ID: 1035380765

View in Genome Browser
Species Human (GRCh38)
Location 7:158439246-158439268
Sequence AGGCATGCGCAGGAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035380765_1035380770 -3 Left 1035380765 7:158439246-158439268 CCGTCCACCTCCTGCGCATGCCT 0: 1
1: 0
2: 0
3: 18
4: 340
Right 1035380770 7:158439266-158439288 CCTCAGCCCCCGACCACCTCAGG 0: 1
1: 0
2: 3
3: 45
4: 308
1035380765_1035380778 21 Left 1035380765 7:158439246-158439268 CCGTCCACCTCCTGCGCATGCCT 0: 1
1: 0
2: 0
3: 18
4: 340
Right 1035380778 7:158439290-158439312 ACAAGTCTCAGGACTTCCTGAGG 0: 1
1: 15
2: 16
3: 32
4: 221
1035380765_1035380776 10 Left 1035380765 7:158439246-158439268 CCGTCCACCTCCTGCGCATGCCT 0: 1
1: 0
2: 0
3: 18
4: 340
Right 1035380776 7:158439279-158439301 CCACCTCAGGCACAAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035380765 Original CRISPR AGGCATGCGCAGGAGGTGGA CGG (reversed) Intronic
900181376 1:1312498-1312520 AGCCCTGCGGAGGAGGTGGCAGG + Exonic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901229374 1:7633450-7633472 AGGCATGGGCTGGAAGAGGAGGG - Intronic
901428741 1:9199595-9199617 AGGGATGGGCAGGTGATGGAGGG - Intergenic
901800046 1:11703335-11703357 AAGGATGGGCAGGACGTGGACGG + Intronic
903225913 1:21894226-21894248 AGCCATGCCCAGGGGGAGGAGGG + Intronic
903745512 1:25584239-25584261 AGGCAAGCGCAGGGGGTTGGGGG - Intergenic
904365956 1:30010934-30010956 AGACATGGGGAGGAGGCGGACGG - Intergenic
905370495 1:37480213-37480235 AGGCCTGAGCAGGAGGAGGGAGG - Intronic
905641489 1:39593006-39593028 AGGTATGAGCAGGATGTGGCTGG - Intergenic
906035674 1:42748971-42748993 GGGAAGGTGCAGGAGGTGGATGG - Intronic
906204230 1:43978820-43978842 AGGCGTGGGCTGGAGGTGGCTGG - Intergenic
906668103 1:47635858-47635880 AGGAAGGAACAGGAGGTGGAGGG - Intergenic
907828298 1:58039402-58039424 AGGATTGCTCAGGAGGTAGAGGG - Intronic
912349226 1:108996165-108996187 AGGTATGTGTGGGAGGTGGAAGG - Intronic
913183576 1:116345917-116345939 GGGCATGGGTAGGAGGAGGAGGG + Intergenic
913320980 1:117588235-117588257 AGTGTTGAGCAGGAGGTGGATGG - Intergenic
913324753 1:117617076-117617098 AGGCAGGTGCATGAGCTGGAGGG - Intronic
913328782 1:117650365-117650387 TGGCAGGGGCAGGGGGTGGATGG + Intergenic
913684065 1:121214931-121214953 GGGAATGAGCAGGAGGTGGTGGG + Intronic
915364356 1:155306015-155306037 AGGGATTAGCAGGAGGTGGGGGG + Intergenic
915891956 1:159781270-159781292 GGGGATGCGCAGGCGGTGCAGGG - Exonic
918290184 1:183099896-183099918 AGGCAGGCGCAGGGGCAGGATGG - Intronic
919919532 1:202160033-202160055 GGGGATGGGCAGGAGGAGGAAGG - Intronic
920194039 1:204214136-204214158 GGGCAGGCGCGGCAGGTGGAGGG - Intergenic
920844330 1:209581115-209581137 AGCCAGGCACAGGAGGAGGATGG + Intergenic
923092974 1:230753657-230753679 GGGCCTGGGCTGGAGGTGGAAGG - Intronic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923523739 1:234756707-234756729 AGGTAAACGCAGGAGGTTGAGGG - Intergenic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
1063515768 10:6693626-6693648 TGGCAGGCGCAGGAGGAGGGGGG - Intergenic
1064634024 10:17345499-17345521 AGGCAGGAGAAGGAGATGGAGGG + Intronic
1064988163 10:21231755-21231777 AGGCATCAGCAGGAGGAGGTAGG + Intergenic
1067947785 10:50701310-50701332 AGGCATGGGGAGGAGGGGCAGGG + Intergenic
