ID: 1035391323

View in Genome Browser
Species Human (GRCh38)
Location 7:158506805-158506827
Sequence CTATGGCGATGGCGGAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035391323_1035391331 -8 Left 1035391323 7:158506805-158506827 CCGCCCCTCCGCCATCGCCATAG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1035391331 7:158506820-158506842 CGCCATAGGAAGGACACACCTGG 0: 1
1: 0
2: 0
3: 8
4: 75
1035391323_1035391332 -7 Left 1035391323 7:158506805-158506827 CCGCCCCTCCGCCATCGCCATAG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1035391332 7:158506821-158506843 GCCATAGGAAGGACACACCTGGG 0: 1
1: 0
2: 0
3: 10
4: 135
1035391323_1035391337 18 Left 1035391323 7:158506805-158506827 CCGCCCCTCCGCCATCGCCATAG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1035391337 7:158506846-158506868 AGCCCGATGGTTGCAAGAGCAGG No data
1035391323_1035391341 26 Left 1035391323 7:158506805-158506827 CCGCCCCTCCGCCATCGCCATAG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1035391341 7:158506854-158506876 GGTTGCAAGAGCAGGATGGCAGG No data
1035391323_1035391334 5 Left 1035391323 7:158506805-158506827 CCGCCCCTCCGCCATCGCCATAG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1035391334 7:158506833-158506855 ACACACCTGGGCCAGCCCGATGG 0: 1
1: 0
2: 2
3: 34
4: 396
1035391323_1035391340 22 Left 1035391323 7:158506805-158506827 CCGCCCCTCCGCCATCGCCATAG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1035391340 7:158506850-158506872 CGATGGTTGCAAGAGCAGGATGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035391323 Original CRISPR CTATGGCGATGGCGGAGGGG CGG (reversed) Intronic
900411821 1:2516023-2516045 CTATAGGGATGGTGGAGGAGGGG - Intronic
903168450 1:21537564-21537586 GTAGGGGGATGGCGGTGGGGGGG - Intronic
903398246 1:23019393-23019415 CTATGGCTGCGGGGGAGGGGCGG + Intergenic
903844204 1:26267784-26267806 CTATGGGGAAGGCAGAGGGACGG - Intronic
904498789 1:30902368-30902390 CTCTGGCCATGGCGGGAGGGGGG + Intronic
906146937 1:43565887-43565909 CCATGGCGACGGTGGAGCGGCGG - Intronic
908228425 1:62079740-62079762 CAATGGCGATGGCAGAGAGGAGG - Intronic
911385991 1:97176350-97176372 CTATGGAGATGGAGAAGGTGTGG + Intronic
912411350 1:109482846-109482868 TTAATGCGATGGCGGCGGGGGGG + Intergenic
915490549 1:156247873-156247895 CTATGGAAATGGGGGAGGGGTGG + Intronic
917329617 1:173868266-173868288 CTCTGGGGATGGGGGAAGGGGGG + Intronic
919852670 1:201683792-201683814 CTATGGAAATGGGGGAGGGCGGG - Intronic
921160466 1:212468704-212468726 CTAAGGCGGTGGGGGTGGGGGGG - Intergenic
922912354 1:229228378-229228400 ATATGGCGGCGGCGGGGGGGTGG - Intergenic
923147239 1:231206869-231206891 CTATGATGATGGGGTAGGGGTGG + Intronic
