ID: 1035399081 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:158553054-158553076 |
Sequence | AGTGTAGACTCCCAAGTCTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 144 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 13, 4: 129} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1035399081_1035399084 | 5 | Left | 1035399081 | 7:158553054-158553076 | CCACAGACTTGGGAGTCTACACT | 0: 1 1: 0 2: 1 3: 13 4: 129 |
||
Right | 1035399084 | 7:158553082-158553104 | CCTGCGTACACACACATGCTTGG | No data | ||||
1035399081_1035399085 | 6 | Left | 1035399081 | 7:158553054-158553076 | CCACAGACTTGGGAGTCTACACT | 0: 1 1: 0 2: 1 3: 13 4: 129 |
||
Right | 1035399085 | 7:158553083-158553105 | CTGCGTACACACACATGCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1035399081 | Original CRISPR | AGTGTAGACTCCCAAGTCTG TGG (reversed) | Intronic | ||