ID: 1035380739

View in Genome Browser
Species Human (GRCh38)
Location 7:158439037-158439059
Sequence ATTCACTGGAAGGCTGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 2, 2: 34, 3: 89, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035380733_1035380739 27 Left 1035380733 7:158438987-158439009 CCTATTGCTTATGTAAAAATGCA 0: 8
1: 66
2: 92
3: 103
4: 345
Right 1035380739 7:158439037-158439059 ATTCACTGGAAGGCTGGTCAAGG 0: 1
1: 2
2: 34
3: 89
4: 241
1035380731_1035380739 29 Left 1035380731 7:158438985-158439007 CCCCTATTGCTTATGTAAAAATG 0: 2
1: 8
2: 15
3: 29
4: 241
Right 1035380739 7:158439037-158439059 ATTCACTGGAAGGCTGGTCAAGG 0: 1
1: 2
2: 34
3: 89
4: 241
1035380732_1035380739 28 Left 1035380732 7:158438986-158439008 CCCTATTGCTTATGTAAAAATGC 0: 7
1: 69
2: 90
3: 78
4: 334
Right 1035380739 7:158439037-158439059 ATTCACTGGAAGGCTGGTCAAGG 0: 1
1: 2
2: 34
3: 89
4: 241
1035380735_1035380739 -7 Left 1035380735 7:158439021-158439043 CCAGGCTCAATTGTGTATTCACT 0: 1
1: 1
2: 6
3: 66
4: 290
Right 1035380739 7:158439037-158439059 ATTCACTGGAAGGCTGGTCAAGG 0: 1
1: 2
2: 34
3: 89
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035380739 Original CRISPR ATTCACTGGAAGGCTGGTCA AGG Intronic
900230761 1:1556003-1556025 ATTCACTTTGAGGCTGGGCATGG + Intronic
901940322 1:12656848-12656870 ACTCAGTGTAAGGCTGGGCATGG + Intronic
902415970 1:16239454-16239476 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
904403604 1:30272650-30272672 TTTCTCTGGATGCCTGGTCAAGG - Intergenic
904449887 1:30604319-30604341 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
904574947 1:31499443-31499465 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
905723628 1:40229073-40229095 ATTTACTGCAGGGCTGGGCATGG - Intronic
907529105 1:55075326-55075348 ATACAGTAGAAGTCTGGTCAGGG - Intronic
911048168 1:93646310-93646332 AATTATTGGTAGGCTGGTCACGG + Intronic
912056085 1:105599540-105599562 ATTCAGTGGAAGGCTAATCAAGG - Intergenic
914241203 1:145854296-145854318 AAAGACTGGAAGACTGGTCAGGG + Intronic
915219402 1:154362294-154362316 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
916011256 1:160707955-160707977 ATTCACTGGAATGAAGCTCAAGG - Intronic
916989692 1:170229008-170229030 ATTCAGTGGAAGACTGATCAAGG - Intergenic
917550366 1:176020395-176020417 TTACACTGTAAGGCTGGGCATGG + Intronic
917986926 1:180330119-180330141 CTTCATTTGAAGGCTGGGCATGG + Intronic
918951791 1:191150005-191150027 GTTCAGTGGAAGGCTGATCAGGG + Intergenic
922847873 1:228704107-228704129 ATCCAGTGGAAGGCTCATCAAGG + Intergenic
923420281 1:233807985-233808007 ATACTCTGGAAGCCTGGACAAGG - Intergenic
923805326 1:237251356-237251378 GTTCACTGGTGGTCTGGTCAAGG - Intronic
1064623916 10:17242645-17242667 ATGTACTGGAGGGCTGGGCATGG - Intergenic
1065509362 10:26463145-26463167 ATTCACTGGAAGGCCAGGCGTGG + Intronic
1065509825 10:26467194-26467216 ATGCATTAGAAGGCTGGGCACGG - Intronic
1065880398 10:30032485-30032507 ATTAACTGGAAGGAAGTTCAGGG + Intronic
1067099083 10:43321789-43321811 GTCCACCGGAAGGCTGGGCAGGG + Intergenic
1067951335 10:50740528-50740550 ATACACTGCAAGGCTGCACAGGG - Intronic
1068904898 10:62311759-62311781 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1069505666 10:68995865-68995887 ATTCACATAAAGGCTGGGCACGG + Intronic
1069952698 10:72030686-72030708 ACTCACAGGAGGACTGGTCAGGG - Intergenic
1071700815 10:87933123-87933145 ATTCACTGTAAAGCTGGAAAGGG + Exonic
1072174004 10:92897739-92897761 ATTCAGTGGAAGGCTGATCAAGG + Intronic
