ID: 1035411314

View in Genome Browser
Species Human (GRCh38)
Location 7:158644827-158644849
Sequence TGATAAGAATACTCCTTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035411314_1035411316 11 Left 1035411314 7:158644827-158644849 CCAGTTAAGGAGTATTCTTATCA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1035411316 7:158644861-158644883 TCCTATCCATTTAGGCTTACAGG No data
1035411314_1035411318 12 Left 1035411314 7:158644827-158644849 CCAGTTAAGGAGTATTCTTATCA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1035411318 7:158644862-158644884 CCTATCCATTTAGGCTTACAGGG No data
1035411314_1035411315 3 Left 1035411314 7:158644827-158644849 CCAGTTAAGGAGTATTCTTATCA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1035411315 7:158644853-158644875 TGCAGATATCCTATCCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035411314 Original CRISPR TGATAAGAATACTCCTTAAC TGG (reversed) Intronic
908442032 1:64164478-64164500 GGATAAGAATAGTACTTAAAAGG + Intronic
908830039 1:68169787-68169809 TGATATTAAGACTCCTTAAATGG + Intronic
908954122 1:69600442-69600464 TTTTTAGAATAGTCCTTAACTGG + Intronic
909501344 1:76338535-76338557 CTATAGCAATACTCCTTAACGGG + Intronic
909671573 1:78194947-78194969 TGATAAGAATACAAAGTAACTGG - Intergenic
909873222 1:80770530-80770552 TGTTAAGAAACCTCCTTGACAGG + Intergenic
912175088 1:107144820-107144842 TGATAAAAATACCCATTAATAGG - Intronic
913204199 1:116520957-116520979 TGATAGGATTATTCCTTATCTGG + Intronic
913226495 1:116704899-116704921 TGGTAAGAATATTCCTGCACAGG - Intronic
913415001 1:118595435-118595457 TGCTAACAAAAATCCTTAACAGG - Intergenic
916266508 1:162895346-162895368 TAATAAGAATTATCTTTAACTGG + Intergenic
917481255 1:175414132-175414154 AGGTAAGGATACTCCTTACCTGG + Intronic
917670076 1:177265472-177265494 AAATAAGAAAACTACTTAACAGG - Intronic
921268375 1:213445073-213445095 TGATATGAATTCTCCAGAACGGG - Intergenic
921348846 1:214215048-214215070 TGATAAGAATATTGATTTACAGG - Intergenic
921491517 1:215782085-215782107 TGATATGAATATTCCTGAAATGG + Exonic
924771246 1:247081658-247081680 TGATGAGAACATTACTTAACTGG - Intergenic
1065512101 10:26489661-26489683 TGATAACAATAATACTTATCTGG - Intronic
1067494625 10:46750684-46750706 TGAAAAAAATGCTCCCTAACAGG - Intergenic
1067600031 10:47589714-47589736 TGAAAAAAATGCTCCCTAACAGG + Intergenic
1068581470 10:58745343-58745365 TGATAATAATAATCCCTCACAGG + Intronic
1070985076 10:80681723-80681745 TGATAAGTATACTCTTTATTTGG + Intergenic
1071651572 10:87397595-87397617 TGAAAAAAATGCTCCCTAACAGG + Intergenic
1089489567 11:118873617-118873639 TGAGATGAATACACCTTAGCCGG + Intergenic
1090978840 11:131698753-131698775 TGAGAAGAATACTCCTAACAAGG - Intronic
1091159443 11:133406505-133406527 TGATAAGAAAAATCATTTACTGG + Intronic
1094591802 12:31828537-31828559 TGATGAGAATTCTCTTTAAGAGG - Intergenic
1095885267 12:47182297-47182319 TGATAAGAATACTACTGCCCTGG + Intronic
1095898363 12:47303250-47303272 TAATAAGAGTACGCCTTGACAGG + Intergenic
1097940165 12:65295399-65295421 AGATAAAAATAATCCTTAAAAGG - Intronic
1099600995 12:84737283-84737305 TGATGAGAGTATTCCATAACTGG + Intergenic
1101571258 12:105955824-105955846 TAATAATAATACTACCTAACAGG + Intergenic
1102454773 12:113064677-113064699 GGATAAGAATAGTCCCTAGCTGG + Intronic
1109312155 13:60708319-60708341 TGATATCAATATGCCTTAACTGG - Intergenic
1110210582 13:72967883-72967905 TGATAAAAATATTCCATATCTGG + Intronic
