ID: 1035376723

View in Genome Browser
Species Human (GRCh38)
Location 7:158411433-158411455
Sequence CCGGGCATGTGCAAGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 308}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035376723_1035376732 9 Left 1035376723 7:158411433-158411455 CCTGGGCCCTTGCACATGCCCGG 0: 1
1: 0
2: 3
3: 22
4: 308
Right 1035376732 7:158411465-158411487 TCTGGTCCCCCCAGCACTCACGG No data
1035376723_1035376738 21 Left 1035376723 7:158411433-158411455 CCTGGGCCCTTGCACATGCCCGG 0: 1
1: 0
2: 3
3: 22
4: 308
Right 1035376738 7:158411477-158411499 AGCACTCACGGCTCACCTCCTGG No data
1035376723_1035376727 -9 Left 1035376723 7:158411433-158411455 CCTGGGCCCTTGCACATGCCCGG 0: 1
1: 0
2: 3
3: 22
4: 308
Right 1035376727 7:158411447-158411469 CATGCCCGGCCACCACTCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 140
1035376723_1035376740 30 Left 1035376723 7:158411433-158411455 CCTGGGCCCTTGCACATGCCCGG 0: 1
1: 0
2: 3
3: 22
4: 308
Right 1035376740 7:158411486-158411508 GGCTCACCTCCTGGGAGCCAAGG No data
1035376723_1035376739 22 Left 1035376723 7:158411433-158411455 CCTGGGCCCTTGCACATGCCCGG 0: 1
1: 0
2: 3
3: 22
4: 308
Right 1035376739 7:158411478-158411500 GCACTCACGGCTCACCTCCTGGG 0: 1
1: 0
2: 3
3: 27
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035376723 Original CRISPR CCGGGCATGTGCAAGGGCCC AGG (reversed) Intronic
900246552 1:1638817-1638839 CCAGCCAGGTGCAAGGGCTCAGG + Intronic
900257778 1:1705959-1705981 CCAGCCAGGTGCAAGGGCTCAGG + Intronic
900418130 1:2544316-2544338 CCAGGCATGTGCAGTGGCCTCGG + Intergenic
900660529 1:3780001-3780023 CTTGGCATGTGCAAGGGCGTTGG - Exonic
900850733 1:5140864-5140886 CCTGTCATGGGCAAGGGGCCAGG - Intergenic
901785826 1:11623856-11623878 GAGAGCATGTGCAAAGGCCCTGG + Intergenic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
902602785 1:17551427-17551449 CCAGGCATGTGCCAAGGCTCAGG + Intronic
903020539 1:20390639-20390661 ACGGGCATATACAAGGGCTCAGG + Intergenic
903043939 1:20552409-20552431 CCGCGCCTGTGCAGGGTCCCGGG + Intergenic
903182127 1:21610075-21610097 AGGGGCATCAGCAAGGGCCCTGG - Intronic
903663225 1:24991331-24991353 GATGGCATGAGCAAGGGCCCAGG - Intergenic
904170064 1:28585451-28585473 CCAGGCAAGAGCAAAGGCCCTGG - Intergenic
904392160 1:30193137-30193159 GGGAGCATGTGCAAAGGCCCTGG + Intergenic
904410009 1:30319609-30319631 CTGGGCTGGTGCCAGGGCCCAGG + Intergenic
904463127 1:30692344-30692366 CCAGGCTTGTGCGAGGGCTCAGG - Intergenic
905802787 1:40856118-40856140 CTGGGCATGAGTAAAGGCCCAGG - Intergenic
906803655 1:48759176-48759198 CCGGACACGTGCTATGGCCCAGG + Exonic
909804582 1:79858640-79858662 ATGGACAGGTGCAAGGGCCCAGG + Intergenic
911782741 1:101903245-101903267 CAGGGCATAAGCAAGGGCCTGGG + Intronic
913036367 1:114969905-114969927 CCTGGGAAGTGCAAGGGACCGGG - Intronic
913336127 1:117710311-117710333 CCAGGAATTTGCAAGGGCCCTGG + Intergenic
915560705 1:156685753-156685775 ATGGGCATGTGCATGTGCCCAGG - Intergenic
917962400 1:180155212-180155234 CCGGGCAGGTGGAGGGGTCCGGG - Intronic
922744581 1:228037020-228037042 TCTGGCAGGTGCCAGGGCCCGGG - Intronic
