ID: 1035412040

View in Genome Browser
Species Human (GRCh38)
Location 7:158652269-158652291
Sequence TACTCAGAACTCCCCAGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035412040_1035412044 -4 Left 1035412040 7:158652269-158652291 CCCGTCCTGGGGAGTTCTGAGTA 0: 1
1: 0
2: 3
3: 14
4: 172
Right 1035412044 7:158652288-158652310 AGTACCCGCAGGCCTTCTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035412040 Original CRISPR TACTCAGAACTCCCCAGGAC GGG (reversed) Intronic
900730705 1:4257465-4257487 TACAAAGAACTGCCCAAGACTGG + Intergenic
902690750 1:18108958-18108980 TGCTCACAACTCCCCAGCCCCGG - Intronic
905470473 1:38188060-38188082 GAGTCAGAACTCCCCAAGGCAGG - Intergenic
908088742 1:60664328-60664350 TAATCAAAACCACCCAGGACTGG - Intergenic
909906223 1:81199054-81199076 TACACAGCACACCCCAGTACAGG + Intergenic
911474679 1:98360925-98360947 TACAAAGAACTGCCCAAGACTGG + Intergenic
913363479 1:118008337-118008359 TACTGAGAACTCCACAGGGTTGG + Intronic
915399416 1:155611539-155611561 TACTCAGCACTCCCTGGGAGGGG - Exonic
915416529 1:155747119-155747141 TACTCAGCACTCCCTGGGAGGGG - Intergenic
921674217 1:217960160-217960182 TACTAAGAAATACCCAAGACTGG - Intergenic
921870171 1:220131566-220131588 GACTCAGAACTCCCCACCTCAGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063584319 10:7337692-7337714 TACAAAGAAATACCCAGGACTGG - Intronic
1065000099 10:21330706-21330728 TAGGCAGGACTCCCCAGGAAAGG + Intergenic
1065877176 10:30007643-30007665 TACTAGGAAGTCCCCAGGAAGGG - Intergenic
1067133359 10:43586192-43586214 TGCTCAGAACAACCCATGACAGG - Intergenic
1069687175 10:70325659-70325681 TCCTCAGATCACCCCAGGCCAGG + Intronic
1071551088 10:86566732-86566754 TACTCAGAAATCCCCAGGCCTGG - Intergenic
1071559383 10:86633163-86633185 TACTCAGAGATCCCCAGGCCTGG + Intergenic
1072460312 10:95612395-95612417 TTCTGAGACATCCCCAGGACAGG + Intronic
1073564507 10:104523650-104523672 TTGTCAGAAATCCACAGGACAGG - Intergenic
1073755083 10:106572778-106572800 TACCCAGATCTCTCCAGCACAGG + Intergenic
1076177288 10:128377797-128377819 CCCTCAGAACTCCCCAGGCAAGG + Intergenic
1078256903 11:9665793-9665815 TACTCATAACTCCCCCGAACTGG - Intronic
1080486858 11:32717725-32717747 TACAAAGAACTGCCCAAGACTGG + Intronic
1083309442 11:61776903-61776925 TAGACAGCCCTCCCCAGGACTGG + Intronic
1086492511 11:87369721-87369743 TACTGAGAACTTCTCAGGGCCGG + Intergenic
1091567589 12:1660449-1660471 TACTCAATACTCCCCAGCTCAGG - Intergenic
1096325960 12:50662239-50662261 TACCCAGAGATCCCCAGAACAGG - Intronic
1097029513 12:56080910-56080932 ATCTCAGACCTCCCCAGGGCAGG - Intronic
1100353452 12:93806948-93806970 AACTCAGAACTACCCAGGACTGG + Intronic
1101970840 12:109310650-109310672 AACTCAGGGCTCCCCTGGACTGG + Intergenic
1102994971 12:117342202-117342224 TACATAGCTCTCCCCAGGACAGG + Intronic
1103258159 12:119561169-119561191 AACTCCAAAGTCCCCAGGACTGG - Intergenic
1103553695 12:121753234-121753256 TGCTGAGAACTGCCCAGAACAGG + Intronic
1105308184 13:19183560-19183582 TACTCTGCTCTTCCCAGGACAGG - Intronic
1110471540 13:75865547-75865569 TACTCAAAATTCCCTAGGAGAGG + Intergenic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1112481451 13:99779428-99779450 TACTCAGAACTGGCCAGGCACGG - Intronic
