ID: 1035392347

View in Genome Browser
Species Human (GRCh38)
Location 7:158513258-158513280
Sequence TCAGTCTGTAGAATGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035392347_1035392350 1 Left 1035392347 7:158513258-158513280 CCAGGGGACATTCTACAGACTGA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1035392350 7:158513282-158513304 CAGGCCTCCTCAAAACTGTCAGG 0: 1
1: 5
2: 13
3: 36
4: 189
1035392347_1035392354 17 Left 1035392347 7:158513258-158513280 CCAGGGGACATTCTACAGACTGA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1035392354 7:158513298-158513320 TGTCAGGGTCCTCAAAGCCAAGG 0: 1
1: 0
2: 3
3: 61
4: 391
1035392347_1035392351 2 Left 1035392347 7:158513258-158513280 CCAGGGGACATTCTACAGACTGA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1035392351 7:158513283-158513305 AGGCCTCCTCAAAACTGTCAGGG 0: 1
1: 12
2: 114
3: 316
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035392347 Original CRISPR TCAGTCTGTAGAATGTCCCC TGG (reversed) Intronic
903125271 1:21243671-21243693 TCTCTCTGTAGGAAGTCCCCTGG + Intronic
905229931 1:36508663-36508685 TCAGCCTCCAGAATGTCCCGGGG + Intergenic
910566504 1:88649481-88649503 TCAGTCTGTACAATTTCTCCAGG + Intergenic
911137437 1:94456205-94456227 TCATTTAGTATAATGTCCCCCGG + Intronic
912439281 1:109686539-109686561 TGAGTCTGAAGAAACTCCCCAGG + Intronic
912442592 1:109710981-109711003 TGAGTCTGAAGAAACTCCCCAGG + Intergenic
912851169 1:113126233-113126255 TCAGACTTTTGAATGACCCCTGG - Exonic
913151271 1:116046700-116046722 TCAGTATTTGGAATGTCTCCGGG - Intronic
916506543 1:165433365-165433387 TCACTCTGTGGCATGACCCCTGG + Intronic
918572136 1:186009273-186009295 TCACTCTGTATGATGCCCCCAGG + Intronic
919093118 1:192997774-192997796 TCAGTTTGTAAAATTGCCCCAGG - Intergenic
922949272 1:229544635-229544657 TCAGTCTGTAAAAGGGCCTCAGG - Intronic
1068014870 10:51503438-51503460 TTTGTTTGTAGAATGTCCTCAGG + Intronic
1070033836 10:72702554-72702576 TCTGTTTGTACAATGTCTCCTGG - Intronic
1070513877 10:77185766-77185788 TCAGTGTGTGGAAAGTCCCAAGG + Intronic
1071162832 10:82770879-82770901 TCATTCTGATAAATGTCCCCAGG - Intronic
1079375606 11:19889023-19889045 TCAGTTTGTAGAAAGTCCAGTGG + Intronic
1081827968 11:46076557-46076579 TCAGTCTCTAGAGTATCCCATGG - Intronic
1083101331 11:60309629-60309651 TGAGTCATTAGAATGTACCCAGG + Intergenic
1085951377 11:81336269-81336291 TCAGTCTTTAAAATGTTCCAGGG - Intergenic
1087280030 11:96199574-96199596 CCATTCTGTAGAATGTGTCCTGG + Intronic
1094234662 12:28150013-28150035 TCACTTAGTATAATGTCCCCAGG + Intronic
1094313932 12:29116495-29116517 TGGGTCTGTAGAAAGTCCCTAGG - Intergenic
1094640724 12:32272585-32272607 TCAGTCTGAAGAAATTCCCCAGG - Intronic
1102597639 12:114005155-114005177 CCAGTCTTTAAAATGTACCCAGG + Intergenic
1105047526 12:133017589-133017611 ACAGTCTGAGGAATGACCCCAGG + Exonic
1105572127 13:21612674-21612696 TCAGTCTGTAGAGTTTTCGCAGG + Intergenic
1107345520 13:39456185-39456207 CCAGTCTGCAGATTATCCCCAGG - Intronic
1116150160 14:41130262-41130284 TCAGTCTGTCCAAGGTCTCCTGG + Intergenic
1120757020 14:88254096-88254118 TCTGTCTGAAGAAAGTCCCGGGG - Intronic
1125719717 15:41839459-41839481 TCAGGCTGAAGATGGTCCCCCGG - Intronic