1068596118 10:58904901-58904923 ATGCACCTGCAGGAGGTGGATGG - Intergenic
1068981889 10:63071248-63071270 TGGCAGGGGCAGGAGGTGCAGGG + Intergenic
1069887411 10:71632731-71632753 GGGCATGCAAAGGTGGTGGAGGG - Intronic
1070835690 10:79445632-79445654 CGGCGCGCGCAGGCGGTGGAAGG + Intergenic
1070883102 10:79866303-79866325 AGGCATGGGGAGGAGGGGCAGGG + Intergenic
1071527723 10:86367578-86367600 AGGCAGGCACCGGAGGCGGAGGG - Intergenic
1071649670 10:87382618-87382640 AGGCATGGGGAGGAGGGGCAGGG + Intergenic
1072195728 10:93116018-93116040 AGGCAGGAGGAGGAGGAGGAGGG + Intergenic
1072900475 10:99402547-99402569 ACGCATGGGCTGGAGGTGGTGGG + Intronic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1077327827 11:1971329-1971351 AGGCAGTGTCAGGAGGTGGATGG - Intronic
1078446021 11:11405429-11405451 AGGAATGAGATGGAGGTGGAAGG + Intronic
1079196552 11:18332407-18332429 AGGCAGGGGATGGAGGTGGAGGG + Intronic
1081852333 11:46282325-46282347 AGGCCTGTGCAGTAGGGGGATGG - Intronic
1081911151 11:46700713-46700735 GGGCATGTGCAGGAAGTGGGCGG - Intergenic
1082125154 11:48423784-48423806 AGGAATGAGCTGGATGTGGAAGG - Intergenic
1082250881 11:49978858-49978880 AGGAATGAGCTGGATGTGGAAGG + Intergenic
1082558821 11:54595052-54595074 AGGAATGAGCTGGATGTGGAAGG - Intergenic
1083631517 11:64097802-64097824 AGGCCTGAGCAGGAGCAGGAAGG - Intronic
1083858765 11:65407929-65407951 AGCCATGCGCATGAGGAGGGCGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1087246987 11:95851009-95851031 AAGCATATTCAGGAGGTGGAAGG + Intronic
1089149807 11:116356000-116356022 AGGCAAGCGAAGGATGTGTAAGG - Intergenic
1089177190 11:116557465-116557487 AGGCATAGGCAGGAGGTTGCTGG - Intergenic
1089640433 11:119844246-119844268 GGGCAGGGGCAGGGGGTGGAGGG - Intergenic
1089839262 11:121400161-121400183 AGGCAGGGGCAAGAGGTGGGAGG + Intergenic
1091041446 11:132284979-132285001 AAGCATGAGCAGGAGCAGGAAGG + Intronic
1091273475 11:134333617-134333639 AGGTATGCGAAGGAGGCTGAGGG + Intronic
1091301234 11:134509556-134509578 AGGCAGGCCCAGGACGTGGCTGG - Intergenic
1202810807 11_KI270721v1_random:26509-26531 AGGCAGTGTCAGGAGGTGGATGG - Intergenic
1091577867 12:1756085-1756107 AAGCAGGCGCAGGTGGTGGTGGG - Intronic
1091704916 12:2687213-2687235 GGGCAGGGGCAGGAGGTGGAAGG + Intronic
1093366293 12:18302960-18302982 AGGCTTGAGCACGGGGTGGAGGG + Intronic
1096112546 12:49038037-49038059 AGGCATCAGCAGCAGGGGGAGGG + Exonic
1097196071 12:57243082-57243104 AGGGATGGGGAGGGGGTGGAGGG - Intergenic
1098449994 12:70609488-70609510 AGGCTTGCAGGGGAGGTGGATGG + Intronic
1100875119 12:98953593-98953615 AGGAATGTGCATGAGGTGGAGGG - Intronic
1101496150 12:105256201-105256223 AATCCTGAGCAGGAGGTGGAAGG - Intronic
1101823575 12:108202955-108202977 AGACCTGCCCAGGAGGAGGATGG - Intronic
1102998141 12:117365157-117365179 AGCCCTGGGCAGGAGGAGGAAGG + Intronic
1103477725 12:121230855-121230877 ACGCATGAGCAGGGGATGGATGG - Intronic
1103704035 12:122861833-122861855 AGGCTTGGGCACCAGGTGGAGGG - Exonic
1104323525 12:127774220-127774242 AGGAAGGGGCAGGAGATGGAGGG - Intergenic
1104372652 12:128237318-128237340 AGATAAGCGCAGGAAGTGGATGG - Intergenic
1105580189 13:21688330-21688352 AGGCATGCCCTGGAGATGGGTGG + Intronic