1112857356 13:103787630-103787652 TACGAAGAAATACCCAGGACTGG + Intergenic
1116288358 14:43002068-43002090 AACTCAGAACTCACCAGCAAGGG + Intergenic
1116416893 14:44688993-44689015 TAACCAAAAATCCCCAGGACAGG + Intergenic
1116912699 14:50488039-50488061 TATACAGAACTGCCCAAGACTGG + Intronic
1117031315 14:51673671-51673693 TTTTCAGAACTCCCCAAAACTGG + Intronic
1121957625 14:98228512-98228534 TAGCCAGGACTCCCCAGGGCAGG + Intergenic
1121974501 14:98390369-98390391 GACTCACAACTCCACAAGACTGG - Intergenic
1122040578 14:98984989-98985011 TCCTCAGAACTCCGCATCACAGG + Intergenic
1122157240 14:99756972-99756994 TACACACACATCCCCAGGACCGG + Intronic
1122225823 14:100278706-100278728 ACCTCAGAACACCCCAGGCCAGG + Exonic
1122832084 14:104403333-104403355 TATAAAGAACTCCCCAAGACTGG - Intergenic
1122882928 14:104698091-104698113 TCCTCAGAGCTCCCCAGCCCCGG - Intronic
1123829622 15:24121114-24121136 TATTCAGAACTTTCCAGGACAGG + Intergenic
1123859621 15:24450778-24450800 TATTCAGAACTTTCCAGGACAGG + Intergenic
1125327316 15:38549138-38549160 TGGACTGAACTCCCCAGGACTGG + Intronic
1125888008 15:43243313-43243335 AACTCAGAAATCACCAGAACAGG - Intronic
1126699415 15:51354666-51354688 TACTCCAAACTCTCCAGTACAGG - Intronic
1126750708 15:51874074-51874096 TACACATAACTGGCCAGGACAGG + Intronic
1128337821 15:66798753-66798775 TGCACAGAACTCCCCTGGAAAGG + Intergenic
1129752500 15:78076156-78076178 CCCCCAGAACTCCCAAGGACAGG + Intronic
1130163590 15:81427580-81427602 TACAAAGAACTGCCCAAGACTGG - Intergenic
1130547164 15:84865173-84865195 TACCCAGAACTCCCCAACAAAGG + Intronic
1134038127 16:11047742-11047764 TACGCAGAAATACCCAAGACTGG + Intronic
1137353572 16:47735824-47735846 GACTCAGAAATCTCCAGGAGTGG - Intergenic
1137902596 16:52285149-52285171 ATCTCAGAACTCCCCAGAAGAGG + Intergenic
1138696325 16:58816865-58816887 TACTCATAACTAACCAGGAAAGG + Intergenic
1140200436 16:72890422-72890444 TACTAAGAACTGCCTAGGACTGG - Intronic
1140740345 16:77936118-77936140 TTCTTATAACTTCCCAGGACTGG + Intronic
1140913281 16:79472880-79472902 TACCCAAATCTCTCCAGGACAGG - Intergenic
1140914328 16:79481172-79481194 TACCCAAATCTCTCCAGGACGGG + Intergenic
1146426530 17:32744914-32744936 TACTCAGCAGTCCTCAGGCCAGG - Intronic
1146693740 17:34893552-34893574 TACTCTGGACTGACCAGGACTGG - Intergenic
1148857517 17:50586828-50586850 TGCTCAGTACTTCCCAGCACCGG - Intronic
1149578223 17:57728804-57728826 GACACAGAACTCCCAAGGAAGGG + Intergenic
1151905460 17:77045580-77045602 TATTTAGAACTCTCCAGGAAAGG - Intergenic
1152516142 17:80826017-80826039 TCCTCAGAGCTCCCCAGGGCCGG - Intronic
1152747995 17:82050022-82050044 TGGTCAGAGCTGCCCAGGACAGG + Intronic
1152995984 18:406744-406766 TCCTCAGTGCTCTCCAGGACTGG + Intronic
1153098478 18:1436783-1436805 ATCTCAGAAGTCCCCAGGGCTGG - Intergenic
1153998300 18:10461442-10461464 TATTCAGAATTCCTCTGGACTGG + Intronic
1162039581 19:7962021-7962043 CACCCAAAACTCCTCAGGACTGG - Exonic
1162248778 19:9425322-9425344 TACTCACAGATCCCCAGGATGGG - Intronic
1162492375 19:11000934-11000956 TTCTCAACACTCCACAGGACAGG - Intronic
1163456908 19:17412148-17412170 CACTCAGTTCTCCCCAGGGCAGG - Intronic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1166431222 19:42729622-42729644 TACCCAGATCTTCCCAGGGCAGG + Intronic
