ID: 1035404041

View in Genome Browser
Species Human (GRCh38)
Location 7:158587165-158587187
Sequence GGTTTAGGGGAGGGGCGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035404041_1035404060 29 Left 1035404041 7:158587165-158587187 CCGAGACGCCCCTCCCCTAAACC 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1035404060 7:158587217-158587239 CCCACGCCCCGCATTCATTGAGG No data
1035404041_1035404048 -4 Left 1035404041 7:158587165-158587187 CCGAGACGCCCCTCCCCTAAACC 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1035404048 7:158587184-158587206 AACCCCCCACTCATTCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035404041 Original CRISPR GGTTTAGGGGAGGGGCGTCT CGG (reversed) Intronic
904051357 1:27641291-27641313 GGGTTGGGGGAGGGGCGTGGAGG - Intergenic
905452177 1:38063938-38063960 GGATCAGGGGAGGGGAGTCCAGG + Intergenic
905456665 1:38092779-38092801 GCTACAGGGGAGGGGCATCTAGG - Intergenic
910467707 1:87517781-87517803 AGTTTGGGGGAGGGGCGTAGGGG + Intergenic
918076596 1:181175593-181175615 GGGTCAGGGGAGGGGCGGCTGGG - Intergenic
922329570 1:224562450-224562472 GGTTTAAGGGAGAAGGGTCTGGG + Intronic
923546324 1:234926252-234926274 GGTTTAGGGGAGGGGAGCAGAGG + Intergenic
1063665133 10:8056189-8056211 GGTTTTGGGGTGGGGGGTCTCGG + Intronic
1064382693 10:14860771-14860793 GGATTTGGGGAGAGGGGTCTGGG + Intronic
1069909551 10:71751094-71751116 GGTTGAGGGGCTGGGCTTCTGGG + Exonic
1070205200 10:74252073-74252095 GGTTTGGTGGAGGGGCTTCTTGG + Intronic
1072921710 10:99582387-99582409 GGTTTCTGGGAAGGGCTTCTTGG + Intergenic
1074285260 10:112091832-112091854 GGTTTAGGGGATGGGATTGTGGG - Intergenic
1075025038 10:118978226-118978248 GGCTTAGGGTAGGGGCGGGTGGG - Intergenic
1075783533 10:125032809-125032831 GGTTGTGGGGAGGGGCTTCTGGG - Intronic
1077124543 11:926401-926423 GGTCTAGGGGTGCGGGGTCTAGG + Intronic
1077630475 11:3808134-3808156 AGTTTGGGGGAGGGGCGCCAGGG + Intronic
1078092388 11:8272996-8273018 GGTTCAGGGGAGGGGAGAATGGG + Intergenic
1080192438 11:29568502-29568524 GGTTGTGGGGAGGGGCATCATGG - Intergenic
1081505536 11:43712555-43712577 AGTGCAGGGGAGGGGCTTCTAGG - Intronic
1083309097 11:61775419-61775441 GTCTTAGGGGAGGGGCCCCTGGG - Intronic
1083680236 11:64348371-64348393 GGCTTGGGGGAGGGGGTTCTAGG + Intronic
1084173431 11:67411282-67411304 GGCCTAGGGGCGGGGGGTCTGGG - Intronic
1084194959 11:67519255-67519277 GGTTGAGGGGAGGGTCTTCAAGG + Intronic
1085781685 11:79414965-79414987 GGCTTAGGGGAGAGGCCTCGTGG + Intronic
1085850108 11:80109869-80109891 GGCTCAGGGGAGGGGCACCTGGG + Intergenic
1088088726 11:106012279-106012301 GGTTTAAGGGAGGGGAGGATGGG - Intronic
1090128442 11:124115038-124115060 GCTGTAGGGGAGGGGCAACTTGG + Intergenic
1096124603 12:49110238-49110260 GGGGCAGGGGAGGGGCGTGTGGG + Intronic
1096214527 12:49791996-49792018 GGCGTAGGGGACGGGCGGCTGGG + Exonic
1096259219 12:50080695-50080717 GGGTTTGGGGAAGGGCCTCTGGG - Exonic
1097169662 12:57105652-57105674 GGTATAGGGGAAGGGGGTCTGGG - Intronic
1097681874 12:62656825-62656847 GGTCTATGGCAGTGGCGTCTTGG + Intronic
1106650387 13:31683979-31684001 GGCTTTGGGGAGGAGGGTCTAGG + Intergenic
1107223235 13:38012338-38012360 GATTCAGGGAAGGGGCTTCTTGG + Intergenic
