATGG - Intergenic
942571966 2:177323938-177323960 TTCTGAGACGATGGGGCAGAAGG - Intronic
943689549 2:190855441-190855463 CTCTCTCACTAGAGGGCAGAAGG - Intergenic
944191680 2:197010287-197010309 CTCGGTGACCGTGGGGCTGAGGG - Intronic
946879778 2:224164961-224164983 CTCAGAGACCAGGGGTGAGAAGG - Intergenic
947372761 2:229465415-229465437 CAATGGGACCAGGGGGCTGAGGG + Intronic
948467713 2:238160108-238160130 CACTGTCAGCAGGAGGCAGACGG + Intronic
1169801480 20:9516136-9516158 CTCCGAGCCCAGCGGGCAGAGGG + Intronic
1170405376 20:16030003-16030025 CTCTCTGACAAGGCTGCAGAGGG + Intronic
1170569540 20:17625106-17625128 CTCTGTGAGAAGGGGGCAGGAGG + Intronic
1170606095 20:17876021-17876043 GTCTGTGCCCAGGGGGAAGCAGG + Intergenic
1171459148 20:25288766-25288788 CTTTGTGCCCAGTGGGCACAGGG + Intronic
1171879176 20:30604021-30604043 CTCTGTGACCAGGAAGCCTAAGG + Intergenic
1174340051 20:49889946-49889968 CCTGGTGACGAGGGGGCAGACGG - Exonic
1175515668 20:59568384-59568406 CTCTGTGCCCAGGTGGAGGAGGG + Intergenic
1175920980 20:62450589-62450611 GACTGTGCCCAGGGGGCAGGCGG + Intergenic
1177081096 21:16639421-16639443 CTATGTCAGCAGGGGGCAGGGGG - Intergenic
1178538728 21:33431652-33431674 CACTTGGACCAGGAGGCAGAGGG - Intronic
1180010058 21:45043613-45043635 CTCTGAGACCTGGGGGAACAGGG + Intergenic
1180096672 21:45558509-45558531 GGCTGTGACCAGGCTGCAGAGGG + Intergenic
1180874857 22:19170432-19170454 CTCTCTCACTAGGCGGCAGAGGG + Intergenic
1180928571 22:19573482-19573504 CTGTGTCCCCATGGGGCAGAAGG + Intergenic
1180959022 22:19754390-19754412 CCCTGGGACCAGGGAGCAGATGG + Intergenic
1180985311 22:19900868-19900890 CTCTGGGAGCAGGGGGCAAAGGG - Intronic
1181339417 22:22166140-22166162 CCCAGTGAGCAGGGGACAGAGGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183436378 22:37797929-37797951 CTCTGTGAGGACGGGGCAAACGG - Intergenic
1183705704 22:39473867-39473889 GTGTGTGGGCAGGGGGCAGATGG + Intronic
1184019234 22:41809428-41809450 CTCTGTGACCAGTGCTCTGATGG + Intronic
1184578768 22:45397983-45398005 CTCTGCCAGCAGAGGGCAGAGGG - Intronic
1184597899 22:45525491-45525513 CTCTGTGCGCAGGGGGCCCAGGG - Intronic
1184718851 22:46297299-46297321 CTCTGTGAGCCGAGGGCTGAAGG + Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950120747 3:10480999-10481021 CTCTGAGACTAGGTGGCAGGCGG - Intronic
950367328 3:12496860-12496882 ATCTGTGCCCACCGGGCAGAAGG - Intronic
950728452 3:14935172-14935194 CTCTGTGCCCAGTGAGCAGAGGG - Intergenic
953090971 3:39725880-39725902 CTCTGTGTCCGGGGGAAAGAGGG - Intergenic
953432347 3:42850552-42850574 CTGTGTGTCAAGGGGGCAGTGGG + Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954283624 3:49602247-49602269 CTCTGTGTCCCTGGGGCAGCAGG + Intronic
954608888 3:51933893-51933915 CTGTGTCACCAGGTGGCAGGAGG - Intronic
955066999 3:55542377-55542399 CTCTGTGAAAAGAGTGCAGAAGG + Intronic
955216614 3:56989516-56989538 GTCTGTGCCCAGGGGGCAGGGGG + Intronic
959292791 3:104495690-104495712 ATCTGTGGCCAGGGAGCAGAAGG - Intergenic
