ID: 1035391727

View in Genome Browser
Species Human (GRCh38)
Location 7:158508763-158508785
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 6, 1: 1, 2: 0, 3: 15, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900481373 1:2901048-2901070 CTGTGGGTTTGGGGCCAACGTGG + Intergenic
900646999 1:3713477-3713499 GTGTGGGACTCGGGGCAAGGTGG + Intronic
901792387 1:11661260-11661282 CAGGGGGTGTCAGGGCAGCGGGG - Exonic
902515294 1:16986663-16986685 CTGTGGGTGCCGGGGGGGCGTGG - Intronic
902688815 1:18096864-18096886 CTGTGGGTCCCTGGGCACCGGGG + Intergenic
903032313 1:20472728-20472750 CTGTGGGTGACAGGGCAGCATGG + Intergenic
903248943 1:22038193-22038215 CAGTGGGTGTGGGGGCCACGAGG + Intergenic
903646038 1:24897057-24897079 CTGCGGATGTCGGGGCGATGTGG + Intergenic
904034041 1:27549724-27549746 CTGTGGGTTTCAGGGGACCGAGG - Exonic
905446273 1:38030226-38030248 CTGTGGGTGAAGGGGCACCGGGG + Intergenic
905930455 1:41783232-41783254 GTGTGGGTGTTGGGGCCAGGAGG + Intronic
907385294 1:54121917-54121939 CTGTGAGTGTCGGGGGATCTGGG - Intergenic
911397888 1:97334972-97334994 CTGTGTGTGTTGGGGCAGTGGGG + Intronic
915354068 1:155245211-155245233 CTGTGCTTGTAGGGGCAACGTGG - Intergenic
921152696 1:212414624-212414646 CGGGGGGTGTCGGGGCTGCGCGG - Intronic
1064060805 10:12135145-12135167 CTGTGGGGGTAGGGGGAAAGGGG + Intronic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1069683172 10:70299707-70299729 CTGTGGGTGTTGGGGGCAAGTGG - Exonic
1069735471 10:70651162-70651184 ATGTGGGTATCTGGGCAATGTGG - Intergenic
1071264702 10:83954663-83954685 ATGTAGGTGTCTGTGCAACGAGG - Intergenic
1073868208 10:107829777-107829799 CTGTGTGTGTCGGGGCGGGGAGG + Intergenic
1074766676 10:116705121-116705143 CTGTGGGTGGGAGGGCCACGTGG - Intronic
1075654601 10:124152781-124152803 CTGTGGGTGTCGGGGACTCAGGG - Intergenic
1075945352 10:126428258-126428280 CTGTGGGTGTCTGGGGAGCTGGG + Intronic
1076874913 10:133211206-133211228 CTGGGCGTGTGGGGGCAAGGGGG - Intronic
1077217775 11:1402201-1402223 CGGTGGGTGTCGGGGCTCCCCGG + Intronic
1077224569 11:1434512-1434534 CTCTGGGTGTCGGCGCACCCAGG + Intronic
1077497763 11:2894766-2894788 CTGAGGGTGTCTGGGCACCTGGG + Intronic
1078216235 11:9314364-9314386 CCGTGGGGGACGGGGCAGCGGGG - Exonic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1083034694 11:59625846-59625868 CTGTGTCTGGCGGGGCAAGGTGG - Intergenic
1083196563 11:61091940-61091962 CTGTGGGGGTGGGGGCACCCAGG - Intergenic
1084217635 11:67658786-67658808 CTGTGGGTGGCAGGGCATGGTGG - Intergenic
1086351292 11:85944777-85944799 ATGTGGGTGTCTAGGCAATGTGG - Intergenic
1086944928 11:92835721-92835743 CTGTGTGTGTAGGGGGAAAGGGG - Intronic
1088089503 11:106021878-106021900 CGGTGGGAGTCGGGGCAACCTGG + Exonic
1089695912 11:120216190-120216212 CTGTGGGTGGGGGAGCAACATGG + Intronic
1092119136 12:6031718-6031740 CTGTGTGTGTCTGGGGGACGGGG + Intronic
1092282478 12:7108531-7108553 CTGTGGGTGTGGGAGGAGCGGGG + Intronic
1093972440 12:25387014-25387036 TTGTGGGTGTAGAGGCACCGAGG + Intergenic