1107347240 13:39474876-39474898 GGAGTAGGGGAGGGCCTTCTAGG + Intronic
1112489368 13:99848159-99848181 GGGTTGGAGGAGGGGAGTCTGGG - Intronic
1114312283 14:21477918-21477940 GGTTGAGGGGAGGAGCTTATTGG + Intronic
1117456005 14:55897639-55897661 GGTTGAGGGTAGGGGTTTCTGGG - Intergenic
1119506330 14:75176291-75176313 GGCTTAGGCGAGGGGAGGCTCGG - Intronic
1120886241 14:89453917-89453939 GATTTGGAGGAGGGGCTTCTGGG + Intronic
1122549002 14:102539934-102539956 GGTGTTGGGGAGGGTCGTCTTGG - Intergenic
1122826732 14:104374282-104374304 GGTTTAGGAGGAGGGCGTCCTGG + Intergenic
1122906667 14:104804850-104804872 CGTTTGGGGGAGGGGAGTCCAGG + Intergenic
1127190522 15:56525722-56525744 GGTTTAGAGGAGGCGCCCCTGGG + Intergenic
1129376603 15:75137650-75137672 GCTTTAGGGCAAGGGTGTCTGGG + Intergenic
1130196295 15:81783087-81783109 GGATTAGGGCATGGGTGTCTTGG - Intergenic
1131315255 15:91329832-91329854 GGGATAGGGGAGGGGTGTGTAGG + Intergenic
1131865327 15:96702606-96702628 GGTATGGGGGAGGGGCGGATGGG + Intergenic
1132757759 16:1494146-1494168 GGTTGAGGGGTGTGGGGTCTCGG + Intronic
1137423253 16:48354092-48354114 GGGTTAGGGGTGGGGCGGGTGGG + Exonic
1138100842 16:54251334-54251356 GAGTTAGGGGAGGGGCGAATGGG + Intronic
1138591314 16:58000908-58000930 GGCTTAGGGGAGGGGGCTCCGGG + Intronic
1139776852 16:69321794-69321816 GGGTTAGGAGAGAGGTGTCTCGG + Intronic
1140409992 16:74735600-74735622 GGTTTTGGGGTGGGGCCCCTGGG - Intronic
1140873943 16:79132909-79132931 GGATTAGTGGTGGGGCTTCTTGG + Intronic
1144461857 17:15464687-15464709 TGTTTAGAGGAGGGGAGACTTGG - Intronic
1145373844 17:22329583-22329605 GCTCTAGGGGAGGGGCCTGTGGG + Intergenic
1146114402 17:30121961-30121983 GGTTTAGGGGTGGGGAGAATGGG - Intronic
1146633963 17:34490696-34490718 TGTTTAGGGGAAGAGGGTCTTGG - Intergenic
1147994387 17:44353172-44353194 GGGGTAGGGGAGGGGAGTGTTGG - Intergenic
1149418808 17:56488450-56488472 GGTTTAGGGCAGGGGAGTGATGG + Intronic
1150132068 17:62674696-62674718 GGTTGAGGGGGGGGGTGTCAAGG + Intronic
1151491301 17:74433404-74433426 GGGATAGGGGTGGGGTGTCTAGG + Intronic
1151705570 17:75765248-75765270 GGTCTGGGGGCGGGGCGTCCGGG - Exonic
1152104943 17:78323333-78323355 GGTTCTGGGGAGGGGAGCCTGGG + Intergenic
1153314882 18:3711903-3711925 GGTTTAGGGATGGGGAGTGTGGG + Intronic
1153576167 18:6524054-6524076 TGTTTAGGGGAGAGGCTTCCAGG + Intronic
1156499786 18:37550454-37550476 GGTACAGGGCAGGGGCTTCTTGG - Intronic
1158209277 18:55028301-55028323 GGTCTAAGGGAGGGGAGTCTAGG + Intergenic
1158670242 18:59467957-59467979 GGTTTAGGGCAGGGACACCTGGG - Intronic
1160915230 19:1493193-1493215 GATTTAGGGGAGGGACGCCCTGG + Intronic
1161114430 19:2488898-2488920 GGCGGACGGGAGGGGCGTCTGGG - Intergenic
1162576918 19:11504956-11504978 GGTTTAGGGGAGTGCAGTCCAGG + Intronic
1162896256 19:13766148-13766170 GGGGTAGGGGAGGGCCTTCTAGG + Intronic
1163094251 19:15044450-15044472 GGTTTGGGGGAGGGACATCGTGG - Intergenic
1163246431 19:16097862-16097884 GGTTTAGGGGAGGTGCATTTTGG - Intronic
1164684509 19:30158079-30158101 GCTCTTGGGGAGGGGAGTCTGGG + Intergenic
1164797551 19:31046228-31046250 GGTAGAGGGGAGGAGCGCCTGGG + Intergenic
1165569610 19:36764443-36764465 GCTCTAGGGGAGGGGCTTGTGGG - Intronic