1106436075 13:29723878-29723900 AGCCATTTGCAGGGGGTGGAGGG + Intergenic
1107851666 13:44577408-44577430 GGGCAGGCGGAGGAGGAGGAGGG + Intergenic
1110128490 13:71978151-71978173 AGGCCTGAGTAGGACGTGGATGG + Intergenic
1112571887 13:100600886-100600908 AGTCATGGGCAGGAGGTGGGTGG - Intergenic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1113484043 13:110641781-110641803 AGGCACCTGCAGGAGGTGGCGGG + Intronic
1113518827 13:110923792-110923814 AGGGATGGGCAGGAGCTAGAAGG - Intergenic
1113683725 13:112263096-112263118 TGGCAAGCACTGGAGGTGGAAGG - Intergenic
1114992275 14:28301298-28301320 CGGCACCAGCAGGAGGTGGAAGG - Intergenic
1116102888 14:40464661-40464683 AGGCATGTGCATGGGATGGATGG + Intergenic
1116948362 14:50856909-50856931 AGGCAGGCACTGGAGGTGGGTGG - Intergenic
1118151975 14:63199516-63199538 AGCCATGGACAGAAGGTGGATGG - Intergenic
1118731625 14:68670861-68670883 AGAGATGAGCAGGAGATGGATGG - Intronic
1119029640 14:71181756-71181778 AGCCAAGGGCAGGCGGTGGAGGG - Intergenic
1119333671 14:73814649-73814671 AGGCATGAGCAGGAAAAGGAGGG - Intergenic
1119529192 14:75347784-75347806 CTGCTTGGGCAGGAGGTGGATGG + Intergenic
1119592540 14:75903424-75903446 GGGCATGAGCAGGGAGTGGAAGG + Intronic
1120384476 14:83827068-83827090 AGCAATGCCCAGGAGGTGGCAGG - Intergenic
1121314092 14:92950913-92950935 AGGCGTGGGCAGGACCTGGAGGG - Intronic
1122066246 14:99175951-99175973 CGTCATGCGCAGCAGGTTGAAGG + Exonic
1122160228 14:99778527-99778549 AGGAATCTGCAGGAAGTGGATGG - Intronic
1122634548 14:103123860-103123882 AGTCCTGGGCAGGATGTGGAAGG - Exonic
1123018577 14:105387034-105387056 AGGCAGGGGCAGGAGGTGCAGGG - Intronic
1123430948 15:20215944-20215966 AGGAATGGGCAGGAGAGGGAAGG + Intergenic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1124689617 15:31811091-31811113 AGGCATGCAGAGAAGGTGCACGG + Intronic
1126584024 15:50265653-50265675 ATGGACACGCAGGAGGTGGAAGG + Exonic
1127406610 15:58655349-58655371 AAGCATGGGCAGAAGGTGAAGGG + Intronic
1127836114 15:62792612-62792634 AGGCAAGCCCAGGATGGGGAAGG - Intronic
1128300230 15:66562045-66562067 AGGTTTGGGCAGGAGGTGGGAGG - Intronic
1128324520 15:66715530-66715552 AGGCCTGTCCAGGAGTTGGAAGG - Intronic
1128380526 15:67108536-67108558 AGGCATGCTCAGCAGCTGGGGGG - Intronic
1129779740 15:78262839-78262861 GGGCATGTGCAGGAGAGGGATGG - Intergenic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131144015 15:90000352-90000374 CGGCCTGCGCCGGAGCTGGAGGG + Intergenic
1131149990 15:90041748-90041770 AGGAATGCACAGGAGCTGGATGG + Intronic
1131514479 15:93067930-93067952 AGGCAGGACCAGGAGGAGGAAGG + Intronic
1132529990 16:442226-442248 AGGACTGCCCAGGAGCTGGAGGG - Intronic
1132793461 16:1706643-1706665 AGGCAGGCGGAGGAGGTGCGTGG + Exonic
1133128447 16:3662052-3662074 CTGCATGCGCAGGAAGTGGCGGG + Exonic
1136118150 16:28108799-28108821 AGACATGCTCAGGAGGCAGATGG + Intronic
1138449669 16:57086124-57086146 AGGCATGTGAAGGAGGCGAAGGG - Intergenic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1141736768 16:85859397-85859419 ATGCATGCCCAGGAAGTGGAAGG - Intergenic
1141775761 16:86121756-86121778 AGGCAGGAGGAGGAGGAGGAGGG - Intergenic
1142372492 16:89690883-89690905 AGGCAGGTGCTGGGGGTGGAGGG - Intronic
1143637898 17:8176811-8176833 AGGCATGCAGAGGAGGGGAAGGG - Intergenic