923336524 1:232975702-232975724 CTGGGCAGGTGCAAGGGTTCAGG + Intronic
923684039 1:236142140-236142162 CCGGGGATGGGGAAGGGGCCGGG + Intergenic
923706490 1:236348484-236348506 CCGGGGATGTGGGAGGACCCAGG - Intronic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1062939166 10:1409084-1409106 CAGAGCATGTCCAAGGGTCCAGG - Intronic
1063377122 10:5561157-5561179 CCTGGCATGGGCCAGGGCCTGGG - Intergenic
1063428099 10:5965311-5965333 CCGGGGATGGGCACAGGCCCTGG - Intronic
1065990643 10:31006459-31006481 CCAGGCATGTGGAAGGGGCAAGG - Intronic
1068922684 10:62501299-62501321 AAGAGCATGTGCAAGGGCACTGG - Intronic
1069904914 10:71726524-71726546 CAGGGCAGTTGCAAGGACCCAGG - Intronic
1069943189 10:71969321-71969343 CCAGGCATCTGCAAAGGCCTGGG + Intronic
1070154314 10:73824310-73824332 CCTGGCAGGTGCAGGTGCCCAGG + Intronic
1070846196 10:79524169-79524191 CCGGGCACGTGCCTGTGCCCTGG - Intergenic
1070927602 10:80236141-80236163 CCGGGCACGTGCCTGTGCCCTGG + Intergenic
1071288280 10:84169001-84169023 GCCCCCATGTGCAAGGGCCCTGG - Intergenic
1071565001 10:86667213-86667235 CCTTGCATGTGCCAGGCCCCAGG + Intergenic
1072003653 10:91221099-91221121 CCCGGCAGGTGCGCGGGCCCAGG - Intronic
1072716065 10:97753334-97753356 CCGGGCATCTGCTAGCTCCCCGG - Intronic
1073447732 10:103591319-103591341 CCTGGGATGGGCCAGGGCCCTGG + Exonic
1074703281 10:116110664-116110686 CCAGGCATGTGCTAGGTGCCAGG - Intronic
1075552121 10:123400428-123400450 AAAGGCAAGTGCAAGGGCCCTGG - Intergenic
1076138050 10:128058463-128058485 CCGGGCAGCTGCGTGGGCCCTGG - Intronic
1076197164 10:128527158-128527180 TCCGGCCTGTGCAAGGGCTCCGG + Intergenic
1076407171 10:130220326-130220348 GAGGGCAGGTGCAAGGGCCAAGG + Intergenic
1076509069 10:130999416-130999438 CTGGGCATGGGCATGTGCCCAGG - Intergenic
1076729553 10:132431538-132431560 CGGGCCATGTGCCAGGCCCCAGG + Intergenic
1076904178 10:133354215-133354237 CCAGGCAAGTGCGAGGCCCCTGG + Intergenic
1077377251 11:2210846-2210868 TGGGGCAAGTGCCAGGGCCCAGG + Intergenic
1077530993 11:3094636-3094658 CCTGACATGAGCAAAGGCCCTGG - Intronic
1077655713 11:4017009-4017031 CCTGGCAAGTGCAAGGGGTCAGG - Intronic
1079099776 11:17533919-17533941 CGGGGCTTGTGCAGGGGCCTGGG - Intronic
1079337889 11:19587307-19587329 CCCGGGATGTGCAAGGGGTCAGG - Intronic
1081669433 11:44934849-44934871 CCAGGCATGGGCAGGGCCCCAGG + Exonic
1081669664 11:44935961-44935983 CCGGACATGGGCAGGGGCCAGGG - Intronic
1081911877 11:46705092-46705114 CAGGGCATGGGCAAGGGGCAGGG - Exonic
1083331378 11:61899997-61900019 CCGGGCCTGGGAAGGGGCCCTGG - Intronic
1083680404 11:64349096-64349118 CAGGGCATGAGGAAGGCCCCTGG - Intronic
1084163983 11:67366648-67366670 CCTGGGATAGGCAAGGGCCCAGG + Intronic
1084214465 11:67639949-67639971 CTGGGCATCTGCAGGGGTCCAGG + Intergenic
1084475675 11:69387267-69387289 AATGGCATGTGCAAAGGCCCAGG - Intergenic
1087652881 11:100888769-100888791 CAGGACAGGTGGAAGGGCCCTGG + Intronic
1088702472 11:112425952-112425974 CCTGGGAAGTGCAAGGGGCCGGG + Intergenic
1089215660 11:116833102-116833124 CTGGGCATGGGAAAGGGCCGAGG + Intergenic
1089273366 11:117316144-117316166 GCGGGCAGGGGCAAGGGCTCCGG + Exonic