1072357115 10:94622715-94622737 ATTCTGTGGAAGGCTGATCAAGG - Intergenic
1072692116 10:97578623-97578645 ACTGACAGGGAGGCTGGTCAGGG - Intronic
1073267480 10:102236541-102236563 AATTACAGGAAGCCTGGTCATGG + Intronic
1075975510 10:126690677-126690699 ATTCAGTGGAAGGCTGGTCAAGG - Intergenic
1076126855 10:127981525-127981547 ATTTAATGGGAGGCTGGGCATGG + Intronic
1076977855 11:189154-189176 ATTCAGTGGAAGGCTGATGAAGG + Intronic
1080135707 11:28851765-28851787 ATTCACTGAAAGTCTGGTTTTGG - Intergenic
1080368681 11:31609083-31609105 CTTCATTGGCAGGCTGGACAAGG + Intronic
1080948500 11:37001789-37001811 AGACAATGGAAGGCTGGGCATGG - Intergenic
1081529767 11:43950085-43950107 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1082192935 11:49269086-49269108 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1082737430 11:56872450-56872472 ATATAGTGGAAGGCTGATCAAGG + Intergenic
1082786082 11:57317675-57317697 ACTCACTGGAGGGCTGGCCCTGG - Intronic
1083352870 11:62043497-62043519 CTTCAGTGGAAGGCTGATCAAGG + Intergenic
1083383451 11:62288295-62288317 ATTCAGTAGAAGGCTAATCAAGG - Intergenic
1084183907 11:67460690-67460712 AGTCACTGGAAGGCTGGGTGTGG + Intergenic
1085588951 11:77738969-77738991 AAGAACTGGAAGGCTGGGCACGG - Intronic
1085760268 11:79235333-79235355 TTTGACTGGAATGCTTGTCAGGG - Intronic
1086673196 11:89571988-89572010 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
1087037551 11:93770352-93770374 ATTCAGTGGAAGGCTGATCAAGG + Intronic
1088594515 11:111430354-111430376 ATTCAGTGGAAGGCTAGTCAAGG - Intronic
1089827883 11:121295396-121295418 ATTCAGTGGAAGGCTAATCAAGG - Intronic
1090102110 11:123809649-123809671 ATTCACTGGAATGTAGGGCAAGG - Intergenic
1090602964 11:128391672-128391694 GTTCTCTGGAAGGCAGGTCCTGG - Intergenic
1090768717 11:129899319-129899341 AGTCACTGGAGGGGGGGTCAAGG - Intergenic
1091103554 11:132897783-132897805 ATTCACAGGCTGGATGGTCAGGG + Intronic
1092370841 12:7915693-7915715 CTGCATTGGAAGGCAGGTCAAGG + Intergenic
1093057639 12:14570514-14570536 ATTCTGTGGAAGGCTGATCAAGG + Intergenic
1093270394 12:17053234-17053256 CTTGGCTGGAAGGCTAGTCAAGG + Intergenic
1094072936 12:26438781-26438803 ATTCACTGATAGGCCAGTCAGGG + Intronic
1094097286 12:26721017-26721039 ATTCAGTGGAGGGCTGGGGATGG + Intronic
1094614488 12:32023848-32023870 ATTCAGTGGAAAGATGATCAAGG - Intergenic
1094679751 12:32657713-32657735 TTTCACTGGAAAGCTGTTTAGGG + Intergenic
1095828940 12:46562107-46562129 ATTCAGTGAAAGGCTGATGAAGG + Intergenic
1096098362 12:48952906-48952928 AGCCACTGGATGGCTGGGCAGGG + Intronic
1096904744 12:54925085-54925107 ATTCGGTGGAAGGCTGATCAAGG - Intergenic
1097131642 12:56815562-56815584 ATTCTCTTGTAGGCTGGGCATGG + Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098700125 12:73613624-73613646 ATTCAGTGAAAGGCTCATCAAGG - Intergenic
1099533796 12:83820778-83820800 TTTCTCTGCAAGGCTGGGCACGG - Intergenic
1100380475 12:94057157-94057179 ATAGAATGGAAGGCTGGTGAGGG - Intergenic
1100999118 12:100338568-100338590 ACTAACAGAAAGGCTGGTCAAGG - Exonic
1101640969 12:106585559-106585581 ATTCTCTGGAAGGGAGGTGAGGG - Intronic
1103596677 12:122028457-122028479 ATTTACTGGGAAGCTGGTCCAGG + Intronic
1105247838 13:18668452-18668474 CTTGGCTGGAAGGCTGGTCTTGG - Intergenic
1107174583 13:37385500-37385522 ATTCAGCGGAAGGCTGATCAAGG + Intergenic
1107215823 13:37917301-37917323 TTTCACTGGGAAGCAGGTCAGGG + Intergenic