959582978 3:108000938-108000960 TTCTGTGTCAAGGGGGAAGAAGG - Intergenic
960992490 3:123321086-123321108 CTCTGAGCCCAGGGTGCAGGAGG - Intronic
961450781 3:127001421-127001443 CTCTGCTACCAGGGGCAAGAGGG + Intronic
961457035 3:127029426-127029448 GTCTGTCACCTGTGGGCAGAGGG - Exonic
961643064 3:128376910-128376932 CTCTGTCACCTGGGGGAAGAAGG + Intronic
961934154 3:130565414-130565436 CTCTATGCCCAGGGTGAAGATGG - Exonic
962733037 3:138300302-138300324 CTCTGTGCTCAGGGGACACACGG - Intronic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
964330086 3:155592582-155592604 CTCTCTGACCAAAGGGCAGTCGG + Intronic
964949084 3:162265101-162265123 CTCAGTGAGCAGGGGGTGGAAGG - Intergenic
966080025 3:175989388-175989410 CTCAGTGACCTGGGCACAGAAGG - Intergenic
968248131 3:197176224-197176246 GTGTGTGAGCAGGGGGCATATGG - Intronic
968487102 4:867995-868017 CTCTGGGAACAGGCGGCAGAAGG + Intronic
968801776 4:2747577-2747599 CTCTGTGATCAGGGGCCTGTAGG + Intronic
968881577 4:3302933-3302955 GTCTGTGACCCCGGGGCAGCTGG + Intronic
968913196 4:3486031-3486053 CTCGGTGGCCCGGGGGCAGCTGG + Intronic
969703118 4:8778581-8778603 CTCTCTGACCAGGGGCCACAGGG + Intergenic
970672305 4:18410918-18410940 AGCTGTGACCAGAGGGCAGTTGG + Intergenic
971995294 4:33956454-33956476 CTCAGTGATCTGGGTGCAGAAGG - Intergenic
972256012 4:37356352-37356374 ATCTATGACCTGGGGACAGATGG - Exonic
973709549 4:53614804-53614826 CTCCATGACCAGGAGGCTGAAGG - Intronic
975043172 4:69769646-69769668 CTCTGTGACCAAGAAGCAGCCGG + Intronic
976772823 4:88672866-88672888 CACTGTGACTAGCAGGCAGATGG - Intronic
977959637 4:103071412-103071434 CTCTGTCACCAGGCTGAAGAGGG + Intronic
981001096 4:139829914-139829936 CTCTGTGACAATGGGTCAGATGG + Intronic
981643856 4:146975676-146975698 CTCTGAGACCAGATGGCAGATGG + Intergenic
982093470 4:151899557-151899579 CTCTGGGACATGGAGGCAGAGGG - Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
986136308 5:4982355-4982377 GTCTGTGTGCAGGGGGCAGGCGG + Intergenic
987061357 5:14246928-14246950 CTCAGTGAGCAGGGTGGAGAGGG - Intronic
988485651 5:31666188-31666210 CTCTTTGACCAGGGAGGAGAAGG + Intronic
990370570 5:55114310-55114332 CCCTGTGGCCTGGGGGAAGAAGG + Exonic
990982595 5:61615413-61615435 CTGCCTTACCAGGGGGCAGAGGG - Intergenic
992461012 5:76960276-76960298 CTGTGAGAACAGGGAGCAGAGGG + Intronic
994222859 5:97216597-97216619 GTCAGTGACCAGGGAGAAGAGGG - Intergenic
995689232 5:114805030-114805052 CCCTATGACAATGGGGCAGAAGG - Intergenic
997857376 5:137384177-137384199 CTCTGTATACAGGAGGCAGATGG + Intronic
998999378 5:147903164-147903186 TCCTGTGACCAGGGCTCAGAGGG - Intronic
999147705 5:149406874-149406896 CTCTGTGGCCAGGGAGCCGCAGG + Intergenic
999246461 5:150157624-150157646 CTCTGTGAACAGGGGTCTGGGGG - Intergenic
1000463219 5:161547476-161547498 CTCTGGGAATAGGGGGCAAAGGG - Intronic
1000963508 5:167628052-167628074 CTCTGTGTCCAGGCATCAGAAGG + Intronic
1001258547 5:170204985-170205007 CTCTGTGTCCAGGGTTCAGAGGG - Intergenic