1167507592 19:49878991-49879013 GTCTCAGAATTGCCCAGGACGGG - Intronic
925716544 2:6789121-6789143 TACAGAGAACTGCCCAAGACTGG - Intergenic
928136124 2:28688820-28688842 TATAAAGAACTGCCCAGGACTGG + Intergenic
928415763 2:31090300-31090322 CACTCAGAGCTCCCTGGGACTGG + Intronic
929259165 2:39845351-39845373 TACAAAGAACTGCCCAAGACTGG - Intergenic
932205539 2:69878123-69878145 TGCTCAGAACTCCCAGAGACAGG - Intronic
936609824 2:113991422-113991444 TCCTCAGATCTTCCCAAGACTGG - Intergenic
938144019 2:128819365-128819387 ATCTCAGAACTCCCTAGGCCAGG + Intergenic
944075270 2:195722601-195722623 TCCTCAGAACTCCCAAGCACAGG + Intronic
946057676 2:216916165-216916187 AATTCGGAACTCACCAGGACGGG + Intergenic
1173913131 20:46685121-46685143 TAGTCACAACTACCCAGGAAGGG + Exonic
1175408017 20:58747545-58747567 TACTGCCCACTCCCCAGGACCGG - Intergenic
1178668840 21:34572690-34572712 TACAAAGAACTACCCAAGACTGG + Intronic
1179005846 21:37513318-37513340 CACTCAGACCTCCCCAGGACTGG - Intronic
1181741984 22:24928519-24928541 TGCCCAGCACTCCCCAGGTCTGG - Intergenic
1181780002 22:25185576-25185598 TACACAGAACAGCCCAGGATCGG - Intronic
1183176943 22:36231274-36231296 CACTCAGATCTCCCCTGGGCTGG - Intronic
1184569048 22:45310482-45310504 TCCTCAGAAGCCCCCAGGCCCGG + Intronic
1184847858 22:47100149-47100171 TACTAAGAACAAGCCAGGACCGG - Intronic
950538159 3:13593789-13593811 TATTCAGAAGTCCCCAGCACGGG + Intronic
951203780 3:19903957-19903979 TACTAAGAACTCCACAGGATAGG - Intronic
951641545 3:24842126-24842148 GACTGAGAACTGCCCAAGACAGG + Intergenic
955869975 3:63427528-63427550 TGCTCAGAAATCCATAGGACAGG + Intronic
959992040 3:112640700-112640722 GATTCAGAAATCGCCAGGACTGG - Exonic
961582577 3:127894713-127894735 TCCTCAGAAGTCCACAGGAGAGG - Intergenic
962606461 3:137036384-137036406 GACTCTGAACTCCCCAGGGAGGG + Intergenic
965396539 3:168166071-168166093 AACTCAGACCTACCCAGGTCAGG - Intergenic
966276060 3:178171290-178171312 TACTCAGAATTCCCAGGGGCAGG + Intergenic
967509272 3:190291275-190291297 TATAAAGAACTCCCCAAGACTGG + Intergenic
967834840 3:193952297-193952319 TATTCAGAACTTCCCAGCTCAGG + Intergenic
967886474 3:194336912-194336934 TCCTCTGAACTCCCCGGCACTGG - Intergenic
968131065 3:196193101-196193123 TACACAAAACTCCCCAACACTGG - Intergenic
969509137 4:7607643-7607665 TTCTCAGGACTACCCATGACTGG - Intronic
969641989 4:8404375-8404397 AACCCAGAACTCTGCAGGACAGG + Intronic
970070551 4:12154960-12154982 TATGAAGAACTGCCCAGGACTGG - Intergenic
971003674 4:22350997-22351019 TACTCACCACTTCCCTGGACTGG - Intronic
971454124 4:26828042-26828064 CAGTCAGAACTCCCCAGCTCTGG + Intergenic
971840861 4:31850372-31850394 TACAAAGAACTGCCCAAGACTGG - Intergenic
976387719 4:84480485-84480507 AACTCAGAACCAGCCAGGACTGG - Intergenic
976936425 4:90640893-90640915 TATAAAGAACTGCCCAGGACTGG - Intronic
978262670 4:106780215-106780237 TACTCAGAATTCCACATGTCTGG + Intergenic
978879320 4:113681514-113681536 TATTAAGAACTGCCCAAGACTGG - Intronic
978917524 4:114144987-114145009 TATTGAGAACTGCCCAAGACTGG - Intergenic
981548843 4:145921753-145921775 TACTCCTAATTCCCCAAGACTGG + Intronic
983529087 4:168791343-168791365 TATAAAGAACTGCCCAGGACTGG + Intronic