1108271657 13:48766982-48767004 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1108607238 13:52052013-52052035 ATTCAGTGAAAGGCTGATCAAGG + Intronic
1109422375 13:62130805-62130827 ATTCAGTGGAAAGCTGATCAAGG + Intergenic
1109960450 13:69621988-69622010 ATTCAGCGAAAGGCTGATCAAGG + Intergenic
1110030251 13:70602648-70602670 AAACCCTGGAAGGCTGGGCACGG + Intergenic
1110228166 13:73141415-73141437 GTTCCCTGGAAGGCTGAGCAGGG - Intergenic
1110605447 13:77426883-77426905 ATTCAGTGGAAGGCTGACCAAGG + Intergenic
1110965154 13:81685490-81685512 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1111078896 13:83276707-83276729 ATACACTGGAAGGGTGGGCAAGG + Intergenic
1111368616 13:87285497-87285519 ATTCAGTAGAAGGCTGATCAAGG + Intergenic
1111546524 13:89745138-89745160 ATTAACTGGAAGACTGGTCATGG - Intergenic
1116381764 14:44277513-44277535 ACTCAGTGGACGGCTGGGCATGG - Intergenic
1117729837 14:58711295-58711317 ATTCATAGGGAGGCTGGGCACGG - Intergenic
1117926878 14:60790427-60790449 ATTCAGTGGAAGGCTGATCAAGG + Intronic
1118577407 14:67257169-67257191 ATTCAGTGAAAGACTGATCAAGG - Intronic
1119223298 14:72926253-72926275 ATGCACGTGGAGGCTGGTCATGG - Intergenic
1121204762 14:92153982-92154004 ATTAGCTGGGAGGCTGGGCACGG - Intronic
1122111286 14:99504738-99504760 ATTCACCTGTAGGCTGGGCACGG - Exonic
1122441179 14:101733138-101733160 AGTAACTGGAAGGCCGGGCATGG - Intergenic
1122501744 14:102204954-102204976 ATACACTTGGAGGCTGGGCATGG + Intronic
1122619498 14:103046939-103046961 ATTCAATGTAAGGCTGGGCGCGG - Intronic
1122659513 14:103285508-103285530 ATTCTCTAGGAGGCTGGGCACGG + Intergenic
1123146362 14:106134504-106134526 ATTCAGTGGTAGGCTGATAAAGG - Intergenic
1123493409 15:20800111-20800133 ATCCAGTGCAAGGCGGGTCAGGG - Intergenic
1123549918 15:21369213-21369235 ATCCAGTGCAAGGCGGGTCAGGG - Intergenic
1123872333 15:24589494-24589516 ATTCAGTAGAAGGCTGATCAAGG - Intergenic
1123883322 15:24696350-24696372 ATTCAGTGAAAGGCTGACCAAGG - Intergenic
1124345456 15:28918811-28918833 ACTCACTGCGAGGCTGGGCAGGG + Intronic
1124583057 15:30979274-30979296 ATTCACTTAAAGGCTGGGCGTGG + Intronic
1124804801 15:32870827-32870849 ATTCAAGGGAAGGCTTCTCATGG - Intronic
1125222151 15:37350709-37350731 TATTAATGGAAGGCTGGTCATGG - Intergenic
1125292941 15:38169724-38169746 AATCACAGGAAGGCTGTTCTAGG - Intergenic
1125742840 15:41979170-41979192 ATCCACAGGAAGGCAGTTCAAGG - Intergenic
1127102137 15:55577218-55577240 ATTCAGTGAAAGGCTGATCAAGG + Intronic
1127214349 15:56809043-56809065 ATTCACTGGAAGAATGTTGAAGG - Intronic
1127229062 15:56968955-56968977 ATTCAGTGGAAGGCTAACCAAGG - Intronic
1130209204 15:81907934-81907956 ATTCACTGAAATGTTAGTCATGG + Intergenic
1131107501 15:89744955-89744977 ACTCACTGTAATGATGGTCAGGG + Intergenic
1131547547 15:93328577-93328599 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
1131653643 15:94430439-94430461 ACACACTGGAAGGCTGGGCATGG + Intronic
1202958247 15_KI270727v1_random:96431-96453 ATCCAGTGCAAGGCGGGTCAGGG - Intergenic
1133467221 16:6039184-6039206 CTTCCCTGGAAGCCTGGTCGGGG + Intronic
1133841178 16:9411118-9411140 GTTCAGTGGACGGCTGATCAAGG - Intergenic
1134369558 16:13610393-13610415 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1134371718 16:13632149-13632171 ATTCGGTGGAAGGCTGGTCAAGG + Intergenic
1135111664 16:19695095-19695117 AATCAGGGGAAGGCTGGGCATGG - Intronic
1136475403 16:30510168-30510190 AGTCACTGGAAGGCTGGGTAAGG - Intronic
1136692702 16:32046962-32046984 ATTCAGTGGTAGGCTGATAAAGG + Intergenic
1136793199 16:32990188-32990210 ATTCAGTGGTAGGCTGATAAAGG + Intergenic