1165818508 19:38658984-38659006 CGGTTAGGGGAGGGCCTTCTTGG + Intronic
1166799886 19:45450348-45450370 GGTTTAGGGGATTGGAGGCTGGG - Intronic
1166872170 19:45877304-45877326 GGTCCAGGGGAGGGGCCTGTGGG + Intergenic
1166895359 19:46019019-46019041 GGTTCAGGGCCGGGGCCTCTGGG + Intronic
1167414821 19:49364510-49364532 GGTGCTGGAGAGGGGCGTCTTGG + Intronic
1168293688 19:55369129-55369151 GGTCTCGGGGAGGAGGGTCTGGG + Intronic
928255945 2:29722820-29722842 GGTTTAGGGGAAGGGAGGTTAGG - Intronic
928398953 2:30964385-30964407 TGGTGAGGGGAGGAGCGTCTGGG - Intronic
930498883 2:52185521-52185543 GGTTTCGGGGAGCGGTGTCATGG - Intergenic
931289087 2:60856659-60856681 GGATTTGGGGAGGGAGGTCTGGG + Intergenic
932801670 2:74747285-74747307 GGTTTAGGGGAGGGGGATAAGGG - Intergenic
935103840 2:100021116-100021138 GGATTTGGTGAGGGGAGTCTGGG - Intronic
935269308 2:101419894-101419916 GCTTTGGGGAAGGGGGGTCTGGG + Intronic
936800183 2:116257143-116257165 GTGTTAGGGGAGGGGCCTCCTGG - Intergenic
937275095 2:120679143-120679165 GGGCTAGGGGAGGGGCTTCAGGG - Intergenic
945988111 2:216371220-216371242 GGTAGAGGAGAGGGGCGTGTGGG + Exonic
948125270 2:235560415-235560437 GGATTAGGGGACAGGCATCTCGG - Intronic
948325560 2:237117474-237117496 GGTTAAGGGGAGGGGAGTCCTGG - Intergenic
1169120873 20:3094937-3094959 GATTTAGGGGTGGGGACTCTGGG - Intergenic
1169402545 20:5295320-5295342 TGTTTAGGGGAGAGCCGACTGGG - Intergenic
1171528955 20:25838821-25838843 GCTCTAGGGGAGGGGCCTGTGGG - Intronic
1171547871 20:26017064-26017086 GCTCTAGGGGAGGGGCCTGTGGG + Intergenic
1172631268 20:36379627-36379649 GGTTGTGGGGAGGGGCTTCCTGG + Intronic
1174365324 20:50053168-50053190 GGCTTTGGGGAGGGGGGTCCCGG + Intergenic
1175261270 20:57675578-57675600 GGTTTGGGGGAGGAGGGTCTAGG + Intronic
1175701480 20:61140814-61140836 GGTCTAGGGGAGGGTCGGCAGGG + Intergenic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1180933801 22:19611033-19611055 GGGTCAGTGGAGGGGCCTCTGGG - Intergenic
1182369105 22:29798536-29798558 GGTGTAAGGTAGGGCCGTCTAGG - Intronic
1184751200 22:46487694-46487716 GGTATGGGGGAGGGGAGTCCAGG + Intronic
1184751229 22:46487764-46487786 GGTATTGGGGAGGGGAGTCCAGG + Intronic
1184960868 22:47927576-47927598 GGATTTGGGGGGGGGCGTCTAGG + Intergenic
950264028 3:11561655-11561677 GGTGTGGGGGAGGGGAGCCTCGG - Intronic
950434055 3:12967896-12967918 GGGTCAGGGGCGGGGCGTCAGGG + Intronic
950616959 3:14167467-14167489 GGTTGAGAGGAGGGTTGTCTGGG - Intronic
955903863 3:63786198-63786220 TGTATAGGGGAGGGGGGTCAGGG - Intergenic
956595042 3:70958234-70958256 GGTTCGGGGGAGGGGTGTTTCGG - Intronic
957166134 3:76676184-76676206 GTGTTGGGGGAGGGGCCTCTTGG + Intronic
961826250 3:129600673-129600695 GATTTAGGAGAGGGGGTTCTAGG - Intronic
963132962 3:141875787-141875809 GGTTAAGAGTAGGAGCGTCTGGG + Intergenic
964379352 3:156082323-156082345 CGATTAGAGGAGGGGCTTCTTGG - Intronic
968089552 3:195891833-195891855 GCTTCAGGGGAGGGGCCTCTGGG - Intronic
968949627 4:3683834-3683856 GGTCTCGGGGAGGAGCGGCTGGG - Intergenic
974789704 4:66671574-66671596 GGTTGAAGGGAGGGGCGGCGGGG - Intergenic
975378190 4:73669351-73669373 GGGTTTGGGGAGGGGTGTGTGGG + Intergenic