1064416309 10:15153246-15153268 TTTTAGAGATGGCGGAGGGGAGG - Intronic
1066602771 10:37125703-37125725 CGAGGGCGATTGGGGAGGGGTGG + Intergenic
1067058258 10:43064736-43064758 GAAGGGGGATGGCGGAGGGGTGG - Intergenic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1075312711 10:121428264-121428286 CTATGTCGATGTGGGATGGGAGG + Intergenic
1076701008 10:132272688-132272710 CTAGGGCGAGGGTGGAGGCGGGG - Intronic
1078918783 11:15807244-15807266 CTGTGGCTGTGGAGGAGGGGTGG - Intergenic
1080865417 11:36190062-36190084 CTAGGGGGAGGGGGGAGGGGAGG + Intronic
1081758581 11:45561367-45561389 CCAGGGAGATGGCGGAGGTGGGG + Intergenic
1081841431 11:46204274-46204296 CTATGGCTAAGGTGGAGTGGAGG + Intergenic
1082922480 11:58510607-58510629 ATATGGCGGGGGCGGGGGGGTGG - Intergenic
1085119274 11:73956985-73957007 CTCTGGGGATGGCGGCGAGGCGG + Intronic
1085461402 11:76696041-76696063 CTATGGCAGTGGCGGGGCGGTGG + Intergenic
1086417742 11:86606075-86606097 CTTTGGGGAGGGAGGAGGGGTGG - Intronic
1087772110 11:102222149-102222171 CCATGGCGATTGTGGAGGTGAGG + Intronic
1089583789 11:119497395-119497417 CTATGGCAATGGAGGAGTTGGGG + Intergenic
1091921440 12:4308110-4308132 CTGGGGAGATGGCGGAGGCGGGG - Intergenic
1103414825 12:120737060-120737082 CCATGGCGATGGCGTAGGCCAGG - Exonic
1103702503 12:122855196-122855218 CTATGGAGATGGCGGAAGGAGGG + Intronic
1104050444 12:125190650-125190672 CGATGGTGATGGGGAAGGGGTGG + Intronic
1104050598 12:125191092-125191114 CGATGGTGATGGGGAAGGGGTGG + Intronic
1107601033 13:42012505-42012527 TGATGGTGATGGCGGTGGGGAGG + Intergenic
1113574186 13:111382582-111382604 CTGTGGTGATGGAGGTGGGGTGG + Intergenic
1118729307 14:68655372-68655394 ACATGGTGATGGGGGAGGGGAGG + Intronic
1119470950 14:74898812-74898834 CTGTGGAGCTGGGGGAGGGGAGG - Intronic
1121253258 14:92514532-92514554 CTACGGCCAGGGCAGAGGGGCGG - Intronic
1121720046 14:96102932-96102954 CTATGGTGGTGGGGGATGGGAGG + Intergenic
1122151925 14:99730302-99730324 CTCTGGCCACGGCGTAGGGGTGG + Intergenic
1124641242 15:31397859-31397881 CTTTGGGGGTGGCGGCGGGGGGG + Intronic
1124828074 15:33119430-33119452 CTCTTGCGATGGAGCAGGGGAGG - Intronic
1128119431 15:65134696-65134718 CTGGGGCGAAGGCGGAGGGGGGG - Intergenic
1128149794 15:65355666-65355688 CTATTGCTATGCGGGAGGGGCGG - Intronic
1128582860 15:68820987-68821009 CAATGGCAGTGGCGGCGGGGGGG + Intronic
1130884137 15:88079078-88079100 ATGTGGTGTTGGCGGAGGGGTGG + Intronic
1134509283 16:14833723-14833745 CTCTGGCGGCGGCGGTGGGGCGG + Exonic
1134974854 16:18562147-18562169 CTCTGGCGGCGGCGGTGGGGCGG - Intronic
1136074572 16:27808083-27808105 CTCTGGGGTGGGCGGAGGGGAGG - Intronic
1139559721 16:67734408-67734430 CTATAGCGGTGGTGGAGGGAAGG - Intronic