1136876654 16:33863869-33863891 ATTCAGTGGTAGGCTGATAAAGG - Intergenic
1138654518 16:58483074-58483096 ATACACTGGGGGGCTGGGCACGG - Intronic
1139086420 16:63592122-63592144 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1142442477 16:90108179-90108201 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1203095455 16_KI270728v1_random:1251879-1251901 ATTCAGTGGTAGGCTGATAAAGG + Intergenic
1142465276 17:133619-133641 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1143090926 17:4448771-4448793 ATTCACTGCAAGGCAGGGCATGG + Intronic
1143467246 17:7145754-7145776 GTTCAGTGAAAGGCTGATCAAGG + Intergenic
1145223148 17:21105638-21105660 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1150165797 17:62941134-62941156 ATGAACTGGAAGACAGGTCAAGG + Intergenic
1150247165 17:63685176-63685198 ACTCACTGGAAGGCTCAGCAGGG + Intronic
1150985400 17:70191030-70191052 ATTCAAAGGTAGGCTTGTCAAGG + Intergenic
1153851539 18:9099941-9099963 ATTCAGTGGAGGGCTGATCAAGG - Intergenic
1153960651 18:10137289-10137311 GTTCACGAGAAGGCTGGGCACGG - Intergenic
1154441011 18:14390682-14390704 CTTGGCTGGAAGGCTGGTCTTGG + Intergenic
1154450960 18:14474649-14474671 ATCCAGTGCAAGGCGGGTCAGGG - Intergenic
1155429390 18:25739819-25739841 AGTCACTGGAAGGCTTGCCTGGG - Intergenic
1155839072 18:30625498-30625520 AGACACTGGAAGGATGGTAAAGG + Intergenic
1157105565 18:44771489-44771511 AATCACTGGATGGATGGTCTGGG - Intronic
1158169970 18:54586489-54586511 ATTTACTGGAAGCATGGCCAGGG - Intergenic
1159206935 18:65265201-65265223 ATTCATTGGCTGGCTGGGCACGG - Intergenic
1159226180 18:65538801-65538823 ATTCACTGCAGGGCTGGGCGTGG - Intergenic
1159943998 18:74430123-74430145 AGTCACTGGCAGGCTGGGCATGG - Intergenic
1161275047 19:3411308-3411330 AAGCACTGGAGGGCTGGGCATGG - Intronic
1162055525 19:8061433-8061455 ATTCCCTGGTTGGCTGGGCATGG - Intronic
1162483345 19:10942605-10942627 ATTTGCTGCAAGGCTGGGCACGG - Intergenic
1164193586 19:22933729-22933751 ATTCACAGGTAGGTTGGTGACGG + Intergenic
1164203945 19:23042282-23042304 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1164423476 19:28118692-28118714 AATCACTGAAAGGCAGCTCAAGG + Intergenic
1164860945 19:31561777-31561799 ACTCCTTGGAAGGCTGGGCATGG - Intergenic
1167688070 19:50968904-50968926 CTTCCCTGGAGGCCTGGTCAGGG - Exonic
1167966527 19:53152314-53152336 ATTCACTGAAGGGCCGGGCATGG + Intronic
1168402840 19:56095829-56095851 CTTCACTGCAAAGCTGGGCAGGG - Intronic
925308118 2:2864554-2864576 ATTCAGTGGAAAGGTGATCAAGG + Intergenic
926208427 2:10850476-10850498 ATTCAGTGAAAGGCTAATCAAGG + Intronic
926250168 2:11151077-11151099 ATTCACTGAAAGGCTGATCAAGG + Intergenic
926669966 2:15567781-15567803 ATACACTGGTAGGCTGGGCATGG + Intergenic
926783974 2:16502018-16502040 AATCACTGGAAGAATGGTGAAGG + Intergenic
927289057 2:21386944-21386966 ATTCACTGGATGGATTATCAAGG - Intergenic
928976178 2:37088810-37088832 AATCACTGTCAGGCTGGGCACGG - Intronic
930030084 2:47053089-47053111 ATTCACAGGAAGGCTAGACATGG + Intronic
930082614 2:47465724-47465746 ATTCAGTGAAAGGCTGATCAAGG - Intronic
932204392 2:69865923-69865945 ATTAAATAGAAGGCTGGGCATGG - Intronic
932442877 2:71748977-71748999 ATTCCCTGATAGGCAGGTCAGGG - Intergenic
932727553 2:74192591-74192613 ATTCAGTGAAACGCTGATCAAGG - Intergenic
932834257 2:75020631-75020653 AATCAGTGGAAGGCTGCTGAGGG - Intergenic
933387606 2:81631101-81631123 ATTCACTAGAAGGATGCCCAGGG + Intergenic