1143833287 17:9669887-9669909 AGGCATGCGCTGGAGATGGCTGG + Intronic
1144650563 17:17004443-17004465 AGGCATGCTGAGGAGGTAGGTGG - Intergenic
1144754385 17:17670383-17670405 AGGTATGGGGAGGAGGTGGGAGG + Intergenic
1145060263 17:19728767-19728789 AGCTGTGAGCAGGAGGTGGAAGG - Intergenic
1146590819 17:34126713-34126735 AGGCAGGGGATGGAGGTGGATGG + Intronic
1146909735 17:36641158-36641180 AGGGATGCGCGGGGGGCGGAGGG + Intergenic
1147575185 17:41594866-41594888 AGGGATGAACAGGAGGTGGGTGG + Intergenic
1147661075 17:42117420-42117442 AGGCATGCGCGGCAGCTGGTGGG + Exonic
1148676476 17:49448507-49448529 ATGCATGGGCAGGAAGTGAAAGG + Intronic
1149451065 17:56750418-56750440 AGGCATTGGCAGGAGGTTGGGGG - Intergenic
1151730819 17:75910147-75910169 GGGCAAGCCCAGGAGGAGGAGGG + Intronic
1152374934 17:79914160-79914182 AGGCATTGGCAGGGGGTGGCAGG - Intergenic
1152584647 17:81183551-81183573 AGGCAAGAGATGGAGGTGGAGGG - Intergenic
1152930647 17:83107906-83107928 GGGCCAGCGCAGGAGGTGGGGGG + Intergenic
1152930671 17:83107977-83107999 GGGCAAGTGCAGGAGGTGGGGGG + Intergenic
1152930693 17:83108048-83108070 GGGCAAGCGCAGGAGGTGGGGGG + Intergenic
1153779137 18:8478846-8478868 AGGCATAGCCAGCAGGTGGAGGG + Intergenic
1158332109 18:56374496-56374518 AGGCAGGGGAAGGAGGAGGAGGG - Intergenic
1158684692 18:59602702-59602724 AGGCATGAGTAGGACTTGGAAGG + Intronic
1160588045 18:79923354-79923376 ATGCATGGGCAGGTGGTGGATGG + Intronic
1160735786 19:661848-661870 GAGCAGCCGCAGGAGGTGGAGGG - Intronic
1161029049 19:2049588-2049610 AGGCCTTGGCAGGAGGTGGCTGG + Intronic
1161252863 19:3290402-3290424 GGGCAGGCGAGGGAGGTGGATGG - Intronic
1161322382 19:3647190-3647212 AGGCACTCACAGGAGGAGGAGGG + Intronic
1161322409 19:3647278-3647300 AGGCACTCACAGGAGGAGGAGGG + Intronic
1163262139 19:16197837-16197859 AGGAATGCGCAGGCGCAGGACGG - Intronic
1164064770 19:21706422-21706444 AGGGATGCACAGGATGAGGAAGG + Intergenic
1164145490 19:22510196-22510218 AGGGTGGGGCAGGAGGTGGAGGG + Intronic
1164941677 19:32255921-32255943 AGGAAGGCACAGGAGGTGGGAGG + Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165993214 19:39827473-39827495 AGGGGTGTGCTGGAGGTGGAGGG - Intronic
1166543349 19:43619873-43619895 TGGGATGCGCTGGGGGTGGAGGG + Exonic
1166823902 19:45597739-45597761 GGGCATGGGGAGGAGGGGGAAGG + Intronic
1167487735 19:49772984-49773006 AGGGATGCGGAGGAGGAGGTGGG + Intronic
1167889381 19:52527615-52527637 AGGCCTGGGCGGGAGGTGGGAGG - Intergenic
927114328 2:19886261-19886283 AGGCATTGGCAGAATGTGGAGGG - Intergenic
928370397 2:30736276-30736298 AGGGATGCGTTGGAGGTGGGAGG - Intronic
929172877 2:38948995-38949017 ATCCAGGCACAGGAGGTGGAGGG + Intronic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
930798531 2:55419348-55419370 AGGCATCTGGAGGAGGAGGAAGG + Exonic
930902375 2:56522990-56523012 TGGCCTGGGCAGGAGCTGGAAGG + Intergenic
930981757 2:57534347-57534369 TGGCATGCTGAGGAGGTTGAGGG - Intergenic
931986957 2:67751429-67751451 GGACATGCGCAGGTGGTGCAAGG + Intergenic
932487633 2:72094140-72094162 AGGACTGAGAAGGAGGTGGAGGG - Intergenic
934050014 2:88201987-88202009 AGGCATCTGCAGGAAGGGGACGG + Intergenic
936659240 2:114523805-114523827 TGGGATGAGCAGCAGGTGGAGGG - Intronic