1094150048 12:27272744-27272766 CTGTGTGTGTTGGGGGAAAGAGG - Intronic
1096988406 12:55777995-55778017 GTGTGGGTGTGGGGGAAACTGGG + Intronic
1097185736 12:57195398-57195420 CTGTGAGTGGCGGGGCCACGTGG + Exonic
1102254252 12:111406690-111406712 CCTTGGGTGTGGGGGCAGCGGGG + Intronic
1102601295 12:114032653-114032675 TTGTGGTGGTGGGGGCAACGTGG + Intergenic
1103482663 12:121261053-121261075 CTGTGGGGTTAGGGGCAATGGGG - Intronic
1105415640 13:20209049-20209071 CTGTGGCTGAAGGGGCAAGGGGG - Intergenic
1111611575 13:90614329-90614351 ATGTGAGTGTCTGGGCAACGTGG + Intergenic
1112620294 13:101047718-101047740 CTGTGGGTGGAGGGGCCACCTGG - Intergenic
1113597805 13:111547034-111547056 GTGTGGATGTGGGGGCCACGTGG + Intergenic
1115172760 14:30528015-30528037 ATGTGGGTGTTGGGGCAATGTGG + Intergenic
1116454698 14:45106060-45106082 CTGAGGGTGGCGGGGCACGGTGG + Intronic
1117195450 14:53335813-53335835 CTGTGTGTGTAGGGGCCAGGTGG + Intergenic
1119419797 14:74501694-74501716 CTGTGGGGGTGGGGGCAGAGAGG + Intronic
1120322376 14:82980705-82980727 CTGTGGGTTTCAGGGAAAGGGGG + Intergenic
1120761327 14:88288421-88288443 CTGTGGGTGTCAGGGCAGGGTGG - Intronic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1122278025 14:100605191-100605213 CTGTGGGTGTTGGGGAAGGGGGG + Intergenic
1122285910 14:100652533-100652555 CTGTGGGTCTAGTGGCAACAGGG + Intergenic
1122741085 14:103872010-103872032 CCGTGGGTGGCGGGGCACCTGGG - Intergenic
1122974693 14:105166275-105166297 CAGTGGGTGTGGGGGCAGGGAGG - Intronic
1124639946 15:31391316-31391338 CTGTGGGTGTCGGGGTTGTGGGG + Intronic
1126954252 15:53914583-53914605 CTGCAGGTGTCGGGGCAGCAGGG + Intergenic
1127304140 15:57685502-57685524 CTGTGTGTGTCGGGGGAGGGTGG + Intronic
1127758266 15:62113661-62113683 CAGTGGGTGTCAGGGCAGTGAGG - Intergenic
1127898276 15:63321717-63321739 CTGTGTGTGTAGGGGCGAGGGGG + Exonic
1128046605 15:64623536-64623558 GTGTGGGTGGCTGGGCAATGAGG - Intronic
1132469509 16:94148-94170 CTGTGGGAGTCGGGGCACATGGG - Intronic
1132612333 16:823543-823565 CTGGCGGTGTCGCGGTAACGCGG + Intergenic
1132691312 16:1183061-1183083 CTGGGGGTGTCGGGTCACAGAGG - Intronic
1132906228 16:2284129-2284151 CTGTGGGAGGTGGGGCAAGGCGG + Intronic
1133285444 16:4688556-4688578 CTGTGGGTGTCCGGGGATCTGGG + Intronic
1134684924 16:16151903-16151925 GTGTGGGTGGCGGGGCACGGCGG + Intronic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1142007461 16:87696308-87696330 CTCAGGGTGTCGGGGCCACAAGG + Intronic
1142129290 16:88425406-88425428 CAGTGGGTGTCTGGGCCATGTGG + Intergenic
1143173251 17:4942379-4942401 CTGGGGGTGGTGGGGCAATGGGG - Exonic
1143571220 17:7759933-7759955 TTGTGGGTGAGTGGGCAACGGGG + Exonic
1144792601 17:17869056-17869078 CTGGGGGTGGCGGGGCAGTGGGG + Intronic
1145902910 17:28499554-28499576 GTGTGGGTGCCTGGGCAGCGAGG - Intronic
1145971773 17:28960462-28960484 CTGGGGGTGGCGGGTCCACGGGG - Intronic
1147861971 17:43529105-43529127 CTGTGGGTCTAGGGACAAGGTGG - Intronic
1148244264 17:46020288-46020310 CTGTGGGTGTCTGTGCAGTGAGG + Intronic