933613671 2:84462266-84462288 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
934791804 2:97068408-97068430 ACTCACAGGAAAGCTGCTCATGG + Intergenic
934887057 2:98034137-98034159 ATTCATTGAAAGGCTGATCAAGG + Intergenic
935983906 2:108653902-108653924 ATTCATCGGAAGGCTGATCAAGG - Intronic
936115736 2:109701526-109701548 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
936136339 2:109897556-109897578 ATTCATCGGAAGGCTGATCAAGG - Intergenic
936208358 2:110473929-110473951 ATTCATCGGAAGGCTGATCAAGG + Intergenic
937308646 2:120887722-120887744 ATTCACTTGATGGATTGTCAGGG + Intronic
937881535 2:126870099-126870121 CATCACAGGAAGGCTGGGCAGGG + Intergenic
938137725 2:128772921-128772943 GCTCAGTGGAAGGCTGGGCAGGG + Intergenic
942316214 2:174698811-174698833 ACTCAGTGGAAGGCTGATCAAGG + Intergenic
943598200 2:189882553-189882575 ATTCAATGAAAGGCTGATCAAGG - Intronic
945292899 2:208143455-208143477 ATTCAGTGGAAAGCTGATCAAGG + Intronic
945647352 2:212514514-212514536 ATTCATTGCTAGGCTGGGCACGG + Intronic
946891412 2:224280914-224280936 ATACATTAGAAGGCGGGTCAAGG + Intergenic
948991342 2:241556043-241556065 AGTCACTGCAAGACTGGGCATGG - Intergenic
1168764243 20:371179-371201 AGTCACAGTCAGGCTGGTCAGGG + Intronic
1169443431 20:5652050-5652072 ATTCAGCGAAAGGCTGATCAGGG + Intergenic
1172326338 20:34038247-34038269 ATTAACTGGAAGGCAGTTCTAGG + Intronic
1174229130 20:49029881-49029903 ATTCACTTTTAGGCTGGGCACGG - Intronic
1174661029 20:52213325-52213347 ATTTAGTGGAAGGCTGATCAAGG - Intergenic
1176445277 21:6815924-6815946 ATCCAGTGCAAGGCGGGTCAGGG + Intergenic
1176823444 21:13680957-13680979 ATCCAGTGCAAGGCGGGTCAGGG + Intergenic
1177649572 21:23942926-23942948 CTTCAGTGGAAGGCTAATCAAGG - Intergenic
1177671282 21:24232449-24232471 ATTCAATGGAAGGTTTTTCAGGG - Intergenic
1178169756 21:30026900-30026922 ATTCAATGTAAGGAAGGTCAGGG + Intergenic
1178307686 21:31504052-31504074 GTTCACTGTAAGGTTGGGCAGGG - Intronic
1178448281 21:32665501-32665523 ATTCAGTGGAAGGCTGATCTAGG + Intronic
1178955767 21:37020243-37020265 ATTAACTGGGTGGCTGGGCATGG - Intergenic
1179668359 21:42927924-42927946 ATTCAGTGGAAGGCTGACCAAGG - Intergenic
1179672169 21:42957277-42957299 ATTCAGTGAAAGGCTGTTCAAGG + Intergenic
1182489168 22:30658731-30658753 ATTCACTGGAATACTGCTTAGGG - Intronic
1184102170 22:42346644-42346666 TTTCACTGGAAAGCTGGTGAGGG - Intergenic
1184588993 22:45468467-45468489 ATTCAGTGGAAGACTGGTCAAGG + Intergenic
1185335507 22:50269474-50269496 GTTGACTGGGAGGCTGATCATGG - Intronic
950203191 3:11059112-11059134 ACTCACTAGCAGGCTGGACAGGG + Intergenic
952248120 3:31619982-31620004 ATTCACTGAGAGGCTGGGCATGG + Intronic
954405877 3:50344823-50344845 ATTGACTGTAAGGCTGGTGGTGG - Intronic
954477144 3:50757883-50757905 ATTAATTGGATGGCTGGGCACGG + Intronic
956712256 3:72048999-72049021 TTACACTGGCAGGCTGGTCTGGG + Intergenic
956792325 3:72689754-72689776 ATTATCTGGCAGGCTGCTCAGGG - Intergenic
957440638 3:80242315-80242337 ATTCAGTGAAAGGCTAATCAAGG + Intergenic
960441172 3:117691043-117691065 ATTCAATAGAAGGCTGGGCTGGG - Intergenic
961182810 3:124889280-124889302 ATTCAGTGGAAGGCTGATCAAGG + Intronic
961510045 3:127395352-127395374 TTTCACTGAAAGGCTCGTCATGG - Intergenic
961518495 3:127453417-127453439 GTTCAGTGGAAAGCTGGACATGG - Intergenic
962833275 3:139162707-139162729 TTTTAGTGGAAGGCTGATCAAGG - Intronic
963162832 3:142169426-142169448 ATTCTCAGGAAGGCAGGCCAGGG - Intronic
963299780 3:143585369-143585391 ATTCAGTGGAAGGCTGATCAAGG + Intronic
