ID: 1035385527

View in Genome Browser
Species Human (GRCh38)
Location 7:158469926-158469948
Sequence CTGTTGCCATAACAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035385524_1035385527 -4 Left 1035385524 7:158469907-158469929 CCTATTGCATCATAACGGGCTGT 0: 1
1: 0
2: 1
3: 5
4: 40
Right 1035385527 7:158469926-158469948 CTGTTGCCATAACAGGAGCTGGG 0: 1
1: 1
2: 0
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035385527 Original CRISPR CTGTTGCCATAACAGGAGCT GGG Intronic
901326757 1:8371274-8371296 CTTTGGCAATGACAGGAGCTTGG + Intronic
908857910 1:68450113-68450135 CTGTTCCCATAACAGTTGTTTGG + Intergenic
911771496 1:101748309-101748331 CTGTTGGCAGACCAGAAGCTGGG + Intergenic
911947133 1:104126093-104126115 CTGCTGTCTTGACAGGAGCTGGG + Intergenic
916458234 1:164993073-164993095 CTGTTGGGAGAAGAGGAGCTAGG - Intergenic
918008129 1:180561292-180561314 TTCTTGCCATAACTGCAGCTGGG - Intergenic
918223815 1:182460342-182460364 CTATTGCCAAAACATGGGCTGGG - Intronic
919974502 1:202602038-202602060 CAGGTGCCATACCAGGAGCTTGG - Exonic
920891731 1:209993482-209993504 CTGTGGCCAGCACATGAGCTGGG + Intronic
921260016 1:213378037-213378059 GAGCTGCCCTAACAGGAGCTGGG - Intergenic
922722846 1:227907478-227907500 CTGTGGCCATAAAAAGAGCAGGG - Intergenic
1063718348 10:8553071-8553093 CTTTTGCCATGACTGAAGCTGGG - Intergenic
1065397505 10:25255494-25255516 CTGTGGTCTTATCAGGAGCTTGG + Intronic
1065416702 10:25496002-25496024 TGGTTGTCATAACTGGAGCTGGG - Intronic
1065874380 10:29984118-29984140 CTGTTGCCATCACAGAGACTTGG - Intergenic
1069705405 10:70456394-70456416 GTGTGGCCAAGACAGGAGCTGGG - Intergenic
1072236682 10:93459898-93459920 CTGCTCCCATAACCGGGGCTTGG + Intronic
1073534166 10:104260142-104260164 CTGCTGCCTTTTCAGGAGCTTGG + Intronic
1075182249 10:120222141-120222163 CTGTGGGCATGGCAGGAGCTGGG - Intergenic
1078219127 11:9336584-9336606 CTCTTGCCATAAGTGTAGCTTGG + Intergenic
1078224646 11:9380920-9380942 CTGTATCCAAAAAAGGAGCTTGG - Intergenic
1085235004 11:75007778-75007800 CTGTTGCAATAACAGGCTATGGG - Exonic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1091957322 12:4657597-4657619 CTGTTGTAATAAATGGAGCTTGG + Intronic
1097843731 12:64345377-64345399 ATGTTGCCATTACTGGGGCTAGG + Intronic
1107566416 13:41609974-41609996 CTGTTGCCATAATAGGAGTAAGG - Intronic
1109791649 13:67256337-67256359 CTGTTGCTGTAACACAAGCTAGG - Intergenic
1114581555 14:23765004-23765026 GTCTTGCCATAACTTGAGCTGGG - Intergenic
1115310171 14:31971443-31971465 CTGGTCTCATAAGAGGAGCTGGG + Intergenic
1120025973 14:79584655-79584677 CTGTACCCATAGCAGTAGCTGGG - Intronic
1120968654 14:90189843-90189865 TTGCTGCCATCACAGGAGTTTGG + Intergenic
1130016986 15:80195260-80195282 ATGGTGCCATATCAGGGGCTTGG - Intergenic
1131217600 15:90552117-90552139 CTGCTGCCACAGCAGGCGCTCGG - Intronic
1131885354 15:96906500-96906522 CTTTTCCCATAAGATGAGCTGGG + Intergenic
1133030103 16:3006638-3006660 CTGTTCCCTTCACAGGTGCTAGG + Intergenic
1136370865 16:29835222-29835244 CTGTTGGCATAGCAGCAACTTGG + Intronic
1142937359 17:3346433-3346455 CTGTTCCCATTACAGGCTCTTGG - Intergenic
1143763813 17:9124330-9124352 CTGTTGCCATGACAGTCGGTTGG + Intronic
1144684091 17:17214906-17214928 CTGTTTCCAAAAGAGGAGCTGGG - Intronic
1151261076 17:72916501-72916523 CTGTTACCATGGCAGCAGCTGGG + Intronic
1157548829 18:48566586-48566608 CTGATGCCACCACAGGACCTTGG - Intronic
1158087009 18:53662940-53662962 TTGTTGCCATAATAGCAGCATGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1159904591 18:74078148-74078170 CTGCTGCCAGATCAAGAGCTGGG + Intronic