1141973070 16:87495786-87495808 AGATGGGGATGGGGGAGGGGTGG - Intergenic
1142421582 16:89973744-89973766 GAATGGAGATGGCGGGGGGGGGG - Intergenic
1143585323 17:7847837-7847859 CCCTCGCGATGGGGGAGGGGTGG - Exonic
1145978554 17:28998120-28998142 CTATGGGGAGGGAGGAGGGATGG + Intronic
1146748568 17:35354483-35354505 CTGTGGCAGTGGAGGAGGGGGGG - Intronic
1147161675 17:38572491-38572513 CTAATGCGGTGGGGGAGGGGAGG + Intronic
1148691615 17:49530503-49530525 CCAGGGGGTTGGCGGAGGGGAGG - Intergenic
1151849834 17:76683741-76683763 TGAAGGCGATGGAGGAGGGGAGG + Intronic
1152632675 17:81417556-81417578 CTTTGGCTAGGGCGGGGGGGGGG - Intronic
1152653631 17:81509180-81509202 ATATGGGGATGGGGGAGAGGAGG - Intergenic
1153791869 18:8586379-8586401 CTCTGCCGATAGCTGAGGGGAGG + Intergenic
1155326860 18:24673109-24673131 CAAGGGCGGTGGGGGAGGGGAGG - Intergenic
1155760378 18:29558152-29558174 CTTTGGCGATGGGGGTGGGCAGG - Intergenic
1159102846 18:63974374-63974396 GTATGGGGATGGGGGAGTGGAGG + Intronic
1160877886 19:1305886-1305908 CTCTGGGGATGGTGGGGGGGGGG - Intergenic
1161091992 19:2365404-2365426 TTGGGGCGATGGAGGAGGGGAGG + Intergenic
1161526704 19:4760359-4760381 CCATCGGGATGGGGGAGGGGGGG - Intergenic
1161535454 19:4816437-4816459 CTGTGGGGAGGGCGGTGGGGGGG + Exonic
1162562064 19:11422664-11422686 CTCTGGGGAGGGCGGCGGGGCGG - Intronic
1163265010 19:16215188-16215210 CTAAGGCGGGGGCGGGGGGGGGG + Intronic
1163473477 19:17511654-17511676 CCATGGCGAGGGCGGCGGCGGGG - Exonic
1163545211 19:17937309-17937331 CACTGGAGATGGCAGAGGGGAGG + Intronic
1164051321 19:21587299-21587321 CTCTGCCGCTGGCGTAGGGGCGG - Intergenic
1164137348 19:22427187-22427209 CTAAGGGGGTGGCGGGGGGGGGG + Intronic
1165750565 19:38256667-38256689 CTCTGGCGGTGGCGGGGTGGGGG + Intronic
1166758669 19:45211356-45211378 GTATGGTGGTGGTGGAGGGGGGG + Intronic
1166997808 19:46728119-46728141 CTCTGGCCCTGGGGGAGGGGGGG + Intronic
1168287536 19:55342109-55342131 CTAAGGAGAGGGCCGAGGGGCGG - Intronic
932454464 2:71838843-71838865 CTTTGGGGGTGGAGGAGGGGAGG + Intergenic
933722832 2:85409303-85409325 CCATGGGGCTGGGGGAGGGGAGG + Intronic
937126152 2:119476229-119476251 CTATGGGGATGAAGGAGGGGTGG + Intronic
944417892 2:199497056-199497078 GTATGGAGATGGGGGATGGGAGG + Intergenic
945825692 2:214717439-214717461 CTGTGGAGGTGGCGGATGGGAGG - Intergenic
946013800 2:216588060-216588082 CTATGGAGTTGGGGGTGGGGAGG - Intergenic
946370799 2:219280178-219280200 CTAGGGGGAAGGGGGAGGGGAGG - Intronic
947439874 2:230109809-230109831 CTATGGGGATGGGTGAGGGATGG + Intergenic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948208863 2:236178085-236178107 CGCTGGAGATGGCGGGGGGGAGG + Intergenic
948646303 2:239407248-239407270 CTGTGGCCAGGGCGGAGGCGTGG + Intergenic