963354474 3:144193388-144193410 ATTCTCAGCAAGGCTGGGCACGG - Intergenic
964351620 3:155808837-155808859 ATTGATTGGAGGGCTGGGCATGG + Intergenic
966306822 3:178545387-178545409 TTTCACTGGAAAGCTGGTAAAGG + Intronic
966958223 3:184907228-184907250 ATTCAGTGGAAGGTTGATCAAGG - Intronic
967279055 3:187804873-187804895 ATTCAGTGGGGGGCTGGTGAGGG - Intergenic
968270550 3:197399995-197400017 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
968362750 3:198159139-198159161 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
968722997 4:2221522-2221544 ATTCAGTGGAAGGCTGATCAAGG + Intronic
972565620 4:40266566-40266588 ATTCAGTGGAAGGTTGATCAAGG - Intergenic
973254269 4:48093164-48093186 ATTCACTGGAATTTTGGTTAAGG - Intronic
973911702 4:55588379-55588401 ATTCAGTGGAAGGCTAATCAAGG + Intronic
974082799 4:57230309-57230331 ATTTAGTGGAAGGCTGATCAAGG - Intergenic
974609940 4:64204530-64204552 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
975211965 4:71711517-71711539 ATTAGCTGGAAGGGTGTTCAGGG + Intergenic
975313305 4:72926573-72926595 ATGCACTAGCAGGCTGGTCCAGG + Intergenic
976695920 4:87919579-87919601 ATTCAGTGGAAGGCTGATCAAGG + Intergenic
977348998 4:95856556-95856578 CTTCAGTGAAAGGCTGATCAAGG - Intergenic
977526822 4:98156442-98156464 ATTCTCTGGAAAGCTCCTCAAGG - Intergenic
977894319 4:102346313-102346335 ATTGAGTGGAAGGCTGATCATGG + Intronic
978053262 4:104230342-104230364 ATTCACTGGAAAGCTACCCATGG - Intergenic
978529387 4:109698920-109698942 ATTCAGTGGAAGGCTGTCCAGGG - Intronic
978598673 4:110405577-110405599 ATTCAGTGAAAGGCTGATCAAGG + Intronic
980121594 4:128733652-128733674 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
980983949 4:139677451-139677473 ATTCAGTGAAAGGCTTATCAAGG - Intronic
981370860 4:143957177-143957199 ATAGACTGGATGGCTGGGCATGG - Intergenic
983639864 4:169935159-169935181 TTTCAGTGAAAGGCTGATCAAGG + Intergenic
983819349 4:172173362-172173384 ATTCACAGGAAGGCTCTTGATGG - Intronic
984000093 4:174229817-174229839 ATTCACTGGAACTCTGGCCCTGG + Intergenic
984782813 4:183541298-183541320 ATGCACTGGAAGGCTCGTAAGGG - Intergenic
985179319 4:187239331-187239353 ATTCACTGGATTTCTGGTCTAGG + Intergenic
986163655 5:5253384-5253406 ATTCAGTGGAAGGCTGATCAAGG - Intronic
986668198 5:10121146-10121168 ATACTCTGGAAGGCTGAGCAAGG + Intergenic
986990240 5:13543898-13543920 ATTCACAGGGAGGCTGCACAAGG - Intergenic
987120667 5:14763796-14763818 AGTGACTGGGAGGCTGGGCACGG + Intronic
988157774 5:27477033-27477055 ATTCACTGGTAGGTAGGTAATGG + Intergenic
991175717 5:63685696-63685718 ATTCAGTGGAAGGCTGATCTAGG + Intergenic
991264907 5:64706265-64706287 ATTTAGTGGAAGGCTGATCAAGG - Intronic
991568201 5:68027106-68027128 ATTCACTTGAAGCCTGAACAGGG - Intergenic
992259882 5:74959047-74959069 ATTGAGTGGCAGGTTGGTCAGGG + Intergenic
992329756 5:75703863-75703885 AAGCACTGAAAGGCTGGGCACGG + Intronic
995019930 5:107354709-107354731 ATCCCCTAGAAGGCTGGGCACGG - Intergenic
998471703 5:142388786-142388808 ATTCTGTGGAAGGCAGGCCAAGG + Intergenic
999450434 5:151673623-151673645 ATTCAGGGGAAGGCTGATCAAGG + Intronic
999503601 5:152171664-152171686 ATTCATTGGAATGCTAATCAAGG - Intergenic
1000052927 5:157577484-157577506 ATTCAGTGGAAGGTTGATCAAGG - Intergenic
1001027866 5:168239255-168239277 ATTCACTGGAAGGTGAGCCAAGG - Intronic
1001699526 5:173696871-173696893 ACTCACTGAAATGCTGCTCAAGG - Intergenic
1002154222 5:177262962-177262984 ATTCAGTGAAAGGCTGATGAAGG + Intronic
1003001489 6:2338906-2338928 ATTCAGTGGAAAGCTGATCGAGG - Intergenic