1089643265 11:119861363-119861385 GCAGGCAAGTGCAAGGGCCCTGG - Intergenic
1091307187 11:134543794-134543816 CCCAGCATGTGCAAAGGCCCCGG - Intergenic
1091322621 11:134662871-134662893 GTGGGCATGTGCAAGGGGGCTGG + Intergenic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1094841608 12:34344744-34344766 CCGTGCATGCGCGAGGTCCCGGG - Intergenic
1094843656 12:34352180-34352202 CCGCGCATGTGCGGGGTCCCAGG - Intergenic
1094872895 12:34607809-34607831 CCGCGCATGTGCAGGGCCCAGGG + Intergenic
1096496825 12:52043531-52043553 CCAGGCCTGGGCACGGGCCCAGG + Intronic
1097262200 12:57726227-57726249 GCGGGCATGTCCAAGCGCCTAGG + Intronic
1097904787 12:64908633-64908655 TAGGGCAAGTGCCAGGGCCCAGG - Intergenic
1099317438 12:81102412-81102434 CTGTGCATGTGCATGGGCGCAGG + Intronic
1101326722 12:103722173-103722195 CGGGGCAGGTGGAGGGGCCCTGG + Intronic
1101565524 12:105901491-105901513 CTTGGCAAGTGCAAAGGCCCTGG + Intergenic
1102648361 12:114418542-114418564 AATGGCATGTGCAAAGGCCCTGG - Intergenic
1103915399 12:124373283-124373305 CAGTGCGTGTGCAGGGGCCCGGG + Intronic
1103915408 12:124373327-124373349 CAGTGCGTGTGCAGGGGCCCCGG + Intronic
1103915419 12:124373372-124373394 CAGTGCGTGTGCAGGGGCCCCGG + Intronic
1103915521 12:124373762-124373784 CAGTGCGTGTGCAGGGGCCCTGG + Intronic
1103915532 12:124373807-124373829 CAGTGCGTGTGCAGGGGCCCTGG + Intronic
1103915555 12:124373894-124373916 CAGTGCGTGTGCAGGGGCCCCGG + Intronic
1103937560 12:124484616-124484638 CCCAGCAGGTGCAAAGGCCCTGG - Intronic
1103941531 12:124503905-124503927 CTGGGCATGTGGGAGGGCCTGGG - Intronic
1104836542 12:131795653-131795675 CTGGGCCTGTGCACAGGCCCTGG + Intronic
1104843473 12:131835312-131835334 CCGGGCTGGTGCTGGGGCCCTGG + Intronic
1105927171 13:25018592-25018614 CCGGGCATGGGCTTCGGCCCAGG - Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1112231544 13:97593115-97593137 CCCGGGAAGTGCAAGGGGCCAGG + Intergenic
1113792162 13:113034699-113034721 CAGGGCAAGGGCAAGGGCGCGGG - Intronic
1113964659 13:114145891-114145913 GGGGGAATGTGCAAAGGCCCCGG - Intergenic
1114484655 14:23055637-23055659 CCGGGCCTGGGCAGGGTCCCGGG - Exonic
1116861815 14:50001441-50001463 CGGGGCATGGGCAGGGGCCAGGG - Intronic
1117515266 14:56494435-56494457 CCTGACATGTGCATGGCCCCAGG + Intronic
1122228447 14:100293007-100293029 CTGGGCCTGTACAAGGGCCTGGG - Exonic
1122325887 14:100880444-100880466 CCGGGCATGGGCTTGGGACCTGG + Intergenic
1124430398 15:29602920-29602942 ACGTGCATGTGCAAAGACCCTGG + Intergenic
1124704206 15:31948080-31948102 TTGGGCATGTGCTTGGGCCCTGG + Intergenic
1125154870 15:36574368-36574390 CCAGGTATGTGCAAAGGCCAAGG - Intergenic
1125330074 15:38573829-38573851 CCAGGGAAGTGCAAGGGGCCAGG - Intergenic
1129255198 15:74330383-74330405 CCGGGCTTCTGCCTGGGCCCAGG + Intronic
1130737543 15:86566059-86566081 CCTGGGAAGTGCAAGGGCTCAGG - Intronic
1131141295 15:89978689-89978711 CTGAGCATGTCCAAGGGCTCAGG + Intergenic
1131522889 15:93129754-93129776 CCTGGCTAGTGCAAGCGCCCAGG + Intergenic
1132644112 16:990907-990929 CCCGGCCTTTGCCAGGGCCCTGG - Intergenic
1132862429 16:2078197-2078219 CAGGGCATGGGCATGGGCCTGGG + Intronic
