ID: 1035399076 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:158553038-158553060 |
| Sequence | TCTGTGGAAATATACAGGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1035399076_1035399084 | 21 | Left | 1035399076 | 7:158553038-158553060 | CCTTCCCTGTATATTTCCACAGA | No data | ||
| Right | 1035399084 | 7:158553082-158553104 | CCTGCGTACACACACATGCTTGG | No data | ||||
| 1035399076_1035399085 | 22 | Left | 1035399076 | 7:158553038-158553060 | CCTTCCCTGTATATTTCCACAGA | No data | ||
| Right | 1035399085 | 7:158553083-158553105 | CTGCGTACACACACATGCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1035399076 | Original CRISPR | TCTGTGGAAATATACAGGGA AGG (reversed) | Intronic | ||