1132893835 16:2218168-2218190 TCTGGCTGTGGAATGTCCACAGG + Intergenic
1133180713 16:4052148-4052170 TTACTTTGTAGAATGTCCCTCGG - Intronic
1138107691 16:54298094-54298116 TCCCTCTGTAGTAGGTCCCCAGG - Intergenic
1139019243 16:62726580-62726602 AGACTTTGTAGAATGTCCCCTGG + Intergenic
1142131351 16:88432962-88432984 TCTGCCTGCAGAATGTCCCTGGG - Exonic
1144139806 17:12337227-12337249 TCAGTATTTAGGATGTCTCCAGG + Intergenic
1147847824 17:43417638-43417660 TCAGTCTGCAGAACGTCAGCTGG + Intergenic
1148922371 17:51050084-51050106 TCAGTCTGTAGAATGGCTATTGG - Intronic
1149849898 17:60028106-60028128 TCAGTCGGCAGAATGTCTTCAGG + Intergenic
1149860270 17:60118418-60118440 TCAGTCGGCAGAATGTCTTCAGG - Intergenic
1155349471 18:24892317-24892339 ACAGTCTGAATAATGCCCCCTGG - Intergenic
1156269474 18:35517657-35517679 TCATTCTGTGGACTGTGCCCAGG + Intergenic
1159932398 18:74327151-74327173 TGAGTCTGAAGAAACTCCCCAGG + Intronic
1164996807 19:32726538-32726560 TCACTCAGTATAATGTCCTCAGG + Intronic
926996998 2:18746680-18746702 TCAGTCTGCAGAATGCTCTCAGG - Intergenic
928568403 2:32577873-32577895 TAAGTCTGAAGAATGTTCTCTGG - Intronic
930854649 2:56000716-56000738 TCAGACTGTAGAATCTCTACGGG + Intergenic
937797067 2:126036293-126036315 TCAGGCTGTTGGCTGTCCCCTGG - Intergenic
941913004 2:170784234-170784256 TCACTCAGTAGTATTTCCCCAGG + Intronic
945108717 2:206342711-206342733 TCATCCTGTTGAAGGTCCCCAGG + Intergenic
947760011 2:232597317-232597339 GCATTTTGTAGAATGTCCCTTGG - Intergenic
948655725 2:239475737-239475759 TCAGTTTGGAGGATGTCCCAAGG + Intergenic
1169051255 20:2579833-2579855 TCAGTCTGTTGAATGACACCTGG - Intronic
1170209094 20:13829866-13829888 TCAGTCTGTACATTCTCCCAGGG - Intergenic
1170750069 20:19137497-19137519 TAGATCTGTAGAATGTTCCCAGG - Intergenic
1171238858 20:23549069-23549091 TCAGTCTAGAGAAGGTCTCCTGG - Intergenic
1171245017 20:23603888-23603910 TCAGTCTAGAGAAGATCCCCTGG - Intronic
1171743230 20:28929496-28929518 TCATTTTGTAGAATGTCCAGAGG - Intergenic
1172854684 20:37992878-37992900 TCAGTCTCCAGGATGTCTCCCGG - Intronic
1174175901 20:48644772-48644794 TCACTCTGTCCAGTGTCCCCAGG + Intronic
1174773561 20:53323375-53323397 GAAGTCTGTAGAAAGTGCCCTGG + Intronic
1175158437 20:56990203-56990225 ACAGTCTGTAGAGGGTCCCAAGG - Intergenic
1182955353 22:34419228-34419250 TCTGTCTGTAAAATCTCCCCAGG + Intergenic
1184202389 22:42979819-42979841 TCAGTCTGTAGCATGTGGTCAGG - Intronic
951618560 3:24575722-24575744 GCAGTCTGTGTAATGTCACCTGG - Intergenic
952521876 3:34168980-34169002 CCAGACTGTCAAATGTCCCCTGG - Intergenic
953733255 3:45468268-45468290 TAAGTGAGTAGAATGTCCCCTGG + Intronic
959801821 3:110504336-110504358 ACAGGCTGTAGAATCTTCCCTGG + Intergenic
961220806 3:125198218-125198240 TTATTTTGTAGAATGTCCTCAGG - Intronic
962012103 3:131401699-131401721 TCAGTCTTTAGAATGTGGCTTGG - Intergenic
967102920 3:186230984-186231006 TCAGTCTTTAATATGTCTCCAGG + Intronic
968718016 4:2176292-2176314 TAAGTCTGTAGAGTGTCTTCAGG + Exonic
981167787 4:141582157-141582179 TCAGTCTGAAGAAACTCCCCAGG - Intergenic
994380385 5:99063914-99063936 GCAGTCAAGAGAATGTCCCCAGG - Intergenic
996118328 5:119643639-119643661 TCAGTCTGAAGAATGACTCTAGG + Intergenic