1132888375 16:2192552-2192574 CAGGGCATGTGGAAAGGCCTTGG - Intronic
1132998853 16:2839105-2839127 CCAGGCATGAGCAAGGTCCTTGG - Intronic
1133185772 16:4097236-4097258 CTGGGAATGTGAATGGGCCCAGG - Intronic
1133855598 16:9546570-9546592 AAGGGCACGTGCAAAGGCCCTGG + Intergenic
1134196664 16:12164172-12164194 AAGGGCATATGCAAAGGCCCTGG + Intronic
1134672335 16:16065051-16065073 AAGAGCATGTGCAAAGGCCCTGG + Intronic
1135463458 16:22664843-22664865 GGGTGCATGTGCAAGGGTCCTGG + Intergenic
1136298073 16:29314853-29314875 CTGGGCATCTCCAAGGGGCCGGG - Intergenic
1136556529 16:31010560-31010582 CCGGGCAGGGGCAGGGGCCTGGG + Exonic
1136723233 16:32339991-32340013 CCAGGTATGTGCTAGGGCCAAGG + Intergenic
1136841554 16:33545995-33546017 CCAGGTATGTGCTAGGGCCAAGG + Intergenic
1137057080 16:35751010-35751032 CCGGGCCTTTGCAAGGGTGCAGG - Intergenic
1137593349 16:49707202-49707224 GAGAGCATGTGCAAAGGCCCTGG - Intronic
1137674496 16:50297627-50297649 CTGGGCAGGTGCAGGGGACCTGG + Intronic
1138436515 16:57003640-57003662 CTGCGCATGTGCAAGGGGTCTGG - Intronic
1140686122 16:77435148-77435170 CCGGGCTGGTGCAAGGGCGTGGG + Intergenic
1141092726 16:81141296-81141318 CCTGGCATGTGCAGGGGCCCAGG + Intergenic
1141138690 16:81483233-81483255 CTGTGCATGTGCAAAGGCCATGG + Intronic
1141138701 16:81483287-81483309 CACAGCATGTGCAAAGGCCCTGG + Intronic
1141622417 16:85243514-85243536 GAGGGCATGTGCAAGGCTCCTGG - Intergenic
1141645935 16:85367622-85367644 AAGAGCATATGCAAGGGCCCCGG + Intergenic
1142038876 16:87880176-87880198 CAGGGGATGTGCAGGAGCCCAGG + Intergenic
1142059719 16:88021358-88021380 CTGGGCATCTCCAAGGGGCCGGG - Intronic
1142075831 16:88117184-88117206 CCGGGGATGTGTGAGGGCCGGGG + Intronic
1142075925 16:88117766-88117788 CCGGTCGTGTGCAAGTGACCTGG + Intronic
1142151416 16:88514237-88514259 CCGGGCAGGTGCTGGGTCCCAGG - Intronic
1203003199 16_KI270728v1_random:177774-177796 CCAGGTATGTGCTAGGGCCAAGG - Intergenic
1203134805 16_KI270728v1_random:1714180-1714202 CCAGGTATGTGCTAGGGCCAAGG - Intergenic
1203151719 16_KI270728v1_random:1846292-1846314 CCAGGTATGTGCTAGGGCCAAGG + Intergenic
1144520839 17:15951373-15951395 CCTGGCCTGTGCATGGGACCAGG - Intronic
1144731068 17:17526615-17526637 ACGGGCATGTGCATGGGCAGAGG - Intronic
1144779560 17:17800987-17801009 CCTGGCATGTGGAAGGGGCTTGG + Intronic
1145904088 17:28506953-28506975 CCAGGCCTCTGCATGGGCCCAGG - Intronic
1145991561 17:29082162-29082184 TCTGGCATGTGCATGGGCACAGG - Intronic
1146407975 17:32556107-32556129 CCTGCCATGTGCAAGGCCCTGGG - Intronic
1147383306 17:40068356-40068378 CCTGGCATGTGCCAGGCCCTGGG - Intronic
1147548898 17:41424264-41424286 CCGGGAATGTGACAGGTCCCTGG + Exonic
1149289241 17:55199916-55199938 CAGGGCATGCGCCAAGGCCCTGG - Intergenic
1152290168 17:79435820-79435842 CCGGGGATGTGCAAGGTGGCTGG - Intronic
1152656611 17:81522882-81522904 CCCTGCATGTGCAAAGGTCCTGG + Intronic
1152788673 17:82266116-82266138 GCGGGCAAGTGCAGGGGCCTTGG - Intronic
1153681402 18:7504544-7504566 ACGGGCAGGTGCAAGAGCCAAGG + Intergenic
1153805265 18:8705179-8705201 CGGGGCATGCGCACGGGCCTGGG + Intergenic
1154401612 18:14043517-14043539 CCTGGGAAGTGCAAGGGGCCAGG - Intergenic
