ID: 1035391690

View in Genome Browser
Species Human (GRCh38)
Location 7:158508592-158508614
Sequence CTGTGGGTGTCGGGGCAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035391679_1035391690 22 Left 1035391679 7:158508547-158508569 CCTGTGGGGAGCTGGAGAGGAGC 0: 1
1: 0
2: 1
3: 41
4: 392
Right 1035391690 7:158508592-158508614 CTGTGGGTGTCGGGGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035391690 Original CRISPR CTGTGGGTGTCGGGGCAACG TGG Intronic
No off target data available for this crispr