975827607 4:78336374-78336396 TGTTTAGGGGAGGAAAGTCTGGG + Intronic
977600376 4:98928847-98928869 GGTGTGGGGGAGGGGCGGCGTGG - Intronic
978495681 4:109357002-109357024 GGTATAGGGGAGTGGACTCTTGG - Intergenic
979203811 4:118010708-118010730 GGTTTAAGGGAGGGGGTTCTTGG + Intergenic
984635578 4:182106091-182106113 GGGTCAGGGGAGGGGAGGCTTGG - Intergenic
985340167 4:188942731-188942753 GGGTTAGGGGAGGGGCCTGGAGG + Intergenic
985782227 5:1877303-1877325 GCTTTTGGGGAGTGGAGTCTGGG + Intergenic
987311527 5:16685698-16685720 GGGATGGGGGTGGGGCGTCTAGG - Intronic
991634314 5:68689136-68689158 GGTTTAGGAGAGTGCTGTCTGGG + Intergenic
998766439 5:145493033-145493055 AGGTTTGGGGAGGGGTGTCTTGG + Intronic
999063063 5:148655730-148655752 GGTTTAGGGAAGGGGAGTAGTGG - Intronic
1001424879 5:171616403-171616425 GCTGTGGGGGAGGGGCGTGTGGG + Intergenic
1007397041 6:41583778-41583800 GGTTCAGGGGAGGTGGGGCTGGG + Intronic
1012682231 6:102196362-102196384 GGTTTAGGGGAGGGGTGACATGG + Intergenic
1017186467 6:151605688-151605710 GGTTGAGGGGAGGGGCATTGTGG + Intronic
1019450512 7:1095339-1095361 GGTGTCGGGGAGGGGGGTTTGGG - Intronic
1022234294 7:28446202-28446224 GGGGGAGGGGAGGGGCGGCTGGG - Intronic
1023136469 7:37057787-37057809 GGTTTAGAGGAGGGGAGTACTGG + Intronic
1029414919 7:100436472-100436494 GGTTTCCGGTAGCGGCGTCTAGG - Exonic
1030788698 7:113696152-113696174 GGTTTAGGGGAGGGGAAGATGGG - Intergenic
1031985192 7:128159711-128159733 GGGTTAGGTGAGGGGTGCCTAGG + Intergenic
1033248504 7:139738701-139738723 GGTATAGGGGAGGGGAATCTGGG + Intronic
1034391660 7:150792029-150792051 GTTGTCGGGGAGGGGCCTCTGGG - Intronic
1034457100 7:151176497-151176519 GGTTTAGCGGGTGGGAGTCTTGG + Intronic
1035404041 7:158587165-158587187 GGTTTAGGGGAGGGGCGTCTCGG - Intronic
1040524127 8:48203801-48203823 GGTTTAGGGGATGAATGTCTAGG - Intergenic
1040592415 8:48805668-48805690 TGATTAGGGGAGGCGAGTCTCGG - Intergenic
1045664428 8:104469659-104469681 AGTCTAGGGGAGGGGCCTTTAGG - Intergenic
1049216816 8:141412100-141412122 GGGTTCAGGGAGGGGCGTCATGG + Intronic
1053796935 9:41735053-41735075 GCTCTAGGGGAGGGGCCTGTGGG - Intergenic
1054148255 9:61579801-61579823 GCTCTAGGGGAGGGGCCTGTGGG + Intergenic
1054185349 9:61947136-61947158 GCTCTAGGGGAGGGGCCTGTGGG - Intergenic
1054468000 9:65510909-65510931 GCTCTAGGGGAGGGGCCTGTGGG + Intergenic
1054653160 9:67641361-67641383 GCTCTAGGGGAGGGGCCTGTGGG + Intergenic
1056919284 9:90772018-90772040 TGGTTAGGGGAGTGGGGTCTGGG - Intergenic
1058824838 9:108765937-108765959 GGTTTTGGGGTGGGGGGTATGGG + Intergenic
1061923347 9:133794234-133794256 GGTGTTGGAGAGGGGCGGCTTGG + Intronic
1062461227 9:136663355-136663377 GGTTCAGGGGAAGGGCGACTGGG - Intronic
1062615472 9:137394106-137394128 GGGTTAGGGAAGCGGCGGCTGGG - Intronic
1187276178 X:17818195-17818217 GGTTTAGGGGGTGGGAGGCTGGG - Intronic
1194847368 X:98826997-98827019 GGGTTGGGGGTGGGGCGTCTGGG - Intergenic
1197745920 X:129932255-129932277 GGGGTAGGGGAGGGGCGCCGGGG - Intergenic
1199649831 X:149939888-149939910 AGCTTAGGGGAGCGGCGGCTTGG + Intergenic
1200787428 Y:7273040-7273062 GGGTCAGGGGAGCAGCGTCTAGG + Intergenic
1201340031 Y:12924249-12924271 TGTTTAGGGGAGGGATTTCTAGG + Intergenic