ID: 1035404290

View in Genome Browser
Species Human (GRCh38)
Location 7:158587903-158587925
Sequence CCGGCCAGCCCCGCTCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035404278_1035404290 9 Left 1035404278 7:158587871-158587893 CCCGGACGCGCGTCCGCCCTCAG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404276_1035404290 11 Left 1035404276 7:158587869-158587891 CCCCCGGACGCGCGTCCGCCCTC 0: 1
1: 0
2: 0
3: 15
4: 86
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404281_1035404290 -4 Left 1035404281 7:158587884-158587906 CCGCCCTCAGGCCACGCCCCCGG No data
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404269_1035404290 30 Left 1035404269 7:158587850-158587872 CCCCGGCGGCAGGGCCCCGCCCC 0: 1
1: 0
2: 12
3: 50
4: 463
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404279_1035404290 8 Left 1035404279 7:158587872-158587894 CCGGACGCGCGTCCGCCCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404284_1035404290 -8 Left 1035404284 7:158587888-158587910 CCTCAGGCCACGCCCCCGGCCAG No data
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404270_1035404290 29 Left 1035404270 7:158587851-158587873 CCCGGCGGCAGGGCCCCGCCCCC 0: 1
1: 0
2: 3
3: 84
4: 608
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404274_1035404290 15 Left 1035404274 7:158587865-158587887 CCCGCCCCCGGACGCGCGTCCGC 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404273_1035404290 16 Left 1035404273 7:158587864-158587886 CCCCGCCCCCGGACGCGCGTCCG 0: 1
1: 0
2: 1
3: 25
4: 195
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404283_1035404290 -7 Left 1035404283 7:158587887-158587909 CCCTCAGGCCACGCCCCCGGCCA No data
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404271_1035404290 28 Left 1035404271 7:158587852-158587874 CCGGCGGCAGGGCCCCGCCCCCG 0: 1
1: 0
2: 3
3: 69
4: 539
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404277_1035404290 10 Left 1035404277 7:158587870-158587892 CCCCGGACGCGCGTCCGCCCTCA 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
1035404275_1035404290 14 Left 1035404275 7:158587866-158587888 CCGCCCCCGGACGCGCGTCCGCC 0: 1
1: 0
2: 0
3: 36
4: 277
Right 1035404290 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035404290 Original CRISPR CCGGCCAGCCCCGCTCGCCC CGG Intergenic
No off target data available for this crispr