1161290290 19:3490507-3490529 CTGCACCCACAACAGGAGCTGGG + Intergenic
1165147039 19:33737466-33737488 CTGTGGCCATAATTAGAGCTGGG + Intronic
1166467644 19:43047115-43047137 CTGTTGCTATAACAGCACCAAGG + Intronic
1166474260 19:43107905-43107927 CTGTTGCCATAACAGCACCAAGG + Intronic
1166494901 19:43293461-43293483 CTGTTGCTATAACAGCACCAAGG + Intergenic
1168009263 19:53517414-53517436 CTCTGGCCATAAAAGAAGCTGGG + Intergenic
1168009439 19:53518896-53518918 CTGTGGCCATAAAAGGAGCAAGG - Intergenic
925352647 2:3212397-3212419 CTCTTCCCACACCAGGAGCTGGG + Intronic
927823496 2:26290043-26290065 CTGTTTTCCTAAGAGGAGCTAGG - Exonic
928725465 2:34168586-34168608 ATGTTGGTTTAACAGGAGCTAGG + Intergenic
935060421 2:99602214-99602236 CTGTAGCGATTACAGGTGCTGGG + Intronic
936089586 2:109492436-109492458 CTGTTAGCATCACAAGAGCTGGG + Intronic
937052547 2:118904265-118904287 CTGTTGTGCAAACAGGAGCTGGG - Intergenic
940245662 2:151612702-151612724 CAGTTTCCATAAGAGGAGGTAGG - Intronic
940843183 2:158608848-158608870 CTGTTGCCATAGCCGAAGTTCGG + Intronic
941004273 2:160231874-160231896 CTGTTGCCATATCAGAATTTGGG + Intronic
942508056 2:176664902-176664924 CTGTGTCTATAAAAGGAGCTTGG + Intergenic
944626486 2:201574777-201574799 CAGTGGCCAAAACAGGGGCTAGG - Intronic
946747185 2:222858116-222858138 ATATTGACATAACAGGAGTTTGG + Intergenic
946848005 2:223878246-223878268 CTGTTGTCAGAGCAGGAGCTGGG - Exonic
1168802384 20:651925-651947 CTGTTGCCACAATAGTAGCACGG - Intronic
1175446198 20:59021562-59021584 CTGTTTCCATATTAAGAGCTTGG + Intronic
1177415794 21:20792105-20792127 CTGATGAGATATCAGGAGCTGGG + Intergenic
1179434196 21:41349004-41349026 CTTTCCCCATAGCAGGAGCTTGG - Intronic
1179768078 21:43589031-43589053 CTGTTGCTATAACAAGTTCTTGG - Intronic
1185109693 22:48894083-48894105 CTGTAGTCATTACAGGTGCTCGG + Intergenic
1185316427 22:50181160-50181182 CTCTTGCCATTAAAAGAGCTGGG + Intergenic
953960443 3:47262138-47262160 CTGTAACCATCACAGGAGGTGGG + Intronic
955001014 3:54928125-54928147 CAGTTTCCATAAGAGGATCTTGG + Intronic
956982363 3:74653857-74653879 ATGTTGCCATAATAAGAGATAGG + Intergenic
959052380 3:101536536-101536558 CTGTTGCCATATAATCAGCTTGG + Intergenic
962502784 3:136011915-136011937 CAGATGTCAAAACAGGAGCTTGG - Intronic
965674116 3:171176710-171176732 CTGCTGCCATTGCAGCAGCTGGG + Intronic
966176891 3:177148378-177148400 CTTTAGCCATAAGAGAAGCTGGG - Intronic
966822864 3:183938801-183938823 CTGTTGCCACAGCAGCAGCTGGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969426877 4:7129694-7129716 CTGTTGCCCTGACAGCCGCTGGG + Intergenic
972338455 4:38129361-38129383 CTGGTGCCATACCAGGAGGGTGG + Intronic
973996602 4:56465595-56465617 CATATGCCATATCAGGAGCTGGG + Intergenic
977150956 4:93510971-93510993 CTGTTGCCAAAACTGGAGTGCGG + Intronic
981778147 4:148394043-148394065 CTGCTGCCATTTCAGGAGCTTGG + Intronic
982554027 4:156838360-156838382 CAATTGCCATAGCAGGAACTAGG - Intronic
984510787 4:180676417-180676439 CTGTTGCCATAACATCAGGATGG + Intergenic
984786658 4:183573559-183573581 CTGTTGCCATGACAGCACCAAGG + Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
991327154 5:65446980-65447002 CTGTTACCATAAAAAGAACTTGG + Intronic
999009108 5:148015602-148015624 CTGTTCGCATTACAGGAGTTTGG + Intergenic
999629109 5:153551824-153551846 CTCTTGGCATAACTGAAGCTAGG - Intronic
1001978076 5:176017143-176017165 ATGTTGCCATTGCAGAAGCTGGG + Intronic
1002239343 5:177826619-177826641 ATGTTGCCATTGCAGAAGCTGGG - Intergenic
