ID: 1035378026

View in Genome Browser
Species Human (GRCh38)
Location 7:158419857-158419879
Sequence ACTTCAAAGCCCACTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035378024_1035378026 4 Left 1035378024 7:158419830-158419852 CCAAATCCAAAAGAAGTGGCAGT 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1035378026 7:158419857-158419879 ACTTCAAAGCCCACTCCTGAAGG No data
1035378025_1035378026 -2 Left 1035378025 7:158419836-158419858 CCAAAAGAAGTGGCAGTCATTAC 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1035378026 7:158419857-158419879 ACTTCAAAGCCCACTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035378026 Original CRISPR ACTTCAAAGCCCACTCCTGA AGG Intronic
No off target data available for this crispr