1001517513 5:172366245-172366267 CTCTCAGACCCTGGGGCAGAGGG - Intronic
1002423710 5:179163899-179163921 CTCCCTGAGGAGGGGGCAGAGGG + Intronic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1005506939 6:26477687-26477709 CTCTGTCACCAGCAGCCAGAGGG - Intergenic
1005809070 6:29502535-29502557 CTTTGTGCCCAGGAGGGAGAGGG + Intergenic
1006375541 6:33669866-33669888 GTCTGTGAGGAGGAGGCAGAGGG + Intronic
1006457492 6:34140298-34140320 CAACGTGACCAGGGGGCAGTGGG + Intronic
1006736612 6:36278037-36278059 CTCTCTGAAAGGGGGGCAGAGGG - Intronic
1007061409 6:38944224-38944246 CTCTGTCTCCAGGTTGCAGAGGG + Intronic
1007115480 6:39340134-39340156 CTTTGGGACCTGGTGGCAGAGGG + Intronic
1008499252 6:52164380-52164402 CTTTGTGACAAGGAGGAAGAGGG + Intergenic
1010252887 6:73726891-73726913 CTCCTTGACCAGAGGGCACAGGG - Intronic
1012310894 6:97722769-97722791 TCCTGTGACCAGGTGACAGAGGG + Intergenic
1015658548 6:135546902-135546924 CCCTGTGACCAATGGGCGGAGGG + Intergenic
1015894817 6:138007105-138007127 CTCTGCCACGAGGGGGCAGAAGG - Intergenic
1018058317 6:160071026-160071048 CCCTGTGCCCAGGGCCCAGAAGG + Intronic
1018341048 6:162851267-162851289 AGCTGTGGCCAGGGTGCAGAAGG - Intronic
1019170089 6:170128951-170128973 CTCTGTGACCTGGTGACAGCGGG + Intergenic
1019333834 7:473372-473394 CCCTGGGTCCAGGAGGCAGACGG + Intergenic
1019470533 7:1218048-1218070 CTGAGTGCCCAGGGGTCAGAGGG - Intergenic
1019672029 7:2285514-2285536 CTCTGTGGCCAGGGAACAGCAGG + Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022948575 7:35313792-35313814 CTCTGTGTCCAGGGGTTACATGG + Intergenic
1023849428 7:44141798-44141820 CCCTCTGACCAAGGGGCAGAAGG + Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1024757148 7:52547732-52547754 CTCTCTGACCCTGAGGCAGAGGG - Intergenic
1029940098 7:104470940-104470962 CTCTGTGAGCTAGGGGCAGGGGG - Intronic
1030334413 7:108308984-108309006 CTCTCTGTCCTGGGGTCAGATGG - Intronic
1031405530 7:121381176-121381198 GTCTGTGACTAGGAGGAAGAGGG - Intronic
1032019646 7:128400242-128400264 GCCTGTGACCAGGGACCAGAGGG - Intronic
1032388372 7:131539806-131539828 CTCTGAGACCACGGGGTAGAGGG + Intronic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1033684480 7:143625684-143625706 TTCTGTGACCCTGAGGCAGAGGG + Intronic
1033687656 7:143704903-143704925 TTCTGTGACCCTGAGGCAGAGGG + Intronic
1033700131 7:143831939-143831961 TTCTGTGACCCTGAGGCAGAGGG - Intergenic
1034276333 7:149825447-149825469 CTCTGGGAGCAGGAGGCAGCTGG - Intergenic
1034292108 7:149941066-149941088 CTCTGAGCCCAGGGGACAGAAGG - Intergenic
1034535161 7:151721542-151721564 TTAGGTGACCATGGGGCAGAGGG - Intronic
1034747355 7:153534881-153534903 CTCTGTCATCAGGAGGCAGTAGG + Intergenic
1034813965 7:154155831-154155853 CTCTGAGCCCAGGGGACAGAAGG + Intronic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035546104 8:483529-483551 CACTGGGCCCAGGGAGCAGAAGG - Intergenic
1035652780 8:1281461-1281483 GCCTGTGCCCAGGGGACAGAAGG - Intergenic
1036045511 8:5135611-5135633 CTCTGTGCCCAGGCTGCAGTGGG + Intergenic