1112465205 13:99637918-99637940 AGATAAGAATGATCCGTAACTGG - Intronic
1115256511 14:31408495-31408517 TGATAAGAATACTATTTTAATGG + Intronic
1116423997 14:44767288-44767310 TGTTAAGAATACACTTTATCAGG + Intergenic
1121235295 14:92387470-92387492 TGATAAAAATACTCCTGGCCGGG - Intronic
1124356288 15:28997146-28997168 TGACAAGAATGCTCCCCAACTGG - Intronic
1124556821 15:30733852-30733874 GGATAAAAATACTACCTAACAGG + Intronic
1125188391 15:36959909-36959931 TGACAACAATCCTACTTAACAGG + Intronic
1129063116 15:72877038-72877060 TGATATCAATTCTCCTTAAATGG - Intergenic
1129208313 15:74050575-74050597 TGCTAAAAATGCTCCTTAAGAGG - Intergenic
1130247018 15:82261667-82261689 TGGTAAGAATACTTTTTAAATGG - Exonic
1130453605 15:84081244-84081266 TGGTAAGAATACTTTTTAAATGG + Intergenic
1137343627 16:47634841-47634863 TGATAACAAAACTGCTTATCAGG - Intronic
1143639552 17:8188393-8188415 TGATTAGAACACTCCACAACAGG + Exonic
1144306790 17:13975818-13975840 TTATAAAAATACTCCTTTAGAGG - Intergenic
1147051718 17:37800106-37800128 TGATAAAAATACACCATAGCAGG + Intergenic
1148026384 17:44591818-44591840 TGAGAAGACTACTTCCTAACTGG - Intergenic
1149084452 17:52698078-52698100 TGAAAAGGATACTTCTTTACAGG - Intergenic
1150499973 17:65641466-65641488 TGATGAAAATACTCCTTGAGGGG + Intronic
1156793329 18:41006514-41006536 TTATAAGAATACCCATTACCTGG - Intergenic
1157634086 18:49131739-49131761 TGTTAAGAATACTGCATAGCTGG - Intronic
1157635663 18:49151269-49151291 TCATGAGAAGAATCCTTAACAGG - Intronic
1158033295 18:52993240-52993262 GGATAAGAAAAGTTCTTAACTGG + Intronic
1164607372 19:29609879-29609901 TTAGGACAATACTCCTTAACCGG - Intronic
1168628591 19:57938883-57938905 TGATAATAATTATCCTAAACGGG - Intergenic
1168635412 19:57992356-57992378 TGATAAGAATACTTCATAGGTGG - Intronic
927218332 2:20682932-20682954 TGAGCAGCATACTCCTTATCTGG + Intergenic
928486462 2:31737335-31737357 AGATAATAATAGTTCTTAACCGG + Intergenic
928696811 2:33857576-33857598 TGTTCAGAATACTTGTTAACTGG + Intergenic
939444533 2:142291662-142291684 AGATGAGAATACTGATTAACTGG + Intergenic
941193155 2:162412619-162412641 TGCTAAAAATACTCCATAAATGG - Intronic
941350882 2:164433650-164433672 TGATAGTAATATTCCTTAAGGGG - Intergenic
947096313 2:226571009-226571031 TGATAAGATTACACATAAACAGG + Intergenic
947397753 2:229702970-229702992 TGACAAGAATCCTCCAAAACAGG - Intronic
1170579699 20:17688808-17688830 TGGTAAGAATTCTCCCTACCTGG + Intergenic
1174626984 20:51923859-51923881 TGATAGGCATGTTCCTTAACTGG - Intergenic
1177918392 21:27120564-27120586 TGATAAGAATCCTCCTCCATAGG + Intergenic
1179428490 21:41302145-41302167 TGATACAAATACTCCATATCAGG - Intergenic
1179558950 21:42200373-42200395 TGATCAGAATTCTTCTTCACAGG - Intronic
1181945039 22:26509963-26509985 TGATAAGTATACTTCTCACCTGG - Intronic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
951151924 3:19300493-19300515 TGATAAAAATACTCCAAAGCAGG - Intronic
954847916 3:53575904-53575926 TGGGAAGAATATTCCTTGACTGG + Intronic
955988826 3:64603125-64603147 GGAAAAGAATACTACTTTACAGG - Intronic
957173540 3:76772684-76772706 TGATTACAGTACCCCTTAACAGG - Intronic
957432596 3:80131129-80131151 TATTCATAATACTCCTTAACTGG - Intergenic
960647804 3:119908788-119908810 TCATAAGAATACACCTTCACTGG + Intronic
963298437 3:143573249-143573271 TGGTAAGAATCCTTCGTAACTGG - Intronic
964181801 3:153896965-153896987 TGTCAAGAATTCTCCTTAACTGG + Intergenic
964603565 3:158531625-158531647 AGATGAGAAAACTCCTTAAGTGG - Intronic
