ID: 1035404298

View in Genome Browser
Species Human (GRCh38)
Location 7:158587924-158587946
Sequence GGCCACGCCCCCCGCCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035404291_1035404298 -6 Left 1035404291 7:158587907-158587929 CCAGCCCCGCTCGCCCCGGCCAC No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404287_1035404298 0 Left 1035404287 7:158587901-158587923 CCCCGGCCAGCCCCGCTCGCCCC No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404289_1035404298 -2 Left 1035404289 7:158587903-158587925 CCGGCCAGCCCCGCTCGCCCCGG No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404278_1035404298 30 Left 1035404278 7:158587871-158587893 CCCGGACGCGCGTCCGCCCTCAG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404286_1035404298 1 Left 1035404286 7:158587900-158587922 CCCCCGGCCAGCCCCGCTCGCCC No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404292_1035404298 -10 Left 1035404292 7:158587911-158587933 CCCCGCTCGCCCCGGCCACGCCC No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404279_1035404298 29 Left 1035404279 7:158587872-158587894 CCGGACGCGCGTCCGCCCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404284_1035404298 13 Left 1035404284 7:158587888-158587910 CCTCAGGCCACGCCCCCGGCCAG No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404283_1035404298 14 Left 1035404283 7:158587887-158587909 CCCTCAGGCCACGCCCCCGGCCA No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404281_1035404298 17 Left 1035404281 7:158587884-158587906 CCGCCCTCAGGCCACGCCCCCGG No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404285_1035404298 6 Left 1035404285 7:158587895-158587917 CCACGCCCCCGGCCAGCCCCGCT No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data
1035404288_1035404298 -1 Left 1035404288 7:158587902-158587924 CCCGGCCAGCCCCGCTCGCCCCG No data
Right 1035404298 7:158587924-158587946 GGCCACGCCCCCCGCCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035404298 Original CRISPR GGCCACGCCCCCCGCCCGCC CGG Intergenic
No off target data available for this crispr