937085253 2:119167405-119167427 AGGCATGAGCAGGGAGGGGAGGG - Intergenic
937908447 2:127064084-127064106 AGGGGTGGGCAGGAGGTGGGAGG - Intronic
937982784 2:127624924-127624946 AGGCATGGGCAGGGGGTGGCAGG + Intronic
938263078 2:129909036-129909058 AGGCAGGGGCTGGAGGTGGCTGG - Intergenic
938930894 2:136086155-136086177 AGGGGAGCGCAGGAAGTGGAAGG + Intergenic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
940993853 2:160126039-160126061 AGGAATGCCCTGGAGGTAGACGG - Intronic
941029133 2:160492803-160492825 TCGCGTGCGCGGGAGGTGGAGGG + Intronic
942666519 2:178325133-178325155 AGGGATGGGCAGGAGTAGGATGG - Intronic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
942856287 2:180553390-180553412 AGGTATGCCCAGGAAGTGTATGG - Intergenic
943494995 2:188609379-188609401 AGGCATTCTCAGAGGGTGGAAGG + Intergenic
944426867 2:199592669-199592691 AGGCAGGCGCAGGAAGAGGCAGG - Intergenic
946026199 2:216673313-216673335 AGGCAGGCGCACGAGGTCCAGGG - Exonic
947640668 2:231706293-231706315 ATGGATGCGCCGCAGGTGGAAGG + Intergenic
947666478 2:231909094-231909116 AGGCATGAGATGGAGGTGGCTGG + Intergenic
948249141 2:236511634-236511656 AGGGATGCTTAGGAGGTGGCAGG - Intergenic
948324004 2:237096532-237096554 AGGCATTCCGAGTAGGTGGAAGG - Intronic
948375479 2:237517840-237517862 AGGCATGGGTGGTAGGTGGATGG + Intronic
948421793 2:237864480-237864502 AGGGAAGCGGGGGAGGTGGATGG + Intronic
948424893 2:237880983-237881005 GGGCAGGGGCAGGAGGAGGAGGG - Intronic
948742447 2:240056784-240056806 GGGCAGGCGCGGGAGGTGGCGGG - Intergenic
948853917 2:240721314-240721336 TGGCATGGGCAGGAGGCGGCAGG - Intronic
948952498 2:241263306-241263328 AGGAAAGCGGAGGAGGTGGATGG + Intronic
1170792187 20:19517392-19517414 AGTCATCAGCTGGAGGTGGAGGG + Intronic
1171158106 20:22895355-22895377 AGGGAGGCTCAGGAGATGGAGGG - Intergenic
1171376352 20:24696568-24696590 GGGCATGGGCTGGAGGGGGAGGG + Intergenic
1172193337 20:33075473-33075495 AAGGATGGGCAGGAGGGGGATGG - Intergenic
1173792047 20:45834127-45834149 AGCCCGGCGCAGGAGGAGGAGGG - Intronic
1174194796 20:48765615-48765637 AGTCATGCAGAGGAGGAGGACGG + Intronic
1175124268 20:56739803-56739825 AGGCGTGTGCAGCAGGTGAAGGG + Intergenic
1175274425 20:57758294-57758316 TGGCATTAGCAGGATGTGGATGG + Intergenic
1175431730 20:58909818-58909840 GGGCAAGCGCAGGGGGTGGGCGG - Intronic
1175715960 20:61253977-61253999 AGGCAGGAGGAGGTGGTGGAGGG - Intronic
1176254712 20:64145949-64145971 AGGCCTGGGCAGGACATGGAGGG - Intergenic
1176618753 21:9041432-9041454 AGGCTAGCGCAGGAGGTGATGGG + Intergenic
1176958965 21:15138488-15138510 AGGCAGGTGGAGGAGTTGGAAGG + Intergenic
1178064166 21:28885402-28885424 AGGCCTGCGCATGAGGGTGAGGG - Intergenic
1178619087 21:34158601-34158623 AGGCATGGCCAGAGGGTGGAGGG + Intergenic
1178816567 21:35935473-35935495 AGGAATGCAGAGGAGGTGGAGGG - Intronic
1178960469 21:37060126-37060148 CTGCATGCTCAGGAGGTGGCAGG - Intronic
1180006742 21:45026167-45026189 AGGCCTGCGCAGGCCATGGATGG - Intergenic
1183138192 22:35910709-35910731 ATGCATGCAAAGGAGGTTGAGGG + Intronic
1183404464 22:37623674-37623696 AGGTGGGGGCAGGAGGTGGAGGG - Intronic
1183418542 22:37696987-37697009 AGCGATGCTCGGGAGGTGGAAGG - Exonic
1183513225 22:38248095-38248117 AGACATGGTCAGGAGGTGGGTGG - Intronic
