ID: 1035399085

View in Genome Browser
Species Human (GRCh38)
Location 7:158553083-158553105
Sequence CTGCGTACACACACATGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035399081_1035399085 6 Left 1035399081 7:158553054-158553076 CCACAGACTTGGGAGTCTACACT 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1035399085 7:158553083-158553105 CTGCGTACACACACATGCTTGGG No data
1035399076_1035399085 22 Left 1035399076 7:158553038-158553060 CCTTCCCTGTATATTTCCACAGA No data
Right 1035399085 7:158553083-158553105 CTGCGTACACACACATGCTTGGG No data
1035399077_1035399085 18 Left 1035399077 7:158553042-158553064 CCCTGTATATTTCCACAGACTTG No data
Right 1035399085 7:158553083-158553105 CTGCGTACACACACATGCTTGGG No data
1035399078_1035399085 17 Left 1035399078 7:158553043-158553065 CCTGTATATTTCCACAGACTTGG 0: 1
1: 0
2: 2
3: 7
4: 136
Right 1035399085 7:158553083-158553105 CTGCGTACACACACATGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035399085 Original CRISPR CTGCGTACACACACATGCTT GGG Intronic