1168847459 20:955169-955191 CTATGGCTATGGGTGAGGGTGGG + Intergenic
1169617909 20:7471064-7471086 CTTTGGAAATGGGGGAGGGGTGG - Intergenic
1169628193 20:7596720-7596742 CCATGGGGATAGGGGAGGGGTGG - Intergenic
1170539787 20:17376046-17376068 TAATGGCGATGGCAGAGGCGTGG - Intronic
1172181435 20:33006242-33006264 CTATGGTGAGGGCGCAGGAGGGG + Intergenic
1176248500 20:64109021-64109043 GTTTGGGGATGGCGGTGGGGGGG + Intergenic
1178493997 21:33071505-33071527 CAGTGGCGGGGGCGGAGGGGTGG + Exonic
1183559827 22:38563679-38563701 TTGTGGAGATGGGGGAGGGGTGG - Intronic
949534923 3:4988352-4988374 CTATGGGGGGGGCGGTGGGGGGG + Intergenic
950134658 3:10572082-10572104 TTATGGCGATGGCAGAGGCATGG - Intronic
950607542 3:14096219-14096241 TTATGGCCATGGGGGAAGGGAGG + Intergenic
952392449 3:32891730-32891752 TGATGGCGATGCCGGAAGGGCGG - Exonic
957386474 3:79502493-79502515 CCATGGCGGTGGGGAAGGGGCGG - Intronic
957961288 3:87256917-87256939 GTTTGGGGATGGCGGCGGGGGGG - Intergenic
961014062 3:123454008-123454030 CTATTGGCATGGGGGAGGGGTGG - Intergenic
961654263 3:128432877-128432899 AGAGGGCGATGGGGGAGGGGCGG - Intergenic
961780281 3:129316811-129316833 CAAAGGGGATGGCGGATGGGAGG + Intergenic
962978478 3:140466793-140466815 CAATGGTGATGGCAGTGGGGAGG + Intronic
964262219 3:154852315-154852337 GGATGGCGTTGGCGGCGGGGGGG - Intergenic
964509586 3:157436548-157436570 CAATGGGGATGAAGGAGGGGTGG - Intronic
964876285 3:161372059-161372081 CTTTGGCGGTGGTAGAGGGGCGG + Exonic
967455032 3:189675243-189675265 CTAAGGCAATGGAGGAGGTGAGG - Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
972356118 4:38280782-38280804 CTATGGCGGAGGGGGTGGGGGGG - Intergenic
974193307 4:58536164-58536186 CCATGGGGATCGGGGAGGGGTGG + Intergenic
976287750 4:83386426-83386448 CTCTGGCGGTGGGGGTGGGGTGG - Intergenic
976454303 4:85228531-85228553 CTATGGTGTTGGGGGAGGAGAGG + Intergenic
976826157 4:89262812-89262834 GTAGGGGGATGGCGGAGGGTGGG - Intronic
978268557 4:106859035-106859057 GTAAGGGGATGGGGGAGGGGAGG + Intergenic
979274826 4:118803407-118803429 CTAGGGAGATGGGGGAGGGGAGG - Intronic
981803244 4:148682321-148682343 CGATGACGATGGCAGTGGGGTGG + Intergenic
1002075722 5:176707264-176707286 CTATGAGGAAGGGGGAGGGGAGG + Intergenic
1002086962 5:176781936-176781958 CTCTGGCCATGGCGGTGGGATGG + Intergenic
1004373425 6:15072259-15072281 CTATGGGGATGTTGGAGGGCAGG + Intergenic
1004843352 6:19612728-19612750 CTCTGGGGTTGGGGGAGGGGTGG - Intergenic
1005089748 6:22043822-22043844 CTGTGCTGATGGAGGAGGGGAGG + Intergenic
1005711899 6:28511400-28511422 CACTGGTGATGGGGGAGGGGCGG + Intronic
1006726448 6:36202415-36202437 CAATGGCGGGGGCGGAGGGGGGG - Intronic
1011136077 6:84102443-84102465 CTATGAAGATGGAGGAAGGGAGG + Intergenic