1150143080 17:62746276-62746298 CTGGTGGTGTCGGAGCAACTTGG + Intronic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1160015526 18:75137519-75137541 CGCCGGGTGTCTGGGCAACGGGG + Intergenic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1160903013 19:1438579-1438601 TGGTGGGTGTCGGGACGACGCGG + Intronic
1161307214 19:3574637-3574659 CTTTGGGGGTCGGGGCTACTGGG - Intronic
1162777207 19:12987111-12987133 CTGTGTGTGTCTTTGCAACGCGG + Intergenic
1162834589 19:13308010-13308032 CAATGGGTGTCTGGGCTACGAGG + Intronic
1163138680 19:15332059-15332081 CCGTTGGTGTCGGGGCGGCGGGG - Intronic
1163158586 19:15452109-15452131 CTGTGGGGGTCGGGGGATTGGGG + Intronic
1165407005 19:35637174-35637196 CTGTGGGGATCTGGGCAATGAGG + Exonic
1165788281 19:38475371-38475393 GTGAGGGAGTCGGGGCAGCGTGG - Exonic
925055187 2:851804-851826 GTGTGTGTGTAGGGGCAAGGGGG + Intergenic
931268694 2:60683112-60683134 CGGTGGATGTCGGGGGAACAGGG + Intergenic
941017340 2:160372326-160372348 TGGTGGGTGTAGGGGCAACAGGG - Intronic
943320495 2:186437236-186437258 ATGTGGGTGTCTGGGCAATGTGG - Intergenic
943532704 2:189104714-189104736 CTGTGGGGGTGGGGGTAAAGTGG - Intronic
948596427 2:239082385-239082407 CTGTGTGGGTCAGGGCTACGTGG + Intronic
1170930612 20:20766998-20767020 CTGTGGGGGTCTGGGGAAAGGGG - Intergenic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1176008055 20:62876851-62876873 CTGTGGGTGCCAGGGCTCCGGGG + Intergenic
1176184967 20:63773422-63773444 CTTTGGGAGCCTGGGCAACGTGG - Intronic
1176286614 21:5022229-5022251 CTGCGGGTGCCGGCGCAGCGAGG - Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178680934 21:34670979-34671001 CTTTGGGGGTGGGGGCGACGGGG + Intronic
1179350488 21:40606256-40606278 GTGTTGGTGTTGGGGCCACGAGG + Intronic
1179870567 21:44241246-44241268 CTGCGGGTGCCGGCGCAGCGAGG + Intergenic
1179884121 21:44306212-44306234 CTGTGAGTGTGGGGGCTCCGTGG + Intronic
1183439484 22:37815319-37815341 CTGAGGGTGGCTGGGAAACGAGG + Intronic
1185047462 22:48536177-48536199 GTGTGTGTGTCGGGGCATGGGGG - Intronic
949348968 3:3104656-3104678 GTGTGGGTGTCCGGGCACCATGG - Intronic
949814219 3:8040923-8040945 CTGTTGGTGTGGGGGCATGGTGG + Intergenic
954181194 3:48882688-48882710 GTGTGTGTGTCGGGGCGGCGGGG - Intronic
955219436 3:57011560-57011582 CTGTGGGTGGCGGGGGAAGGTGG - Intronic
957685607 3:83501278-83501300 TTGTGGGTGTCTGGGCAATGTGG + Intergenic
963779811 3:149475870-149475892 CTGTGGGTGCTGCGGCAACGAGG + Exonic
965762308 3:172092678-172092700 CTGTGGGTGTCCTGGAAAAGAGG + Intronic
968514017 4:1008900-1008922 CTGTGGGTGTCTGGGCTTCTCGG + Intergenic
968568216 4:1326108-1326130 CTATGCGTGTCGGGGCAGCAAGG + Intronic
968977033 4:3827474-3827496 GTGTGTGTGTCGGGGCCAAGGGG + Intergenic
969414163 4:7047986-7048008 CTGTGGGTGATGTGGGAACGTGG + Intronic
971250650 4:24970770-24970792 ATGTGGGAGTCTGGGCAACATGG - Intronic
979082551 4:116361271-116361293 ATGTGAGTGTCTGGGCAATGTGG - Intergenic
984869699 4:184315285-184315307 CTGTGTGTGTGGGAGCAGCGAGG + Intergenic
985622532 5:963014-963036 CCGTGGGTGTGGGGGCCATGTGG - Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
