ID: 1035399078

View in Genome Browser
Species Human (GRCh38)
Location 7:158553043-158553065
Sequence CCAAGTCTGTGGAAATATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035399078_1035399084 16 Left 1035399078 7:158553043-158553065 CCTGTATATTTCCACAGACTTGG 0: 1
1: 0
2: 2
3: 7
4: 136
Right 1035399084 7:158553082-158553104 CCTGCGTACACACACATGCTTGG No data
1035399078_1035399085 17 Left 1035399078 7:158553043-158553065 CCTGTATATTTCCACAGACTTGG 0: 1
1: 0
2: 2
3: 7
4: 136
Right 1035399085 7:158553083-158553105 CTGCGTACACACACATGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035399078 Original CRISPR CCAAGTCTGTGGAAATATAC AGG (reversed) Intronic