ID: 1035399078 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:158553043-158553065 |
Sequence | CCAAGTCTGTGGAAATATAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 146 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 7, 4: 136} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1035399078_1035399084 | 16 | Left | 1035399078 | 7:158553043-158553065 | CCTGTATATTTCCACAGACTTGG | 0: 1 1: 0 2: 2 3: 7 4: 136 |
||
Right | 1035399084 | 7:158553082-158553104 | CCTGCGTACACACACATGCTTGG | No data | ||||
1035399078_1035399085 | 17 | Left | 1035399078 | 7:158553043-158553065 | CCTGTATATTTCCACAGACTTGG | 0: 1 1: 0 2: 2 3: 7 4: 136 |
||
Right | 1035399085 | 7:158553083-158553105 | CTGCGTACACACACATGCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1035399078 | Original CRISPR | CCAAGTCTGTGGAAATATAC AGG (reversed) | Intronic | ||