ID: 1035403144

View in Genome Browser
Species Human (GRCh38)
Location 7:158581223-158581245
Sequence TGTACCACAGGACACCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035403144 Original CRISPR TGTACCACAGGACACCTGGT GGG (reversed) Intronic
900814126 1:4830276-4830298 TCAACCACAGGAGTCCTGGTCGG - Intergenic
904241615 1:29149982-29150004 TGTACCACTGGACTCCAGCTTGG + Intronic
905455263 1:38084071-38084093 TGCTCCAGAGGACACCTGGTGGG + Intergenic
907058558 1:51396922-51396944 TGTACCACAGCACTCCAGCTTGG - Intronic
907204641 1:52758153-52758175 TGTGCCACTGCACACCTGGCTGG + Intronic
908267928 1:62396885-62396907 TGTACCAGAGAGCACCTGGGTGG - Intergenic
910397981 1:86810812-86810834 TTTAGCCCAAGACACCTGGTGGG + Intergenic
915573916 1:156762537-156762559 TGTACCTCTGGGTACCTGGTTGG + Intronic
915978811 1:160407789-160407811 TCTTCCACAGCTCACCTGGTGGG + Intronic
922921317 1:229307261-229307283 TGTACAACTGGACACATGCTGGG - Intergenic
923086489 1:230706928-230706950 GGGGCCACAGGACAGCTGGTGGG - Intronic
924365756 1:243291741-243291763 TGAATCACTGGACACCTAGTTGG - Intronic
1066434282 10:35382600-35382622 TGTACCACAGGACAGTTAGCAGG - Intronic
1070313231 10:75288651-75288673 TGTTCCACAGCCCACCTGCTGGG - Intergenic
1077571023 11:3338806-3338828 TGTACTAGAGGAGACCTGGGTGG + Intergenic
1078325540 11:10377837-10377859 TGCACCACAGCACACCAGGCTGG + Intronic
1080504864 11:32902555-32902577 TGGAACAAAGGAAACCTGGTGGG - Intronic
1081827158 11:46066653-46066675 TGTACCACCGCACACCAGCTTGG + Intronic
1083887392 11:65579494-65579516 TGCAACACAGGTCTCCTGGTAGG + Intronic
1084083870 11:66845850-66845872 TTTTCCCCAGGACACCTGATTGG + Exonic
1087865520 11:103221810-103221832 TGTACCACAGCACTCCTGCCTGG + Intronic
1096216236 12:49798933-49798955 TGTTCCACATGAGACCAGGTAGG - Intronic
1101114325 12:101517510-101517532 TGAACCAGAGGACACCTAGCTGG - Intergenic
1101191543 12:102338555-102338577 TGTACCACTGTCCACCTAGTTGG + Intergenic
1101204891 12:102476744-102476766 TATACCAAGGGACCCCTGGTTGG + Intronic
1105439111 13:20401281-20401303 TCTTCTACAGGACACCTGGCTGG + Intergenic
1108607021 13:52049869-52049891 TGTACCTCCTGATACCTGGTGGG - Intronic
1112503294 13:99958034-99958056 TTTACCACACGACCCCTTGTAGG - Intergenic
1113913227 13:113854543-113854565 TGCACCACAGGACACCCTGCTGG - Intronic
1114879652 14:26768630-26768652 TGCACCACAGCACTCCTGCTTGG - Intergenic
1116960442 14:50963098-50963120 TGTCCTCCAGGACACTTGGTGGG + Intergenic
1122052281 14:99067996-99068018 AGTATCACAGGGCACCTGGCAGG - Intergenic
1126118070 15:45227006-45227028 TTTCCCACAGGAGACCTTGTAGG + Intergenic
1135188634 16:20336411-20336433 TGTAACACAGGACACGGGGGAGG - Intronic
1136380105 16:29889547-29889569 TATACCACAGGGCACCTTGGTGG - Intronic
1139593928 16:67947528-67947550 TGTAACTCAGGACCCCTGGGTGG - Intronic
1140655687 16:77137009-77137031 TGTACTTCAGGTCAGCTGGTAGG - Intergenic
1143977257 17:10838970-10838992 TGTTCCTCAGGATAACTGGTGGG + Intergenic
1144744837 17:17607178-17607200 TGTCCCACTGGTCACCTGCTTGG - Intergenic
1146630610 17:34466786-34466808 TCTAACACAGGTCACCTAGTGGG + Intergenic
1146873996 17:36393228-36393250 TGTGCTACAGGACCCCTGGATGG - Intronic
1147065391 17:37919645-37919667 TGTGCTACAGGACCCCTGGATGG + Intergenic