1011472549 6:87722251-87722273 CTTTGGCGGTGGAGGAGGGGTGG - Intergenic
1014275573 6:119384551-119384573 TTATGGAGATGGGGGAGGGATGG + Intergenic
1018077207 6:160228250-160228272 CCTTTGCGCTGGCGGAGGGGAGG - Intronic
1018368741 6:163148955-163148977 CTATGGCGGGGGGGGGGGGGGGG + Intronic
1022349887 7:29558061-29558083 CTATGGAGAAGGGGGAGGAGGGG + Intergenic
1023993488 7:45144777-45144799 GTAGGGAGATGGGGGAGGGGAGG + Intergenic
1026764953 7:73154705-73154727 CTAAGGGGAAGGCCGAGGGGAGG - Intergenic
1026867163 7:73830949-73830971 ATATGGCTCTGGCAGAGGGGCGG - Exonic
1027041425 7:74964475-74964497 CTAAGGGGAAGGCCGAGGGGAGG - Intergenic
1027082215 7:75237901-75237923 CTAAGGGGAAGGCCGAGGGGAGG + Intergenic
1027685484 7:81274777-81274799 CTGGAGCGATGGAGGAGGGGTGG - Intergenic
1027698882 7:81443956-81443978 GTATGGAGGTGGCGGGGGGGAGG + Intergenic
1028169646 7:87581034-87581056 CTGTAGGGATGGGGGAGGGGGGG + Intronic
1028929681 7:96398482-96398504 CTCAGGGGATGGAGGAGGGGTGG + Intergenic
1030340401 7:108373169-108373191 CAATGGCGATTGCCAAGGGGTGG + Intronic
1033095969 7:138431189-138431211 ATTTGGCGATGGCGGGCGGGGGG - Intergenic
1033611129 7:142963980-142964002 CCAAGGGGATGGCAGAGGGGAGG + Intergenic
1035391323 7:158506805-158506827 CTATGGCGATGGCGGAGGGGCGG - Intronic
1036723780 8:11201303-11201325 CGATGGCGGTGGCGTGGGGGTGG - Exonic
1038980325 8:32752329-32752351 CTGTGGCTATGGGGGAGGGGAGG + Intronic
1045485923 8:102631144-102631166 CTGTGAGGATGGGGGAGGGGTGG + Intergenic
1049417496 8:142501921-142501943 TGATGGCGATGGCGGGGTGGTGG + Intronic
1049442412 8:142615383-142615405 CTAAGGGGATGGAAGAGGGGAGG + Intergenic
1057234268 9:93346337-93346359 CTAGGGCGGAGGCGGAGGCGGGG - Exonic
1059526352 9:114994090-114994112 CTGTGGTGTTGGAGGAGGGGTGG + Intergenic
1061726422 9:132584486-132584508 GTATGGCGCTGGGGGTGGGGTGG - Intronic
1062111652 9:134785309-134785331 CCAAGGCGATGGTGGAGGGCTGG - Intronic
1187266303 X:17737295-17737317 CTAAGGAGATGGCTGTGGGGCGG - Intergenic
1188078648 X:25808629-25808651 CCATGGGGCTGGGGGAGGGGTGG + Intergenic
1190233152 X:48597730-48597752 CTATGGCGACTGGGGAGGGGCGG + Intronic
1190440361 X:50470073-50470095 CGATGGCGATGGCGATGGCGAGG + Exonic
1190894038 X:54597914-54597936 CTGGGGGGATGGTGGAGGGGTGG + Intergenic
1192142521 X:68657995-68658017 CTATGGCTATGGTGGAGGTTGGG + Intronic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195138166 X:101931760-101931782 CTATGGCGGCGGCGGGGAGGGGG - Exonic
1195285094 X:103376401-103376423 ATATGGCGGTGGCGGGTGGGGGG + Exonic
1196424975 X:115561110-115561132 CAATGGCGGCGGCCGAGGGGCGG + Intergenic
1198615277 X:138451631-138451653 CTCTGGGGATGGGGGTGGGGAGG + Intergenic