987116758 5:14731881-14731903 CTGTGTGGGACAGGGCAACGTGG + Intronic
994980864 5:106874460-106874482 ATGTAGGTGTCTGGGCAATGTGG + Intergenic
995361089 5:111298548-111298570 ATGCAGGTGTCTGGGCAACGTGG - Intronic
1001952179 5:175824025-175824047 CTGTGGGTGTTGGGGACAGGAGG - Intronic
1006027931 6:31159091-31159113 CTGTGTGTGTCGGGGTGGCGGGG - Exonic
1010771517 6:79837022-79837044 CTGAGGGTGTTTGGGCAAAGAGG + Intergenic
1011469437 6:87692993-87693015 CTGTGGTGGTCGGATCAACGAGG + Intronic
1019499959 7:1359916-1359938 CTGTGGGTGTGGGGCCCACCAGG + Intergenic
1020074431 7:5248477-5248499 CTGTGGCTGTCCGGGAGACGGGG - Intergenic
1020123751 7:5520759-5520781 CTGTGGGTGTCTGGGGACAGCGG + Intergenic
1020146030 7:5643840-5643862 CTGTGGGTTGCAGGGCAAGGAGG - Intronic
1026451096 7:70530348-70530370 CTGTGGGTGTTACGGCAACATGG + Intronic
1026512047 7:71035639-71035661 CTGCGGGTGTCTGGGCTCCGGGG - Intergenic
1034416419 7:150966771-150966793 CTGTTGGAGTCGGGGCAAAAGGG + Intronic
1034435711 7:151061937-151061959 CTGCGGCTTTCAGGGCAACGAGG - Exonic
1034690848 7:153012526-153012548 GTGTGTGTGTCAGGGCAGCGGGG - Intergenic
1035391690 7:158508592-158508614 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391703 7:158508649-158508671 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391715 7:158508706-158508728 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391727 7:158508763-158508785 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391739 7:158508820-158508842 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391752 7:158508877-158508899 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391763 7:158508934-158508956 CTGTGGGTGTCAGGGCAACGTGG + Intronic
1035447792 7:158954900-158954922 CTGTGGGGGACGGGGCATGGTGG - Intronic
1035605400 8:926946-926968 CTGTGGGGGTGGGGACAGCGTGG + Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1039610825 8:38917959-38917981 CTGTGGGTTTCTGGACATCGAGG + Exonic
1046974847 8:120262889-120262911 CTGTGGGTGGAGGGACAACCAGG + Exonic
1047634400 8:126744480-126744502 CTGTGGGTGTCAGGGGATGGAGG + Intergenic
1053052877 9:34976438-34976460 CTGTGGGTTTGGGGGCCCCGAGG + Intronic
1055557833 9:77493114-77493136 GTGTGGGTATGGGGGCACCGTGG + Intronic
1055589274 9:77793688-77793710 ATGTGTGTGTTGGGGGAACGGGG - Intronic
1057287399 9:93769243-93769265 CTGTGTGTGTTGGGGCAAGCGGG + Intergenic
1057973137 9:99576288-99576310 CCCTGGGTGTCAGTGCAACGTGG - Intergenic
1058275649 9:103038190-103038212 CTGTGGGTGTTGGGGGACAGGGG - Intergenic
1059396079 9:114034967-114034989 CTGTGGGTGCTGGGGCCACCAGG - Intronic
1062502903 9:136858870-136858892 CAATGGGTGCCTGGGCAACGGGG + Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187832989 X:23401453-23401475 CTGTGGGTGACTGGGCAAACTGG + Exonic
1192448983 X:71231015-71231037 CTGTGGGATTCAGGGCAGCGGGG + Intergenic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1198415633 X:136417093-136417115 CTGTGGGTTTCAGGCCAACTGGG - Intergenic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic