ID: 1035385515

View in Genome Browser
Species Human (GRCh38)
Location 7:158469840-158469862
Sequence CTGTCGCCATAACAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035385512_1035385515 -4 Left 1035385512 7:158469821-158469843 CCTATTGCATCACAATGGGCTGT 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1035385515 7:158469840-158469862 CTGTCGCCATAACAGGAGCTGGG 0: 1
1: 1
2: 0
3: 3
4: 93
1035385507_1035385515 28 Left 1035385507 7:158469789-158469811 CCATCATAAAAGAATTGGGAGCT 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1035385515 7:158469840-158469862 CTGTCGCCATAACAGGAGCTGGG 0: 1
1: 1
2: 0
3: 3
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035385515 Original CRISPR CTGTCGCCATAACAGGAGCT GGG Intronic
901326757 1:8371274-8371296 CTTTGGCAATGACAGGAGCTTGG + Intronic
902877384 1:19349152-19349174 CTGTCTGCTCAACAGGAGCTGGG + Intronic
903003995 1:20286485-20286507 CTGTCTCCAAAACTTGAGCTTGG + Intergenic
911527181 1:99002134-99002156 CTGTCACCATGTGAGGAGCTGGG - Intronic
919974502 1:202602038-202602060 CAGGTGCCATACCAGGAGCTTGG - Exonic
920891731 1:209993482-209993504 CTGTGGCCAGCACATGAGCTGGG + Intronic
922722846 1:227907478-227907500 CTGTGGCCATAAAAAGAGCAGGG - Intergenic
1065397505 10:25255494-25255516 CTGTGGTCTTATCAGGAGCTTGG + Intronic
1065835184 10:29650920-29650942 CTGTCTCCAAAACAAGAGCATGG + Intronic
1069705405 10:70456394-70456416 GTGTGGCCAAGACAGGAGCTGGG - Intergenic
1071210823 10:83339878-83339900 CTGGCCTCATAAAAGGAGCTAGG + Intergenic
1075026965 10:118992569-118992591 CTGTCACCAGAACTGGTGCTGGG - Intergenic
1075182249 10:120222141-120222163 CTGTGGGCATGGCAGGAGCTGGG - Intergenic
1075456052 10:122585734-122585756 CTCTCCCCATCTCAGGAGCTTGG - Intronic
1075458180 10:122598437-122598459 CTCTCCCCATCTCAGGAGCTTGG - Intronic
1078224646 11:9380920-9380942 CTGTATCCAAAAAAGGAGCTTGG - Intergenic
1080945717 11:36971898-36971920 CTGTCTCCATCAAAGTAGCTTGG + Intergenic
1085516715 11:77116004-77116026 CTGCCACCATGACAGGGGCTGGG - Intronic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1095142711 12:38686365-38686387 CTGTCCCCAGAATAAGAGCTTGG - Intronic
1107566416 13:41609974-41609996 CTGTTGCCATAATAGGAGTAAGG - Intronic
1118841784 14:69518944-69518966 CTGTCACCAAAATAAGAGCTAGG - Intronic
1120025973 14:79584655-79584677 CTGTACCCATAGCAGTAGCTGGG - Intronic
1122099564 14:99396696-99396718 GTGGCGCCGGAACAGGAGCTTGG + Intergenic
1144684091 17:17214906-17214928 CTGTTTCCAAAAGAGGAGCTGGG - Intronic
1144834905 17:18151620-18151642 CTCCCTCCCTAACAGGAGCTGGG - Intronic
1145407080 17:22610378-22610400 CTATCCCTATAACAGGTGCTAGG - Intergenic
1155430099 18:25746169-25746191 CTGTCCCCATAAAATGAGTTAGG - Intergenic
1158961135 18:62588410-62588432 CTGGCACCAAAACAAGAGCTTGG - Intergenic
1160048107 18:75406615-75406637 CTGTCGCCACACCCTGAGCTGGG - Intergenic
1161290290 19:3490507-3490529 CTGCACCCACAACAGGAGCTGGG + Intergenic
1161741781 19:6025294-6025316 CAGTCCCCATGACAGGAGGTTGG - Intronic
1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG + Intronic
1165226284 19:34357503-34357525 CTGTCTCCACAACAGGAGGCAGG - Intergenic
1166474260 19:43107905-43107927 CTGTTGCCATAACAGCACCAAGG + Intronic
1168009263 19:53517414-53517436 CTCTGGCCATAAAAGAAGCTGGG + Intergenic
1168009439 19:53518896-53518918 CTGTGGCCATAAAAGGAGCAAGG - Intergenic
1168154740 19:54466489-54466511 CTGTCTTCAGAACAGGAGCCTGG - Intronic
928775436 2:34755796-34755818 CTGTCCCCATAAAATGAGTTAGG - Intergenic
932007046 2:67937651-67937673 CTGTCACCATGACAGCAGCAAGG + Intergenic
934571853 2:95377534-95377556 CTGTCCCCATGGCAGGGGCTAGG - Intronic
935060421 2:99602214-99602236 CTGTAGCGATTACAGGTGCTGGG + Intronic
942508056 2:176664902-176664924 CTGTGTCTATAAAAGGAGCTTGG + Intergenic