965033940 3:163409769-163409791 TGAAAAGAATAATACCTAACTGG + Intergenic
966271197 3:178108112-178108134 TGATAAGTATACCCCCAAACAGG + Intergenic
966686130 3:182697920-182697942 TGATGAAAATACTGCTTACCTGG - Intergenic
973147921 4:46851802-46851824 TGATAAGAATACTACAAAAATGG + Intronic
974510376 4:62833002-62833024 GGAAAAGAATTCTCTTTAACAGG - Intergenic
975601006 4:76099309-76099331 TAATAATAATAATCCTTACCTGG + Intronic
977057933 4:92217134-92217156 TGATAAGCCTAATCCTTAACAGG + Intergenic
977786742 4:101043899-101043921 GGATAATAAAACTCCTTATCTGG - Intronic
977973386 4:103236823-103236845 TGCTAAGAATATTCATGAACAGG - Intergenic
977986884 4:103392790-103392812 TGCTAAGAATATTCATGAACAGG + Intergenic
980783515 4:137522282-137522304 TTAAAAGAAAACTTCTTAACAGG - Intronic
994958979 5:106573445-106573467 TTATAAGAGTACTCCTGAGCAGG - Intergenic
995690655 5:114823056-114823078 TGATAAGAAGAGTAATTAACTGG + Intergenic
1005386639 6:25291841-25291863 TGATATGTGTACTGCTTAACTGG - Intronic
1008959528 6:57252206-57252228 TGATAAGCATTGTCCTTAATTGG + Intergenic
1010542638 6:77110755-77110777 TTAGAAGAATACTCCTTAGAAGG - Intergenic
1010711669 6:79182138-79182160 TGATAATAATAGTACTTACCTGG + Intergenic
1016203520 6:141443202-141443224 TGATAAGAAAACAGTTTAACAGG + Intergenic
1016514239 6:144876203-144876225 TGATAAGAATACTTTTTAAAAGG + Intergenic
1016947697 6:149549587-149549609 TCTTAAAAATAATCCTTAACAGG - Intergenic
1017302492 6:152878929-152878951 TGATAAGATTTCTCATTAATTGG - Intergenic
1018019989 6:159752956-159752978 TAATAAGGATTTTCCTTAACAGG - Intronic
1018159054 6:161019764-161019786 TAATTAGAAAACTCCTTAAATGG - Intronic
1020497525 7:8875154-8875176 TGATAAGCATAGTACCTAACAGG - Intergenic
1024282482 7:47730901-47730923 TGTTAAGAATACATCTTAAATGG + Intronic
1031898375 7:127381188-127381210 TGACAAGAATGCTTCTTAAATGG + Intronic
1032467854 7:132157799-132157821 TGAGTGGAATACTCCTTAATGGG - Intronic
1035411314 7:158644827-158644849 TGATAAGAATACTCCTTAACTGG - Intronic
1040701298 8:50069290-50069312 TGATATAAATACTCCTAAACTGG - Intronic
1040733884 8:50482791-50482813 TGATATGTGTACTCCTTACCTGG + Intronic
1041016310 8:53595545-53595567 TGATAACAATACTAGTTACCAGG - Intergenic
1041054009 8:53964219-53964241 TGTTAAGGATACTACTTCACAGG - Intergenic
1043314109 8:78898548-78898570 TGTTAAAATTACTCCCTAACTGG - Intergenic
1045613021 8:103870249-103870271 TGATAATAATAGTACTTCACAGG + Intronic
1046421630 8:113991957-113991979 TGAAAAGAAAACACCTTAGCAGG + Intergenic
1048084317 8:131160546-131160568 TTATATTAATACTCCTTAATTGG + Intergenic
1048822495 8:138392878-138392900 TTCTGAGAATACTCCTTAATCGG + Intronic
1050379171 9:5008028-5008050 TGATAAGAATTCTCATTATTAGG - Intronic
1052071792 9:24090685-24090707 GGATAGGTATACTCCTTAAAGGG - Intergenic
1061730000 9:132606331-132606353 TGATGAGAATATTGCTTTACAGG + Intronic
1188195694 X:27230073-27230095 GGATAAAAATTCTCCTTTACTGG + Intergenic
1189640266 X:43061587-43061609 TGGTAAGCATACTCATTAAAAGG - Intergenic
1193928494 X:87521782-87521804 TGTTCAAAATATTCCTTAACCGG + Intronic
1194967183 X:100301975-100301997 TGTTAAGAAAATTCCTTAAAAGG + Intronic
1195638462 X:107146031-107146053 TGATAAGACTACTACATAAATGG + Intronic
1197568006 X:128112378-128112400 TGATAAGCATAGTCCCCAACAGG - Intergenic
1198302974 X:135349519-135349541 TGATCAAAAGACTCCTTATCAGG - Intronic
1199408141 X:147486402-147486424 TGACAAGAAAACTCCATACCTGG + Intergenic