1157695180 18:49716713-49716735 CCGGGGAAGTGCAAGGGGTCAGG - Intergenic
1160309689 18:77777982-77778004 CAGGGCAGGTGTAAGGGCCAAGG + Intergenic
1160513129 18:79463556-79463578 CCGGGCGTTTGCAACTGCCCAGG + Intronic
1161036720 19:2089168-2089190 CCTGGCATTTGCTGGGGCCCTGG + Intronic
1161221920 19:3121898-3121920 CCGGCCATGAGAGAGGGCCCAGG - Exonic
1161257279 19:3316415-3316437 CGTGGCATGTGGAAAGGCCCTGG + Intergenic
1161705828 19:5820988-5821010 CATGGCCTGTGCAAAGGCCCTGG - Intergenic
1162456512 19:10788317-10788339 CCCGGCCAGTGCAAAGGCCCTGG + Intronic
1162493621 19:11010419-11010441 CAGGCCACGTGCAAGGGCCTGGG - Exonic
1163006960 19:14402899-14402921 CCCAGCATGTGCGAAGGCCCTGG - Intronic
1163321423 19:16577111-16577133 CCGGGCCTGGGCAAGCCCCCTGG - Exonic
1163500622 19:17674161-17674183 GAGAGCAAGTGCAAGGGCCCTGG + Intronic
1163664177 19:18595284-18595306 CCGGGCACGAGCAGGGGCCAAGG + Intronic
1163692452 19:18745108-18745130 CCGGGCATGTAGCAGGGCCTGGG + Intronic
1163748100 19:19059911-19059933 GGGGGCTTGTGCAAAGGCCCTGG - Intronic
1164265564 19:23613609-23613631 CCTGGGAAGTGCAAGGGGCCAGG + Intronic
1165356808 19:35309624-35309646 CTGGGAATGTTCAAGGCCCCAGG + Intronic
1166887960 19:45973170-45973192 CGTGGCAGGTGCAAGGGCTCTGG - Intronic
1168351529 19:55678877-55678899 CCGGGCAGGTGCAGGGGCTCAGG + Intronic
1168445055 19:56404383-56404405 CCGGGGCTGGGCCAGGGCCCGGG - Exonic
927654496 2:24933881-24933903 CCAGGGATGTGCAAGCGCCCAGG + Intergenic
929053831 2:37859178-37859200 ACGGGCATGTGCAGGAGCCAGGG + Intergenic
929280510 2:40072786-40072808 TCGGGCATGTGCAGAGACCCAGG - Intergenic
931814762 2:65889865-65889887 CCCGGGAAGTGCAAGGGCTCAGG + Intergenic
932219587 2:69989527-69989549 CTGGGCAGGTCCAAGGGCTCAGG - Intergenic
934972028 2:98771474-98771496 AGGAGCATGTGCAAAGGCCCTGG - Intergenic
937295124 2:120805423-120805445 CCAGGCATGGCCAAGGCCCCAGG - Intronic
937931034 2:127205355-127205377 CGGGGCATCTGCAGGCGCCCTGG + Intronic
938768543 2:134480272-134480294 AGTGGCATGTGCAAAGGCCCTGG - Intronic
938817445 2:134918703-134918725 CCGCGCATGCGCAAGGGCGGAGG + Intronic
938932782 2:136101259-136101281 AAGGACATGTGCAAAGGCCCTGG - Intergenic
941730826 2:168915199-168915221 CAGGGCATGTGCAATGTTCCAGG + Intergenic
943074716 2:183179786-183179808 CCCGGGAAGTGCAAGGGTCCAGG - Intergenic
943599206 2:189893479-189893501 CCCGGCAAGTGCAAGGGGTCAGG - Intronic
947155988 2:227163952-227163974 CCAGGCAGGTGCCGGGGCCCCGG + Intronic
947740073 2:232480947-232480969 CAGGGCATGTGCTGGGGCCACGG - Intronic
948729233 2:239952744-239952766 CTGGGCCTGGGCCAGGGCCCCGG + Intronic
948912004 2:241009535-241009557 CAGGGCATGAGAAAGGGCACGGG + Intronic
949017336 2:241720786-241720808 CCTGGCCTGTGCAAGGGACAGGG + Intronic
1172006556 20:31822449-31822471 CTGGGCATGTGCAATGGGGCAGG + Intronic
1173384109 20:42572487-42572509 CCAGGCATGTGCCAGGGCCCTGG - Intronic
1173458066 20:43219696-43219718 AGTGACATGTGCAAGGGCCCTGG + Intergenic
1173488490 20:43458585-43458607 CCGGGCAGGCGCGAGGGCCGGGG + Intronic
1173581793 20:44152133-44152155 CCAGGCTTGTGCCAGGGCGCTGG - Intronic