944626486 2:201574777-201574799 CAGTGGCCAAAACAGGGGCTAGG - Intronic
946848005 2:223878246-223878268 CTGTTGTCAGAGCAGGAGCTGGG - Exonic
947158721 2:227190003-227190025 CTAACGCCATAACAGTGGCTAGG + Intronic
1175977667 20:62719848-62719870 CTGGCCTCATAACATGAGCTGGG + Intronic
1179434196 21:41349004-41349026 CTTTCCCCATAGCAGGAGCTTGG - Intronic
1181678908 22:24477540-24477562 CTGTCCCCATGACAGGAGGCAGG - Intergenic
1185109693 22:48894083-48894105 CTGTAGTCATTACAGGTGCTCGG + Intergenic
1185190753 22:49434360-49434382 CTGTCCTCGTCACAGGAGCTTGG + Intronic
953960443 3:47262138-47262160 CTGTAACCATCACAGGAGGTGGG + Intronic
957635620 3:82780086-82780108 CTGTCGCCAGAACAGGATGGGGG + Intergenic
961793722 3:129394472-129394494 CTGTCAACATCAAAGGAGCTGGG - Intergenic
961809958 3:129515919-129515941 CTGTCAACATCAAAGGAGCTGGG - Intronic
962843099 3:139252868-139252890 CTGTCCCCAGAAGAGGGGCTGGG - Intronic
966176891 3:177148378-177148400 CTTTAGCCATAAGAGAAGCTGGG - Intronic
966822864 3:183938801-183938823 CTGTTGCCACAGCAGCAGCTGGG + Intronic
969052052 4:4380089-4380111 CTGTCTCTAGGACAGGAGCTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969581712 4:8069141-8069163 CTCACGCCTTAACGGGAGCTGGG - Intronic
977821410 4:101476334-101476356 CTTTCTCCATAATAAGAGCTAGG - Intronic
979003960 4:115264741-115264763 CTGTCCTCATAACATGAGTTAGG + Intergenic
981778147 4:148394043-148394065 CTGCTGCCATTTCAGGAGCTTGG + Intronic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
988153690 5:27420998-27421020 CTGGCCTCATAACATGAGCTTGG + Intergenic
991946576 5:71903410-71903432 CTATCCCCAAAACAGGATCTAGG - Intergenic
997658263 5:135571186-135571208 GTCTCGCCATCACAGGATCTTGG + Exonic
997804368 5:136900602-136900624 CTGTCTTCATAAAATGAGCTCGG + Intergenic
1003998621 6:11570243-11570265 CAATAGCCATAACAGGAGTTTGG - Intronic
1007225276 6:40309348-40309370 CTGTGGCCTTGCCAGGAGCTGGG - Intergenic
1009618135 6:66037662-66037684 CTGTTGCAAGAACAGGAGCAAGG + Intergenic
1010070505 6:71738715-71738737 ATGGTGCCATATCAGGAGCTTGG - Intergenic
1014497810 6:122148501-122148523 CTTTCACCATCAGAGGAGCTAGG + Intergenic
1015452479 6:133387159-133387181 CTGTCTACATAATAGGAGTTAGG - Intronic
1016878612 6:148888253-148888275 CTGTCGCCATGACAGCACCAAGG + Intronic
1024344755 7:48301694-48301716 CTGTCACCACATCAGGAGATTGG + Intronic
1024571332 7:50725074-50725096 CAGTCGCCATTACAGCAGGTAGG - Intronic
1029102124 7:98139886-98139908 CAGGCACCATAACAGAAGCTGGG - Intronic
1033294454 7:140118450-140118472 CTGTCGCCATTGCATGATCTCGG + Intronic
1035385515 7:158469840-158469862 CTGTCGCCATAACAGGAGCTGGG + Intronic
1035385527 7:158469926-158469948 CTGTTGCCATAACAGGAGCTGGG + Intronic
1036586046 8:10124515-10124537 CTGGTGCCATAATTGGAGCTAGG + Intronic
1038654184 8:29433755-29433777 CTGTCGCCATGGCATGATCTTGG + Intergenic
1047576058 8:126156618-126156640 CTGTACCCATCACAGTAGCTGGG + Intergenic
1047979788 8:130168781-130168803 CTGGGGCCATAAGAGGAGCAGGG - Intronic
1049352885 8:142173475-142173497 CTGTCCTCACAACAAGAGCTCGG + Intergenic
1049545854 8:143230205-143230227 CTGCTTCCATGACAGGAGCTGGG - Intergenic
1052692592 9:31834303-31834325 CTGTTCCCTTAACAGCAGCTTGG - Intergenic
1186741822 X:12526249-12526271 CTCTCTCCATAGCAAGAGCTGGG + Intronic
1191612549 X:63132798-63132820 GTGTCACCATAATAGGAACTGGG + Intergenic
1191623748 X:63246128-63246150 GTGTCACCATAATAGGAACTGGG - Intergenic
1192801277 X:74466939-74466961 CTGTGGCCATAAAATGATCTGGG - Intronic
1195103729 X:101582537-101582559 CTGTCCTCATAAAATGAGCTAGG + Intergenic
1200254248 X:154571113-154571135 CTGTCACCATAAATGGTGCTTGG + Intergenic
1200263521 X:154633295-154633317 CTGTCACCATAAATGGTGCTTGG - Intergenic
1200281185 X:154778343-154778365 CTGTAGCCATATCATGAGCCAGG + Intergenic
1202043279 Y:20710057-20710079 CTGTCCCCATAAAAGGAGTTAGG - Intergenic