1036442024 8:8789862-8789884 CTCAGTGGCCCTGGGGCAGAGGG - Intronic
1037528446 8:19750403-19750425 CTCTGTCAGTAGGGGGCAGCGGG + Intronic
1037918196 8:22785526-22785548 ATCTGTGGCCAGGGAGCACATGG - Intronic
1037977037 8:23221077-23221099 CTCTCTGAGCTTGGGGCAGAAGG - Intronic
1038066857 8:23972429-23972451 CTTTGTGGTCTGGGGGCAGAGGG - Intergenic
1042521042 8:69711263-69711285 CTTTGGGACCTGGGGACAGAGGG - Intronic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1049093920 8:140536762-140536784 CTCTGTTGCCAGGAGGCAGGAGG - Intronic
1049460040 8:142722527-142722549 CTCTCTGACCAGGAGGCTGGTGG - Intergenic
1049973782 9:842788-842810 CTCAGGGACCCGGGAGCAGAGGG - Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1051666230 9:19469343-19469365 CTCTGTGACCAATGGGCATGTGG - Intergenic
1053416890 9:37952434-37952456 CACTGTGAGCAGCGGGCAGGAGG + Intronic
1055360817 9:75488567-75488589 CTCTCTGACCAGAGGCCAAAGGG - Intergenic
1055640671 9:78316579-78316601 CTCTGAGACCAGGGAGCCAAGGG + Intronic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057221781 9:93261439-93261461 CACTCTGACCGGGGGCCAGATGG + Intronic
1057228498 9:93304871-93304893 CCCAGTGACCAGTGTGCAGACGG - Intronic
1057265233 9:93613022-93613044 CTCTGTGACCAGGAAGCCTAGGG - Intronic
1059476278 9:114550525-114550547 CACTGTGGCCAGGGGGCAACTGG + Intergenic
1059649236 9:116299741-116299763 CTCTGTGACCTGGAAGCAGATGG + Intronic
1060106087 9:120874468-120874490 CTGTCAGACCAGGGGGCAGGGGG - Intronic
1060224972 9:121784992-121785014 CTCGGTGACCAGGGGGCCCCGGG - Exonic
1061096060 9:128457147-128457169 CTGAGCGACCTGGGGGCAGAGGG - Intronic
1061160545 9:128891591-128891613 GTCTGGGCCCTGGGGGCAGAAGG - Intronic
1061596703 9:131635174-131635196 CTAGGTGACCAGGAGGCAGTGGG - Intronic
1061626656 9:131844382-131844404 CTCGGTGGCCAGAGGGCGGAGGG + Intergenic
1061716332 9:132520778-132520800 CTCCTGGGCCAGGGGGCAGAAGG - Intronic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1062434337 9:136540047-136540069 CTGTGTGACCCTGGGGCTGATGG + Intronic
1062630109 9:137459548-137459570 CTTTGCGACCAGGGGGCCGCTGG - Intergenic
1062722812 9:138053398-138053420 CTCTGTGGTCAGGGGCCTGAGGG + Intronic
1185634164 X:1539081-1539103 CACTGTGACCAGGGGCCTGAAGG - Intergenic
1185669500 X:1794902-1794924 CTCTGTGGCCAGGCGACTGAGGG - Intergenic
1186478545 X:9878189-9878211 GTCTGTGACAAGGTGGCAGGTGG - Intronic
1189044836 X:37579431-37579453 CTAAGTGACCATGGGGCAGGTGG + Intronic
1190220913 X:48511826-48511848 CTCTGAGACCATGGGGGACAGGG - Intronic
1195498657 X:105567995-105568017 CTCTGGGGCCTGGTGGCAGAAGG - Intronic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1199634494 X:149802707-149802729 CTCGCTGACTAGGGGACAGAGGG - Intergenic
1200023630 X:153234631-153234653 CACTGTGACGAGGGAGCAGTGGG - Intergenic
1200210065 X:154343081-154343103 CTCTTTGCCCTGGGGTCAGACGG + Intergenic
1200220787 X:154389011-154389033 CTCTTTGCCCTGGGGTCAGACGG - Intergenic