1173758120 20:45535935-45535957 TCAGGCATGTGCAAAGGCACGGG - Intronic
1174274781 20:49395842-49395864 CACGGCAAGTGCAAGGGTCCTGG + Intronic
1174604379 20:51750340-51750362 TGGGGCATGTGAAAGGGCCCAGG - Intronic
1175272237 20:57742487-57742509 TCTGGCTTGTGCAAGGGCCCTGG + Intergenic
1175843048 20:62042580-62042602 ACGGGCAGGTGCAGGAGCCCGGG - Intronic
1175989752 20:62782448-62782470 GCGGGAGTGTGCAAGGGCCCTGG - Intergenic
1176069970 20:63221188-63221210 CAGGGCAGGTGCCAGGGCTCAGG - Intergenic
1176234851 20:64049444-64049466 CCGCGACTGTGCATGGGCCCCGG - Exonic
1178864523 21:36316936-36316958 CCCGGGAAGTGCAAGGGGCCGGG - Intergenic
1179992042 21:44953241-44953263 CCTGTCATGTTCAGGGGCCCTGG + Intronic
1180137716 21:45871897-45871919 CCTGGGATGTGGAAGGTCCCAGG + Intronic
1181046532 22:20217281-20217303 CCGGGAATGAGCATGTGCCCGGG - Intergenic
1181725769 22:24809868-24809890 CTGACCATGTGCAGGGGCCCAGG + Intronic
1182038317 22:27216620-27216642 CTGGGCATGTGCAAGGGATTAGG + Intergenic
1182353607 22:29712337-29712359 CACAGCAAGTGCAAGGGCCCTGG + Intergenic
1182568896 22:31221289-31221311 GGGGACATGTGCAAAGGCCCTGG - Intronic
1182960167 22:34464625-34464647 ACAAGCATGTGCAAAGGCCCTGG + Intergenic
1184256218 22:43288567-43288589 CTGGGCGCGTGCAAAGGCCCTGG - Intronic
1184432393 22:44449147-44449169 GAGGTCATGTGCAAGGGCCCTGG - Intergenic
1184751901 22:46491079-46491101 CTGGCCATGTCCAAGGGCCCGGG - Intronic
1184864100 22:47192908-47192930 CCGGGCGTGTTTAAGGGCCATGG + Intergenic
1185075640 22:48680654-48680676 CCTGGCATGCACAAGGGGCCTGG - Intronic
950912004 3:16604927-16604949 CCGGCCACGTGCAAGGGCCACGG - Intronic
952252841 3:31671378-31671400 AAGAGCATGTGCAAAGGCCCTGG + Intronic
952902475 3:38119363-38119385 CTGGGCATGAGCAAGGGGGCTGG - Intronic
953073991 3:39551085-39551107 CCTGGGAAGTGCAAGGGCTCAGG + Intergenic
954688559 3:52383773-52383795 ACAGGGCTGTGCAAGGGCCCTGG + Intronic
954794257 3:53153541-53153563 AAGGGCATGGGCAAAGGCCCAGG + Intergenic
955054529 3:55443945-55443967 CAGGCCATGTGCAAAGGCCCAGG - Intergenic
956301978 3:67781876-67781898 CCGGGGAAGTGCAAGGGGTCAGG - Intergenic
957048807 3:75396257-75396279 CCGGGCATGGGCTTCGGCCCGGG - Intergenic
957497631 3:81011097-81011119 CCGGGGAAGTGCAAGGGGTCAGG + Intergenic
961830234 3:129619462-129619484 CCCGGCCTGTGCAGTGGCCCAGG - Intergenic
962324965 3:134425245-134425267 CAGGGAATGGGCAAGGCCCCAGG - Intergenic
962358515 3:134715454-134715476 CCCTGCATGTGCAAGTGCGCAGG - Intronic
966442942 3:179966881-179966903 CCAGGCATGAGAAGGGGCCCTGG - Intronic
968873707 4:3254459-3254481 CCAGTCCTGTGCAAGGCCCCAGG - Intronic
968903075 4:3440227-3440249 CTGGGCCTGTGCCAAGGCCCTGG + Intergenic
968945512 4:3661459-3661481 CCGGGCAGGGGCAGGTGCCCAGG + Intergenic
969032619 4:4226810-4226832 CCGGGCAGCTGCAAGCGCCTCGG - Exonic
969270453 4:6096111-6096133 GAGTGCCTGTGCAAGGGCCCTGG + Intronic
969559695 4:7939376-7939398 CCGGGCAGGAGCCAGCGCCCGGG + Exonic
969565185 4:7973156-7973178 AAGTGCATGTGCAAAGGCCCTGG + Intronic
970278368 4:14426461-14426483 CCTGGGAAGTGCAAGGGCTCAGG - Intergenic
970793009 4:19881249-19881271 TCTGGCAAGTGCAAAGGCCCGGG - Intergenic