1147362854 17:39942631-39942653 TGAACCACAGCACCCCTGGCAGG + Intronic
1150596425 17:66609954-66609976 TGAACTATAGGACACCCGGTTGG - Intronic
1152293929 17:79455866-79455888 CGTAGCACTGGACACCTGGGTGG - Intronic
1153321823 18:3780843-3780865 TGCACCACTGCACTCCTGGTGGG - Intronic
1154293062 18:13127394-13127416 TGCATGACAGGACACCTGGCTGG + Intergenic
1158398031 18:57094976-57094998 TGGATCCCAGGACCCCTGGTGGG - Intergenic
1158705194 18:59786335-59786357 GGTACTACAGGAGCCCTGGTGGG - Intergenic
1160544878 18:79646626-79646648 TGTGCCACAGAACAGCTGGGAGG + Intergenic
1162300566 19:9842572-9842594 AGGACCACAGGAGGCCTGGTGGG + Intronic
1164507960 19:28874879-28874901 AGTCTCATAGGACACCTGGTTGG - Intergenic
1164613299 19:29648187-29648209 TGTACCACAGCACTCCAGCTGGG + Intergenic
925012985 2:499942-499964 TGTAACACAGGAAACCTGGTCGG - Intergenic
928287846 2:30008933-30008955 TGCACCACAGGAGACCTGGGGGG - Intergenic
932467835 2:71934913-71934935 TGACCCACAGGACTCCTGCTGGG - Intergenic
937070027 2:119056340-119056362 TATTCCACAGGACCCCTGGTAGG - Intergenic
942333346 2:174852243-174852265 TGCACCACAGGACTCCAGCTTGG + Intronic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
943989869 2:194674485-194674507 AGTGCCACAGGACACATAGTTGG + Intergenic
944230011 2:197383108-197383130 TGTACCACTGGACTCCAGTTTGG + Intergenic
946398315 2:219454467-219454489 TGTAGCACTTGGCACCTGGTTGG - Intronic
946614699 2:221497010-221497032 TGTACCCCAGGATTTCTGGTGGG - Intronic
948354576 2:237367919-237367941 TGTGCCACAGGCAGCCTGGTAGG + Intronic
948506065 2:238427528-238427550 TGTACCACCGGACACGCCGTGGG - Intronic
1169391229 20:5192910-5192932 TTACCCACAGGACACCTGGAGGG + Exonic
1174644700 20:52075646-52075668 TGCACCACTGCACACCAGGTTGG - Intronic
1178171046 21:30040059-30040081 AGGACCAGAGGACACCTGTTGGG + Intergenic
1179296198 21:40065097-40065119 TGTCCCACTGTACACCTGGTAGG - Intronic
1179513562 21:41891466-41891488 TGTATCAGAGGGCACCTGCTGGG + Intronic
1179727326 21:43347722-43347744 GGGACCCCAGGACACCCGGTGGG + Intergenic
1182037828 22:27213392-27213414 TGGACCCCAGGACACCAGGCAGG - Intergenic
1184508379 22:44917743-44917765 TGCACCACTGGACACAGGGTGGG - Intronic
1184877602 22:47285378-47285400 TGGACCCCAGAATACCTGGTGGG - Intergenic
949455127 3:4230206-4230228 TGGACTGCAGGACAACTGGTTGG - Intronic
951665572 3:25119570-25119592 TGCAGCACAGGACAGGTGGTAGG + Intergenic
952369666 3:32709505-32709527 GTTACCACAGGACAAGTGGTGGG + Intronic
954378171 3:50205655-50205677 GGGACCACAGGACGCCTTGTTGG + Intronic
955494941 3:59521345-59521367 TGTAGCACAGGACACATGCTTGG + Intergenic
955621666 3:60870874-60870896 TGTACCCCAGGAGAACTGCTTGG + Intronic
956664572 3:71630546-71630568 TGTACCACTGCACACCAGCTTGG - Intergenic
959592211 3:108092735-108092757 TGTATCACAGAGCAGCTGGTTGG + Intergenic
961369529 3:126420944-126420966 TGTACCACACCACACCGGGCTGG - Intronic
965970314 3:174546509-174546531 TGTATCACAGAACCCCTGGGGGG - Intronic
967458733 3:189720927-189720949 TGCACCACTGGACAGCTGGAGGG + Intronic
967676024 3:192300165-192300187 TCCAACCCAGGACACCTGGTAGG - Intronic
972388912 4:38594133-38594155 TGTATCACAGGCCACGTGGGGGG - Intergenic
979311685 4:119211281-119211303 TGGTGCACAGGACACGTGGTAGG + Intronic