996540822 5:124629014-124629036 TCAGTCAGAGGAATGTCCCTGGG + Intergenic
1004839828 6:19570183-19570205 TCATTCTAAAGAATGGCCCCTGG + Intergenic
1004925977 6:20415530-20415552 TCACACTGTCAAATGTCCCCGGG + Intronic
1005226805 6:23652621-23652643 TCAGTAAGTAGAATGTGTCCAGG - Intergenic
1005462681 6:26084104-26084126 TCAGTCTGCTGAATTTCCCTAGG - Intergenic
1008649391 6:53547760-53547782 TCATTCTGTAGACTGCACCCAGG + Intronic
1013994818 6:116296046-116296068 CCAGTATGTAGAATGTCACCAGG - Intronic
1015079037 6:129201188-129201210 TCACCCTGGAGACTGTCCCCAGG - Intronic
1015659483 6:135559159-135559181 TCACTCAGTATAATGTCCTCAGG - Intergenic
1018399018 6:163403990-163404012 TCAGACTGAAGCACGTCCCCAGG + Intergenic
1020267632 7:6571930-6571952 ACAGACTGTGAAATGTCCCCAGG - Intergenic
1021191199 7:17621657-17621679 TCTGTCTGTAGAATGAAACCTGG - Intergenic
1024562338 7:50655118-50655140 TCATTCTCTAGAATGTCTCTTGG + Intronic
1028236141 7:88363866-88363888 TGAGTCTGAAGAAACTCCCCAGG - Intergenic
1032543465 7:132723480-132723502 TCACTTAGCAGAATGTCCCCAGG - Intronic
1033136010 7:138784876-138784898 CCATTCTGTAGAAAGTCCTCAGG - Intronic
1034683566 7:152949881-152949903 TTAGTCTGGAGAAAGTCTCCTGG + Intergenic
1035392347 7:158513258-158513280 TCAGTCTGTAGAATGTCCCCTGG - Intronic
1035566281 8:643439-643461 CCAGTCTGCAAAATGCCCCCTGG - Intronic
1035617270 8:1011675-1011697 TCAGTCTATAGAGTGAGCCCTGG + Intergenic
1037681431 8:21100892-21100914 TCAGTTTGCACACTGTCCCCAGG - Intergenic
1045320145 8:101076227-101076249 TCATTCTGTAAGATGGCCCCTGG + Intergenic
1046071714 8:109263152-109263174 TCAGTCTGTAAACTGTTCACTGG + Intronic
1046580558 8:116087106-116087128 TCAATTTTTACAATGTCCCCAGG - Intergenic
1047264144 8:123290022-123290044 TCAGTTTGTAGAGTTTGCCCTGG - Intergenic
1053391125 9:37737036-37737058 TCAGTCTTCAGACTGTCCCTTGG + Intronic
1055389190 9:75800629-75800651 TCAATCTGTGGAATGTCACTAGG - Intergenic
1056054348 9:82805300-82805322 TTAGCATGTAGAATTTCCCCTGG - Intergenic
1058502603 9:105636452-105636474 TCAGTCTGTTGAATGTCGATGGG + Exonic
1058792234 9:108460150-108460172 TCTGTCTGGAAAATGTTCCCTGG - Intergenic
1059532782 9:115052172-115052194 TCACTCTGTACAATGTCTTCTGG - Intronic
1059637774 9:116187505-116187527 TCAGTCTGTGGAAGGTGGCCAGG + Exonic
1060018257 9:120106302-120106324 GCAGCCTGTAGAATGTGCCCTGG + Intergenic
1060714241 9:125907612-125907634 TGTGACTGTAGAAGGTCCCCTGG - Intronic
1062411120 9:136425095-136425117 GCAGTTTCTAGAATGTCCTCGGG - Intergenic
1186117279 X:6318161-6318183 TCACTCAGGATAATGTCCCCCGG - Intergenic
1186627533 X:11310551-11310573 TCACTCAGTATAATGTCCCCAGG - Intronic
1187124007 X:16436491-16436513 TAAATCTGGAGAATGTCCCATGG + Intergenic
1189174916 X:38946688-38946710 TCATTCTGTAGTATGTGGCCTGG - Intergenic
1190112889 X:47606315-47606337 TCAGCATGTAGAATATCTCCTGG + Intronic
1190247251 X:48698803-48698825 TCAGTCTTTGGGATGTCCCAGGG + Intronic
1190489692 X:50969293-50969315 TGAGTCTGAAGAAACTCCCCAGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1195816412 X:108894012-108894034 TCAGTCTGTAGACCCACCCCAGG + Intergenic
1200033029 X:153311606-153311628 TCAGTGTCTGCAATGTCCCCAGG - Intergenic
1201934782 Y:19396613-19396635 TCAGTATTTGGATTGTCCCCAGG + Intergenic