ID: 1035411303

View in Genome Browser
Species Human (GRCh38)
Location 7:158644761-158644783
Sequence TGGTGGTGATCTCAATGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035411296_1035411303 -5 Left 1035411296 7:158644743-158644765 CCATCCTCAACATCCTCCTGGTG 0: 1
1: 1
2: 3
3: 30
4: 344
Right 1035411303 7:158644761-158644783 TGGTGGTGATCTCAATGCAGGGG No data
1035411293_1035411303 13 Left 1035411293 7:158644725-158644747 CCTGGCAGCATCCAACATCCATC No data
Right 1035411303 7:158644761-158644783 TGGTGGTGATCTCAATGCAGGGG No data
1035411298_1035411303 -9 Left 1035411298 7:158644747-158644769 CCTCAACATCCTCCTGGTGGTGA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1035411303 7:158644761-158644783 TGGTGGTGATCTCAATGCAGGGG No data
1035411294_1035411303 2 Left 1035411294 7:158644736-158644758 CCAACATCCATCCTCAACATCCT No data
Right 1035411303 7:158644761-158644783 TGGTGGTGATCTCAATGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035411303 Original CRISPR TGGTGGTGATCTCAATGCAG GGG Intronic