981461870 4:145022298-145022320 TATACCACAGTATACATGGTGGG + Intronic
986446770 5:7828458-7828480 TGTACCACGGGGCACCTGCCAGG - Exonic
988974640 5:36502835-36502857 TGTATCACGGGACTCCTGGAAGG + Intergenic
997479335 5:134171998-134172020 TGTACCACTGCACACCAGGCTGG + Intronic
997582247 5:135025309-135025331 TGTACCACAGGACAATAGGCTGG + Intergenic
998549517 5:143063867-143063889 TGTATCACATTCCACCTGGTGGG + Intronic
999712178 5:154328567-154328589 TGAATCACAGGACACCAGGCTGG - Intronic
1001414754 5:171537338-171537360 TGACCAACAGGACATCTGGTTGG + Intergenic
1001467537 5:171981549-171981571 TGAACTACAGGACACCCAGTTGG + Intronic
1003384718 6:5656592-5656614 TGTACCACAGCACTCCAGCTTGG - Intronic
1003704764 6:8512793-8512815 TGTACCACTGCACTCCAGGTTGG + Intergenic
1007359206 6:41343007-41343029 TGAGCCACAGGGCACCAGGTGGG + Intronic
1007387737 6:41530954-41530976 TGTATCCCAGGCCACCTGCTGGG - Intergenic
1007781261 6:44256337-44256359 TGTGCCACAGGGCTCCAGGTGGG - Exonic
1011649192 6:89490339-89490361 TGTACTACACAACACCTGGTGGG - Intronic
1015824588 6:137298111-137298133 TGAACCACAGGAAACCTGATAGG + Intergenic
1017123903 6:151048903-151048925 TGAATAAGAGGACACCTGGTTGG - Intronic
1017257970 6:152355525-152355547 TGCACCTCAGAGCACCTGGTGGG - Intronic
1019088485 6:169503053-169503075 TGGACCACAAGACATCTGGGAGG + Intronic
1019387219 7:764061-764083 TGAACCACAGCTCAGCTGGTCGG - Intronic
1019478833 7:1256836-1256858 TGTGCCCCAGGGCACCGGGTGGG + Intergenic
1025996040 7:66528188-66528210 TGAACCAGAGGGGACCTGGTGGG + Intergenic
1026621298 7:71952205-71952227 GATACCACAGGTCACCTGGCAGG + Intronic
1031861606 7:126986053-126986075 TGTACCACTGGACTCCAGCTGGG - Intronic
1032170955 7:129584068-129584090 TGCAGCACCGGAGACCTGGTAGG + Intergenic
1032793416 7:135258938-135258960 TGTGCCACAGGACAGCTGGGTGG + Intergenic
1033446328 7:141425504-141425526 TCTACCTAAGCACACCTGGTTGG + Intronic
1035403144 7:158581223-158581245 TGTACCACAGGACACCTGGTGGG - Intronic
1038863080 8:31408928-31408950 TGTACCACAGCACACCAGCCTGG - Intergenic
1039784566 8:40822062-40822084 TGTACAACAGGACGCCAAGTGGG + Intronic
1047445182 8:124913230-124913252 TGAATCAGAGGACACCTGGCTGG + Intergenic
1048998293 8:139807665-139807687 TGTAACACAGAACCCCTGCTTGG - Intronic
1049541103 8:143209390-143209412 TGTACCTCAGTGCACATGGTGGG + Intergenic
1049786521 8:144453539-144453561 AGTCCCTCAGGACACCTGGCTGG - Intronic
1054958710 9:70942978-70943000 TTTACCACAGGACCCCAGTTAGG - Intronic
1056221082 9:84451294-84451316 TGAACTGCAGGACACCTGGTTGG + Intergenic
1058950954 9:109903321-109903343 TGGACCACAGGGCCACTGGTTGG + Intronic
1061037327 9:128120980-128121002 TCTAACACAGGGCACCTGCTGGG - Exonic
1062431642 9:136529143-136529165 TGTGGCCCAGGTCACCTGGTGGG - Intronic
1187968044 X:24632020-24632042 GGCACCTCAGGGCACCTGGTGGG - Intronic
1192448167 X:71225657-71225679 TGTCCCACAGTCCACCTGTTGGG + Intergenic
1196783633 X:119403864-119403886 TGAATCAGAGGACACCTAGTTGG - Intronic
1198198487 X:134389513-134389535 TCTACCACAAGGCACCTGGTTGG - Intronic
1198501247 X:137249646-137249668 TGTACCACTACACACCTAGTAGG + Intergenic
1199675216 X:150182949-150182971 TGTGCCACTGGAGACCTGGAAGG - Intergenic
1201104921 Y:10756382-10756404 TGTACCACAGCACTCCAGTTTGG - Intergenic