ID: 1035404281

View in Genome Browser
Species Human (GRCh38)
Location 7:158587884-158587906
Sequence CCGGGGGCGTGGCCTGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035404281_1035404298 17 Left 1035404281 7:158587884-158587906 CCGCCCTCAGGCCACGCCCCCGG No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404281_1035404290 -4 Left 1035404281 7:158587884-158587906 CCGCCCTCAGGCCACGCCCCCGG No data
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035404281 Original CRISPR CCGGGGGCGTGGCCTGAGGG CGG (reversed) Intergenic
No off target data available for this crispr