1183580947 22:38726370-38726392 AGGCATGCGCTTGCGATGGATGG - Exonic
1184146804 22:42616484-42616506 AGGAACGCGCAAGAGGTGGGAGG + Intergenic
1184380795 22:44143808-44143830 GGGCAGGCCCAGGAGGGGGAAGG - Intronic
1185069629 22:48648943-48648965 GGGCATGGTCAGGAGGAGGAGGG + Intronic
1185161560 22:49232939-49232961 AGGCTGGGGCAGGAGGTGCAGGG + Intergenic
950531246 3:13553445-13553467 AGGCAGGACCTGGAGGTGGACGG - Intronic
950563804 3:13752056-13752078 AGTCATGCGAAGGTGGAGGAAGG - Intergenic
950667774 3:14507601-14507623 AGCCACCTGCAGGAGGTGGATGG + Exonic
951979284 3:28547971-28547993 ATGCATGGGCAGGAGGAGAATGG + Intergenic
952278061 3:31896756-31896778 AGGCATAGGCAGGAGCTGGCTGG - Intronic
953042419 3:39267188-39267210 AACCATGAGCAGGAGGGGGAGGG + Intronic
953464280 3:43105621-43105643 AGGGAGGCGCGGGAGGTGGGCGG - Intronic
953882811 3:46700429-46700451 AGGCCTGCGCAGGCTGGGGATGG - Intergenic
954687006 3:52376560-52376582 AGGCAGGCCCAGGAGGAGGCTGG - Intronic
955750383 3:62180472-62180494 AGACATGGGGAGAAGGTGGAAGG + Intronic
959888488 3:111528385-111528407 AGGGATGCTGAAGAGGTGGAGGG - Intronic
961141131 3:124557475-124557497 AGGCATTAGCAGCAGGTGCAGGG + Intronic
961825599 3:129597578-129597600 AATCATGCGCTGGAGGGGGAGGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962428377 3:135296102-135296124 AGGCATGGCCATGAGCTGGAAGG + Intergenic
963410241 3:144918158-144918180 AGGCATGTGCAAAAGGTAGATGG - Intergenic
963499485 3:146107743-146107765 AGGCTGAGGCAGGAGGTGGAAGG - Intronic
964663910 3:159151468-159151490 AGGCCAGAGCAGCAGGTGGAAGG - Intronic
967439269 3:189488323-189488345 AGGCATGCGCAAGAGGGTGCTGG - Intergenic
967946015 3:194804878-194804900 AGTCATGCTCAGGAGGAGAAAGG - Intergenic
968481209 4:833858-833880 AGCCCTGCCCAGGAGCTGGATGG + Intergenic
968544871 4:1193604-1193626 GGGCATGGGAAGGATGTGGAGGG + Intronic
968544879 4:1193626-1193648 GGGCATGGGAAGGATGTGGAGGG + Intronic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
969479768 4:7441669-7441691 GGGCTGGGGCAGGAGGTGGAGGG - Intronic
971105940 4:23524457-23524479 AGGCATCTGTAGGAGGTGGCTGG - Intergenic
971918840 4:32910238-32910260 AGGCACCTGCAGGAGGTGGCTGG - Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
973188990 4:47365662-47365684 AGGCATGGGCAGGAGATTAAAGG + Intronic
973785885 4:54332301-54332323 AGGCATGAGAAGGAAGGGGAGGG + Intergenic
974061055 4:57036294-57036316 AGGCAGGAGGAGGAGGTGGGGGG + Intronic
975281717 4:72569289-72569311 AGGCAGGCGGAGGAGGTGGGAGG + Intergenic
978907567 4:114025916-114025938 AGGCATTTGCAGGAGGGAGATGG - Intergenic
979795363 4:124839659-124839681 AGGGATGGGAAGGGGGTGGAGGG - Intergenic
979947402 4:126850454-126850476 AGTCATGAGCAGGAAGTGGAAGG - Intergenic
982726093 4:158908302-158908324 AGGGTTACGCAGGAGGTGGGTGG - Intronic
984715389 4:182919687-182919709 TGGCAGGCAGAGGAGGTGGAAGG - Intergenic
984885617 4:184446708-184446730 AAGCATGCATAGGAGGCGGACGG + Intronic
984927201 4:184817506-184817528 AGGGCTGCTCAGGAGATGGAAGG - Intronic
985619790 5:948135-948157 AGGCGTGGGAAGGAGGAGGAAGG + Intergenic
985903237 5:2813562-2813584 CGGCAGGCGCAGGCGGTGGCAGG - Intergenic
987322571 5:16784312-16784334 AGGCAAGTGCAGGAGCTGGAGGG + Intronic
992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG + Intergenic