1003998621 6:11570243-11570265 CAATAGCCATAACAGGAGTTTGG - Intronic
1006183547 6:32167906-32167928 CTGTTGTCCTCACAGGAGCCTGG - Exonic
1007225276 6:40309348-40309370 CTGTGGCCTTGCCAGGAGCTGGG - Intergenic
1009618135 6:66037662-66037684 CTGTTGCAAGAACAGGAGCAAGG + Intergenic
1010070505 6:71738715-71738737 ATGGTGCCATATCAGGAGCTTGG - Intergenic
1013273996 6:108566805-108566827 TTGGTGCTATAAAAGGAGCTGGG + Intronic
1015289291 6:131520219-131520241 CTGCTGCTACAACAGGATCTTGG + Intergenic
1017350026 6:153429368-153429390 TTGTTTCCTTAACAGGAGTTGGG + Intergenic
1017646287 6:156542622-156542644 GTGTTGCCAAAACAGAAACTGGG + Intergenic
1017875596 6:158521633-158521655 CTGTTGAAATATCAGGTGCTGGG - Intergenic
1018099878 6:160428044-160428066 CTGTTGACATAAGAGGAGAAAGG - Intronic
1018518717 6:164618156-164618178 GTGTTGTCATAACAGTATCTGGG - Intergenic
1019449275 7:1088392-1088414 CTGTTCCCATAACAGGACAGCGG - Intronic
1020619458 7:10500402-10500424 CTGTTGTCATAAAATGAGTTAGG - Intergenic
1022450073 7:30505746-30505768 CTGATGCCAGGTCAGGAGCTAGG + Intronic
1028380316 7:90192611-90192633 CTGTTACCAAAAAAGGGGCTTGG + Intronic
1029432558 7:100540374-100540396 CTGTTGCCATGACTGGATCCTGG + Intronic
1031965051 7:128021803-128021825 CATCTGCCATAACAGGACCTAGG - Intronic
1035385515 7:158469840-158469862 CTGTCGCCATAACAGGAGCTGGG + Intronic
1035385527 7:158469926-158469948 CTGTTGCCATAACAGGAGCTGGG + Intronic
1036586046 8:10124515-10124537 CTGGTGCCATAATTGGAGCTAGG + Intronic
1041901225 8:62985235-62985257 CTCTTCCCAAAACAGGAACTCGG + Intronic
1044095608 8:88060304-88060326 CTGTTGAAATAACATAAGCTAGG - Intronic
1046206658 8:111008389-111008411 CTGTTACCCAAACTGGAGCTTGG + Intergenic
1047576058 8:126156618-126156640 CTGTACCCATCACAGTAGCTGGG + Intergenic
1047979788 8:130168781-130168803 CTGGGGCCATAAGAGGAGCAGGG - Intronic
1048654699 8:136522829-136522851 ATGTTGCCACTACAGGAGATGGG + Intergenic
1049545854 8:143230205-143230227 CTGCTTCCATGACAGGAGCTGGG - Intergenic
1052237935 9:26235091-26235113 GTTTTGTCATAACAGGAGCAGGG - Intergenic
1052692592 9:31834303-31834325 CTGTTCCCTTAACAGCAGCTTGG - Intergenic
1058542181 9:106023000-106023022 CTGTTGCCACGAGATGAGCTGGG + Intergenic
1186191767 X:7073657-7073679 CTGCTTCCCTGACAGGAGCTTGG + Intronic
1186279285 X:7975549-7975571 ATGTTGCCATTACAGGGGATGGG - Intergenic
1186470143 X:9814688-9814710 ATGTTGCCATTACAGGGGATGGG + Intronic
1187209674 X:17217123-17217145 TTGTTGCCATAACTGGAGGAGGG - Intergenic
1187675015 X:21707726-21707748 CTGTTGCCATAACAAGGGTGTGG + Intronic
1188633089 X:32392709-32392731 CTTTTGCCATAACTGGCACTTGG - Intronic
1191916154 X:66203521-66203543 CTATTGCCCTGACCGGAGCTGGG + Exonic
1192188167 X:68970676-68970698 CTGTTCTCATAAAATGAGCTTGG - Intergenic
1192801277 X:74466939-74466961 CTGTGGCCATAAAATGATCTGGG - Intronic
1194435314 X:93862170-93862192 CTGTTGCCATAACCAGATTTGGG + Intergenic
1196140117 X:112252310-112252332 CTGCTGTAATAACATGAGCTTGG + Intergenic
1197155856 X:123269548-123269570 CTGTTCCCAGGAGAGGAGCTGGG + Intronic
1199271299 X:145885606-145885628 TGGTTGCCGTAACAGGAGCAGGG - Intergenic
1200281185 X:154778343-154778365 CTGTAGCCATATCATGAGCCAGG + Intergenic
1202043279 Y:20710057-20710079 CTGTCCCCATAAAAGGAGTTAGG - Intergenic
1202172112 Y:22060771-22060793 CTGTTGCCATAACCAGCGCAGGG - Intergenic
1202219250 Y:22525600-22525622 CTGTTGCCATAACCAGCGCAGGG + Intergenic
1202323931 Y:23670465-23670487 CTGTTGCCATAACCAGCGCAGGG - Intergenic
1202546840 Y:25999589-25999611 CTGTTGCCATAACCAGCGCAGGG + Intergenic