971749132 4:30623908-30623930 CCTGGGAAGTGCAAGGGGCCGGG + Intergenic
971943267 4:33241833-33241855 CCTGGGAAGTGCAAGGGCTCAGG - Intergenic
973856026 4:55010479-55010501 AAGGGCAAGTGCAAAGGCCCTGG - Intergenic
977557691 4:98501631-98501653 AGGGGCAAGTGCAAAGGCCCTGG + Intronic
979354030 4:119681336-119681358 AAGAGCATGTGCAAGGACCCTGG + Intergenic
979457521 4:120943950-120943972 CCAGGAAAGTGCAAGGGGCCAGG + Intergenic
981671468 4:147292351-147292373 CCGGGGAAGGGCAAGGGGCCAGG + Intergenic
982393545 4:154891867-154891889 CCTGGGAAGTGCAAGGGGCCAGG + Intergenic
982883248 4:160746545-160746567 CCTGGCAAGTGCAAGGGGTCTGG + Intergenic
982889212 4:160825763-160825785 CCAGGTATGTGTAAGGGCCTGGG - Intergenic
983459980 4:168015722-168015744 CCTGGCATGTTAAAGGGCCCTGG - Intergenic
984928173 4:184825314-184825336 ACGGCCAAGTGCAAGGGCCACGG + Intronic
988264139 5:28928146-28928168 CCGGGCATGGGCTTTGGCCCGGG - Intergenic
989178432 5:38553161-38553183 AAGGGCAAGTGCAAAGGCCCTGG - Intronic
989418208 5:41205432-41205454 CCTGGGATGTGCAAGGGGTCGGG + Intronic
990582088 5:57174539-57174561 GCGGGCGTGTGCAAGAGGCCGGG - Intronic
992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG + Intronic
992728903 5:79638294-79638316 CAGGGCAGGTGAAAGGTCCCTGG - Intronic
994609452 5:102018455-102018477 CCTGGGAAGTGCAAGGGCTCAGG + Intergenic
997510313 5:134449490-134449512 CAGGGCACAGGCAAGGGCCCAGG - Intergenic
997611079 5:135216210-135216232 CAGGGCATGTGTCAAGGCCCTGG - Intronic
998794353 5:145802318-145802340 CTGTGCATGTGCTATGGCCCAGG - Intronic
1001567955 5:172712788-172712810 CACAGCATGTGCAAAGGCCCTGG - Intergenic
1002761894 6:208926-208948 CAGGGCATGTGTACGTGCCCCGG - Intergenic
1002778767 6:350561-350583 CCGCGCAGGTGCACAGGCCCCGG + Exonic
1003159912 6:3625907-3625929 CTGGGCGTGGGAAAGGGCCCCGG - Intergenic
1003210963 6:4066223-4066245 CAGGGCATGTGCCAAGGCACAGG - Intronic
1004882872 6:20025895-20025917 AGGAGCATGTGCAAAGGCCCTGG - Intergenic
1005821669 6:29604256-29604278 CCTGGCAGGTGGAAGGGCTCTGG - Intronic
1006781627 6:36636389-36636411 CACAGCATGTGCAAAGGCCCTGG + Intergenic
1007502176 6:42306651-42306673 ACTGGCATGTGCAAAGGCCCTGG - Intronic
1010221361 6:73451754-73451776 CTGGGCACGTCCCAGGGCCCGGG + Exonic
1013668625 6:112374390-112374412 CAGGGCATGTGCTAGAGCCAGGG + Intergenic
1017954418 6:159167211-159167233 CCGGGCAGATGCAAGAGTCCCGG - Intergenic
1018828782 6:167425961-167425983 CCGGGCCAGTGCAGAGGCCCTGG - Intergenic
1019218243 6:170457280-170457302 CAGGGCACGTACAAGGCCCCAGG + Intergenic
1019425700 7:975616-975638 CCGGGCCTGGGCAAGGGGCGGGG - Intergenic
1022500228 7:30878112-30878134 CCAGGCCAGAGCAAGGGCCCTGG - Intronic
1023892296 7:44401847-44401869 CCGGGATTGTGCTATGGCCCCGG + Intronic
1025236307 7:57237037-57237059 ACCCGCATGTGCAAAGGCCCTGG - Intergenic
1026847186 7:73704836-73704858 CCGGGCTTCTGCAAGAGACCAGG + Intronic
1026910975 7:74091814-74091836 CGGTGCATGTGCAAAGGCCTTGG + Intronic
1027050530 7:75018763-75018785 CACAGCATGTGCAAAGGCCCAGG + Intronic
1027188579 7:75985522-75985544 CCGGGGCTGGGCAAGGGCCTCGG + Intronic