992556894 5:77912843-77912865 AGGAATGTGAAGGAGGAGGAGGG - Intergenic
993457274 5:88141335-88141357 AGGAGGGGGCAGGAGGTGGAGGG + Intergenic
994192914 5:96888301-96888323 ATGGATGTGCAGGAGGTGAATGG + Intronic
995553084 5:113299773-113299795 AGGTGTGGGCAGGAGGTGGCAGG + Intronic
997872391 5:137517054-137517076 AGGCAAGCTCAGGAGGGGCAGGG + Intronic
997991891 5:138551406-138551428 AGGTATACCAAGGAGGTGGATGG + Intergenic
998969195 5:147572912-147572934 AGCCATGGGGAGGAAGTGGAAGG - Intergenic
999370416 5:151051893-151051915 AGGCAAGTGCTGGAGGAGGAAGG + Intronic
999726871 5:154445425-154445447 AGACATGCGGAGGAGGTGATGGG - Intergenic
1000627426 5:163555216-163555238 AAGGATGAGCAGGAGGTGAAGGG - Intergenic
1001289098 5:170443850-170443872 AGAAATGGGCAGGAAGTGGAAGG + Intronic
1002161053 5:177314366-177314388 AGACATGGCCAGGAGGTGGTGGG + Intergenic
1002239638 5:177829417-177829439 AGGCATGCGGACGAAGAGGAAGG - Intergenic
1002860498 6:1075477-1075499 GGGCAGGTGCAGGAGCTGGAAGG - Intergenic
1003156645 6:3602934-3602956 AGGCTTGCTCAGGTGCTGGAAGG + Intergenic
1003384171 6:5652106-5652128 AGGCATGGGCAGGAGATGTGAGG + Intronic
1003427509 6:6007462-6007484 AGGCAAGCGCAGGGGGCGGGCGG - Intronic
1004737167 6:18419206-18419228 AGCCATAGGCAGGAGGAGGAGGG - Intronic
1005943287 6:30577515-30577537 AGCCATGTGAAGGAGGTGGGAGG + Intronic
1007074990 6:39060646-39060668 AGGCATTGGCAGAAGATGGAAGG - Intronic
1007272160 6:40646174-40646196 GGGCATGAGCAGGGGGTGGTGGG - Intergenic
1007687613 6:43676365-43676387 AGGGAATGGCAGGAGGTGGAGGG - Intronic
1007709789 6:43815217-43815239 AGGCAGCAGGAGGAGGTGGATGG + Intergenic
1011314475 6:86016436-86016458 AGGCTGGTGCAGGATGTGGAAGG + Intergenic
1011925930 6:92644787-92644809 AGACATGGACAGAAGGTGGATGG - Intergenic
1013188719 6:107783956-107783978 GGGCAGGGGCAGGAGGTGGCAGG - Intronic
1016480745 6:144478664-144478686 AGGCCAGCACAGGAGCTGGATGG - Intronic
1018799250 6:167210002-167210024 TGCCATGCCCAGGAGGTGAAGGG - Intergenic
1019104063 6:169654796-169654818 AGGCGCGCTCAGGAGGAGGAGGG + Intronic
1019586438 7:1806673-1806695 AGGCATGGGCTGGAGGTCGGGGG + Intergenic
1020080205 7:5282756-5282778 AGGAATGGGGAGGAGGGGGAGGG + Intronic
1020865395 7:13554842-13554864 AGACATGGGCTGGAGGTGGTAGG - Intergenic
1021480321 7:21108161-21108183 GAGCATGCGCAGCAGCTGGAAGG - Intergenic
1021812524 7:24417114-24417136 AGCCATGGGCAGGAGGTAGATGG - Intergenic
1022541474 7:31139781-31139803 AGGGGTGGGCAGGAGGGGGAGGG - Intergenic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023998521 7:45176653-45176675 AGGCATGAGGAGGAAGGGGAGGG + Intronic
1024033201 7:45482735-45482757 AGGGATGCTAAGGAGGTTGATGG - Intergenic
1024225136 7:47320763-47320785 AGGAATGTGCAGGGGGTGGAGGG + Intronic
1026819478 7:73537264-73537286 AGGCAGGGCCAGGAGGCGGAGGG + Exonic
1029460509 7:100691586-100691608 AGGTAAGAGCAGGAGGTGGCGGG + Intergenic
1029989071 7:104946489-104946511 AAGCATGCTCTGGAGGAGGATGG + Intergenic
1030695523 7:112580901-112580923 AGGCCTGAGCAACAGGTGGATGG + Intergenic
1033443697 7:141402408-141402430 AGGAATGAGCAGCAGGGGGAGGG - Intronic
1035074238 7:156168104-156168126 GGGCTTGTGGAGGAGGTGGATGG - Intergenic