1004111865 6:12726582-12726604 ACTCACTGGAAGCCTGGCCATGG + Intronic
1004529734 6:16442719-16442741 TTTTACTGGAAGGCTGGGCATGG + Intronic
1005624344 6:27649264-27649286 ATTCAGTGAAAGGTTGATCAAGG + Intergenic
1005851991 6:29829051-29829073 AATCCCTGGAAGACTGATCAGGG + Intronic
1006479873 6:34283491-34283513 AATAAATGGAGGGCTGGTCATGG - Exonic
1007156333 6:39748275-39748297 GTTCAGTGGAAGGCTGATCAAGG - Intergenic
1008672933 6:53792134-53792156 AGTCACTTGAAGGCTTGACAAGG + Intergenic
1010622159 6:78090026-78090048 ATTCAGTGGAAGGCTGGTCAAGG + Intergenic
1011658882 6:89577043-89577065 ATGCCCAGGAAGGCTGGGCATGG - Intronic
1012064551 6:94534038-94534060 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1012064566 6:94534206-94534228 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1012976444 6:105785434-105785456 ATTCACTAGAAGGCTGTCCCAGG - Intergenic
1014726837 6:124981527-124981549 ATTCAGTGAATGGCTGATCAAGG - Intronic
1015438705 6:133221849-133221871 ATTTACTAGGAGGCTGGGCATGG - Intergenic
1015574958 6:134661333-134661355 AGTTTCTGGAAGGTTGGTCATGG + Intergenic
1016891819 6:149014827-149014849 ATGCCCTGGAAGTCTGGCCAGGG + Intronic
1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG + Intronic
1019020578 6:168914322-168914344 ATTCTCTGGATGGCTCCTCATGG - Intergenic
1019099827 6:169620505-169620527 ATTCAGTGGAAAGCTGATCAAGG + Intronic
1019210065 6:170397754-170397776 ATTTACGGCCAGGCTGGTCACGG - Intronic
1019233303 6:170586483-170586505 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1019252933 7:29572-29594 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1020416081 7:7947207-7947229 AGTCACTGAAATGCTGGCCATGG + Intronic
1021463295 7:20913060-20913082 ATTCACTGAGAGGCTGGTGCAGG + Intergenic
1022490430 7:30813452-30813474 ATTCACTGAGGGGCTGGACATGG - Intronic
1023736007 7:43236612-43236634 ATTCAGCGAAAGGCTGATCAAGG - Intronic
1023934055 7:44726543-44726565 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1024589835 7:50871772-50871794 ATTCAGGGAAAGGCTGATCAAGG - Intergenic
1024689231 7:51781129-51781151 ATTCACTGAGAGGCTTGGCAGGG - Intergenic
1026291615 7:69011538-69011560 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1026398067 7:69978932-69978954 ATTCCCAGGAAGACTGGTAATGG - Intronic
1026561862 7:71457001-71457023 ATTCAGTGGAAGGTTAATCAAGG - Intronic
1028391849 7:90326002-90326024 ATTAAATGGGAGGCTGGGCACGG + Intergenic
1029159904 7:98544207-98544229 GTTCCCTGGCAGGCTGTTCAGGG + Intergenic
1030927437 7:115476269-115476291 TTACACTGGAAGGCTGTTGAGGG - Intergenic
1031197974 7:118640748-118640770 ATTCAGTGGGAGGCTGATTAAGG + Intergenic
1031621699 7:123941453-123941475 ATTCAATGGAAAGCTGATCAAGG - Intronic
1031622126 7:123946727-123946749 ATGCAGTGGAAGGCTGATCAAGG - Intronic
1032801308 7:135319288-135319310 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1033058492 7:138081964-138081986 ATTCACTGGAAGCCTTCTCTTGG + Intronic
1034495749 7:151421106-151421128 AGTCACAGAAAGGCTGGGCATGG + Intergenic
1034626861 7:152500204-152500226 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1035380739 7:158439037-158439059 ATTCACTGGAAGGCTGGTCAAGG + Intronic
1036146149 8:6256686-6256708 ATTCACTGAAAGACTGATGAGGG - Intergenic
1036964979 8:13287234-13287256 ATTCAATGTATGGCTCGTCAGGG + Intronic
1039500831 8:38015475-38015497 ATTCAGTGAAAGACTGGTCAAGG - Intergenic
1040925637 8:52679467-52679489 ATTGAGTGAAAGGCTGATCAAGG + Intronic