1027495927 7:78887941-78887963 CCTGGCAAGTGCAAGGGGTCAGG + Intronic
1028829569 7:95312750-95312772 CTGGGAGTGTGCAAAGGCCCCGG + Intronic
1028829582 7:95312815-95312837 CTGGGAGTGTGCAAAGGCCCCGG + Intronic
1029382515 7:100222907-100222929 CACAGCATGTGCAAAGGCCCAGG - Intronic
1031925281 7:127632814-127632836 CTGGGAATGTTCAAGGCCCCAGG + Intergenic
1033299702 7:140175988-140176010 CCGGGTGTGTGCGGGGGCCCAGG + Intronic
1034281768 7:149859552-149859574 AAGGACATGTGCCAGGGCCCAGG + Intronic
1035376723 7:158411433-158411455 CCGGGCATGTGCAAGGGCCCAGG - Intronic
1035998391 8:4574384-4574406 CCGGGGAAGTGCAAGGGGCTGGG - Intronic
1036658377 8:10692047-10692069 CGGGGCATGTGCAGACGCCCTGG + Intronic
1037817767 8:22120840-22120862 CCGGGTCTGCGCAAGGGCCTGGG - Exonic
1037855378 8:22367525-22367547 CCGGGCGTGTGCCGGTGCCCGGG - Intronic
1039075906 8:33690138-33690160 ACGGGCAGGTGCAGGGGCCCTGG - Intergenic
1040582465 8:48708654-48708676 CCTGGCATGTGCAGGGACTCAGG + Intergenic
1041166279 8:55095832-55095854 CAGAGCATGTGCCAGGGACCTGG - Intergenic
1041997671 8:64083854-64083876 CCGGGGAAGTGCAAGGGGTCAGG + Intergenic
1045257167 8:100536064-100536086 CCAAGCATTTGCAAGGGCACAGG + Intronic
1048293658 8:133198854-133198876 CACAGCATGTGCAAAGGCCCTGG - Intronic
1049208186 8:141373057-141373079 CCGGGCAGGCGCCTGGGCCCAGG - Intergenic
1049250100 8:141583703-141583725 CCAGGCATGTGAGAAGGCCCAGG - Intergenic
1049420684 8:142515210-142515232 CCTGGCATGTGCAAGGGCCTGGG + Intronic
1052628125 9:31003225-31003247 CCGGGGAAGTGCAAGGGGTCAGG - Intergenic
1053443260 9:38132733-38132755 CAGGGCATGGGCAGGGGCCCTGG + Intergenic
1057282325 9:93721777-93721799 GCGGGGATGTGCAAAGGCCCTGG - Intergenic
1057293468 9:93821566-93821588 AATGGCATGTGCAAAGGCCCTGG - Intergenic
1057773166 9:97984482-97984504 CGGGGCAAGGGCAGGGGCCCCGG - Intronic
1060187826 9:121574754-121574776 CTGGGCATGGGAAAGGGCCCTGG - Intronic
1061281666 9:129601257-129601279 GAGGGCATGTGCAAAGGCCCTGG + Intergenic
1061366297 9:130173705-130173727 CCGGGCAGCTGCGTGGGCCCAGG + Intronic
1061951430 9:133938453-133938475 GCTGGCAGGTGCAAAGGCCCTGG - Intronic
1062029770 9:134356951-134356973 CTGGGCATGGGCATGGGCCTTGG - Intronic
1186810270 X:13181513-13181535 CCTGGAAAGTGCAAGGGGCCGGG + Intergenic
1187133880 X:16528309-16528331 CCAGGCCTATACAAGGGCCCAGG + Intergenic
1188756630 X:33970197-33970219 CCAGGCATGGGCATGGGCGCTGG - Intergenic
1191222279 X:58002592-58002614 CCTGGGATGTGCAAGGGGTCGGG + Intergenic
1191802642 X:65098627-65098649 CCTGGGAAGTGCAAGGGGCCAGG + Intergenic
1193605370 X:83561493-83561515 CCAGGCATGTGCTAGGTGCCTGG + Intergenic
1200013162 X:153135935-153135957 CCAGGCATGTGCAAGGGTACAGG - Intergenic
1200026438 X:153263988-153264010 CCAGGCATGTGCAAGGGTACAGG + Intergenic
1200953986 Y:8927320-8927342 CCTGGAATGTAGAAGGGCCCTGG + Intergenic
1200957810 Y:8969706-8969728 CCCAGAATGTGGAAGGGCCCTGG + Intergenic
1200986518 Y:9306942-9306964 CCTGGAATGTAGAAGGGCCCTGG - Intergenic
1202124060 Y:21553960-21553982 CCCGGAATGTAGAAGGGCCCTGG + Intergenic
1202154948 Y:21875420-21875442 CCCGGAATGTAGAAGGGCCCTGG - Intergenic