1035268153 7:157703648-157703670 AGGCACCTGCAGGAGGTGAAAGG + Intronic
1035380757 7:158439216-158439238 AGGCATGTGCCCGAGGTGGTCGG - Intronic
1035380765 7:158439246-158439268 AGGCATGCGCAGGAGGTGGACGG - Intronic
1035476655 7:159148889-159148911 AGGCATGTGCCTGGGGTGGAGGG - Intergenic
1035737421 8:1898647-1898669 AGGCAGTTACAGGAGGTGGAGGG + Intronic
1036454113 8:8893130-8893152 AGGCAGGGGCAGGAGCCGGAGGG - Exonic
1037622595 8:20577934-20577956 AAGCTTGCACATGAGGTGGAAGG - Intergenic
1042187609 8:66152594-66152616 GGGCATCCGCAGCAGGTGGCAGG - Exonic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG + Intronic
1048533852 8:135274348-135274370 AGGCAAAGGCAAGAGGTGGAAGG + Intergenic
1048874551 8:138826902-138826924 AGGCAGGCCAAGAAGGTGGATGG - Intronic
1049593545 8:143473253-143473275 AGGCCTGGGCAGGAGTGGGAGGG - Intronic
1050211517 9:3263829-3263851 AGGCACTGGCAGGAGATGGAAGG + Intronic
1051353314 9:16218426-16218448 AGGCATGCTCTGGAGCTGGCTGG - Intronic
1051560624 9:18436897-18436919 AGGCAGGAGCAGTAGGTGGAGGG + Intergenic
1051774797 9:20621990-20622012 AGGGAGGCGCGGGGGGTGGAGGG + Intronic
1051796130 9:20872537-20872559 AGGCATGCAGAAGAGGAGGAGGG - Intronic
1052339842 9:27354146-27354168 AGGCAAGCTCTGGGGGTGGATGG + Intronic
1053449140 9:38178987-38179009 TGGAATGAGGAGGAGGTGGAAGG - Intergenic
1053575257 9:39353503-39353525 AGGCTTTTGGAGGAGGTGGAGGG - Intergenic
1053839760 9:42181437-42181459 AGGCTTTTGGAGGAGGTGGAGGG - Intergenic
1054096819 9:60912186-60912208 AGGCTTTTGGAGGAGGTGGAGGG - Intergenic
1054118223 9:61187812-61187834 AGGCTTTTGGAGGAGGTGGAGGG - Intergenic
1054442969 9:65283699-65283721 CGGCGTGCGCAGCAGGTAGAGGG + Exonic
1054589532 9:66994752-66994774 AGGCTTTTGGAGGAGGTGGAGGG + Intergenic
1055709752 9:79047855-79047877 TTGCATTCCCAGGAGGTGGAAGG + Intergenic
1056455070 9:86752119-86752141 AGGCAGGCTCAGGAGCTGGCAGG - Intergenic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057916746 9:99062277-99062299 TGGAAAGCGCAGGGGGTGGAGGG - Exonic
1058472728 9:105297827-105297849 GGGCATGAGCAGGAGGGGGCTGG - Intronic
1058553226 9:106138134-106138156 AGGCAGAAGGAGGAGGTGGAAGG - Intergenic
1060885560 9:127149704-127149726 AGCCATGGCCAGGAGGTTGAAGG + Intronic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1185610546 X:1391788-1391810 AGGCGGGCGCCGGAAGTGGAAGG - Intronic
1185701446 X:2233728-2233750 AGACATGGGCAGTGGGTGGATGG + Intronic
1189318111 X:40069974-40069996 AGGGATGAGCTGGAAGTGGAGGG + Intronic
1190170290 X:48107099-48107121 AGGCTGAGGCAGGAGGTGGAAGG - Intergenic
1190188202 X:48254463-48254485 AGGCTGAGGCAGGAGGTGGAAGG - Intronic
1190657096 X:52622227-52622249 AGGCTGAGGCAGGAGGTGGAAGG - Intergenic
1190909051 X:54755572-54755594 AGGCATGAGCTGGAGTTCGAAGG + Intronic
1192216667 X:69164165-69164187 AGGGATGTGCTTGAGGTGGATGG + Intronic
1192318024 X:70067023-70067045 AGGCAGGCGAAGGCTGTGGAAGG + Intergenic
1195849953 X:109272051-109272073 AGGAATGCGCAGTATGTGGTAGG - Intergenic
1196195297 X:112832938-112832960 AGGCAACAGCAGGAGGAGGAGGG - Intronic
1196685192 X:118504705-118504727 AGGCATGCAGAGGAGTTGGTGGG + Intronic
1198158227 X:133983794-133983816 GGGCATGTGCAGGAGCTGTAAGG - Intronic
1200182021 X:154156396-154156418 AAGCATGCGAAGAAGGTGTAGGG - Exonic