1046619590 8:116514314-116514336 AGACAGTTGAAGGCTGGTCATGG - Intergenic
1046802785 8:118447591-118447613 TTTCAATTGAAGGCTGGACACGG - Intronic
1047091871 8:121583985-121584007 ATTCAGCGGAAGGCTGATCAAGG + Intergenic
1047110990 8:121789405-121789427 GTTCAGTGGAAGGCTGATCAAGG + Intergenic
1047136081 8:122079859-122079881 ATTCAGTGGAAGGCTGATCAAGG - Intergenic
1047514560 8:125542415-125542437 TTTCACTGGAAGCCAGTTCAAGG + Intergenic
1051427155 9:16943834-16943856 ATTCATTTGAAGGCTGGGCACGG + Intergenic
1051637934 9:19197782-19197804 ATTCACTTGTAGGCTGGGCATGG + Intergenic
1052888726 9:33676266-33676288 ATTCACTGTAAAGCTGGAAAGGG - Intergenic
1053058842 9:35012580-35012602 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1053060581 9:35027939-35027961 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1055054305 9:72010141-72010163 ATTCAGTGGAAAGCTGATCAAGG - Intergenic
1055483720 9:76735559-76735581 AGTAACTGGAAGGCTGACCATGG + Intronic
1055949032 9:81713764-81713786 AGTCACTTGGAGGCTGGGCATGG - Intergenic
1057529120 9:95828549-95828571 CTCCTCTGGAGGGCTGGTCAGGG - Intergenic
1058431982 9:104927974-104927996 CTTCTCCGGAAGGCTTGTCAAGG - Exonic
1060956790 9:127647186-127647208 TTTCACTGAAACGCTCGTCAAGG + Intronic
1062747437 9:138222802-138222824 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1203523918 Un_GL000213v1:68601-68623 ATCCAGTGCAAGGCGGGTCAGGG - Intergenic
1185804952 X:3048490-3048512 ATTCAGTGGAAAGCTGATCAAGG + Intronic
1185917199 X:4048509-4048531 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1186816830 X:13246400-13246422 ACTCAATGGAAGGGTGGGCATGG + Intergenic
1187963987 X:24592744-24592766 ATACACTAGGAGACTGGTCAGGG - Intronic
1188221336 X:27545297-27545319 ATTCACTGGAAGAATGGTTTTGG - Intergenic
1188430675 X:30103251-30103273 ATTCAATAGAAGGCTGATCAAGG - Intergenic
1188963626 X:36523995-36524017 ATTTACTGGAAGGGTGCTCTTGG - Intergenic
1190731420 X:53228532-53228554 AGTGACTGGAAGGCTCGTCTGGG + Intergenic
1190889730 X:54557722-54557744 ATTAGCTGGGAGGCTGGGCATGG - Intronic
1190951805 X:55152976-55152998 ATTCAGTGAAAGGCAGATCAAGG + Intronic
1193179655 X:78439843-78439865 ATTCAGTGGAAGGGTGATTAAGG + Intergenic
1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1193319713 X:80107026-80107048 ATTCTGTGGAAGGCTGATCAAGG + Intergenic
1193346963 X:80414672-80414694 ATTCAGTGGAAGGCTGATCAAGG - Intronic
1193639869 X:84000055-84000077 ACTCAGTGAAAGGCTGATCAAGG - Intergenic
1194113865 X:89872508-89872530 ATTCAGTGGAAGGCTGAACAAGG - Intergenic
1194487164 X:94498509-94498531 ATTCAATGGAAGACTGATCAAGG + Intergenic
1194502361 X:94697466-94697488 ATTCAGTGGAAGGCTTACCAAGG - Intergenic
1195069237 X:101263334-101263356 CTACACTGGAAGGATGGTGAAGG + Exonic
1197660232 X:129162713-129162735 AGTCTCAGGAAGGCTGATCAGGG + Intergenic
1198736961 X:139797102-139797124 CTTCACTGAAATGCTGCTCAGGG - Intronic
1199174945 X:144776458-144776480 AAGCAGTGGAAGGCTGATCAAGG - Intergenic
1199356919 X:146873535-146873557 ATTCAGTAGAAAGCTGATCAAGG + Intergenic
1199746831 X:150777026-150777048 ATTCAGTGAAAGGCTGATCAAGG - Intronic
1199820311 X:151439061-151439083 ATGCACTGGATGGCTCTTCATGG + Intergenic
1200466602 Y:3527863-3527885 ATTCAGTGGAAGGCTGAACAAGG - Intergenic
1201276304 Y:12302117-12302139 ATTCAGTGGAAAGCTGATCAAGG - Intergenic
1201389481 Y:13481454-13481476 ATTCAGTAGGAGGCTGATCAAGG - Intergenic
1201948600 Y:19539125-19539147 GTTTACTGGAAGTCAGGTCAAGG - Intergenic