984117879 4:175704963-175704985 TAATCAGAAGTCCCCAGAAGTGG - Intronic
984399257 4:179240745-179240767 TACGAAGAAATACCCAGGACTGG - Intergenic
986630322 5:9766498-9766520 TACTCAGAACTGCCCCAGGCAGG - Intergenic
987478597 5:18424433-18424455 TATGCAGAACTACCCAAGACAGG + Intergenic
988142879 5:27265672-27265694 GACTCAGAGTTCCACAGGACTGG - Intergenic
988823245 5:34908995-34909017 TGCTCAGAACTCCCAAGTAAAGG + Intronic
992142006 5:73807889-73807911 TACTCAAAACACCTCAGGGCAGG - Intronic
992240028 5:74758600-74758622 TACTCAGAATGCTACAGGACAGG - Intronic
992826102 5:80551550-80551572 GACTCAGATCTTCCTAGGACAGG + Intergenic
993769715 5:91911021-91911043 TACAAAGAACTGCCCAAGACTGG - Intergenic
999936743 5:156494857-156494879 TACTCAGACCTTCCCAGGCCTGG + Intronic
1004424951 6:15501018-15501040 TCCCCAGAACTGCCCAGGACCGG + Exonic
1014941844 6:127450024-127450046 TCCTCAGAAGTCCTCAGGTCAGG + Exonic
1015281692 6:131441585-131441607 AACTGAGACCTCCTCAGGACAGG + Intergenic
1016175757 6:141075855-141075877 TACTCAGATCTCCACTGGAAAGG + Intergenic
1016521289 6:144950026-144950048 TGCCTAGAAATCCCCAGGACAGG + Intergenic
1018426497 6:163687734-163687756 TACACTGAAATCCACAGGACAGG - Intergenic
1018933033 6:168254676-168254698 TAGTGAGACCTGCCCAGGACAGG + Intergenic
1018974109 6:168551282-168551304 TATAAAGAACTCCCCAAGACTGG - Intronic
1019171615 6:170136281-170136303 CACTCAGACGTCCCCAGGCCCGG - Intergenic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1021096224 7:16538937-16538959 TATAAAGAACTCCCCAAGACTGG - Intronic
1022794134 7:33718672-33718694 TACTCACTTCTCCCCAGGACAGG + Intergenic
1024054601 7:45651863-45651885 CACTCAGAATTCCCCAAGCCTGG - Intronic
1024488195 7:49944495-49944517 AATTCAGAACTTCCCAGGCCTGG + Intronic
1026564213 7:71476437-71476459 TACTCACAAATCCCCTGAACAGG + Intronic
1026650288 7:72210456-72210478 TACAAAGAACTGCCCAAGACTGG + Intronic
1027771933 7:82418010-82418032 TATAAAGAACTGCCCAGGACTGG + Intronic
1028844683 7:95466445-95466467 GACTTAGGACTCCTCAGGACTGG - Intergenic
1029171298 7:98630916-98630938 TACTCAGATCTCCCCCTGAAAGG + Intergenic
1031752125 7:125589162-125589184 GACTCACATTTCCCCAGGACTGG + Intergenic
1032101636 7:128983863-128983885 TTCTCAGAACTCCTCGAGACTGG + Intronic
1032675032 7:134121954-134121976 TTCTCTTAACTCCCCTGGACTGG + Intergenic
1032683099 7:134205369-134205391 TCATCAGCACTCCCCAGGAAGGG + Intronic
1034119737 7:148616638-148616660 TACAAAGAAATCCCCAAGACTGG + Intergenic
1035412040 7:158652269-158652291 TACTCAGAACTCCCCAGGACGGG - Intronic
1037522293 8:19691903-19691925 TACAAAGAACTGCCCAAGACTGG + Intronic
1037946893 8:22995329-22995351 TACTGAGAACTCCCTGGGACCGG - Intronic
1039644830 8:39269821-39269843 TATACAGAACTGCCCAAGACTGG + Intronic
1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG + Intergenic
1043313766 8:78894888-78894910 TTCTCACAATGCCCCAGGACAGG + Intergenic
1046831355 8:118750373-118750395 TATAAAGAACTGCCCAGGACTGG - Intergenic
1047504498 8:125468477-125468499 TACTCAAAACAGCCCAGAACTGG - Intergenic
1048163779 8:132044185-132044207 GACTCACAACTCTCCAGGAAGGG - Intronic
1049620128 8:143594413-143594435 TACCCAGAACACTCCAGGTCAGG + Intronic
1051689944 9:19700752-19700774 AACTCAGAACTTCTCAGGCCTGG + Intronic
1052968818 9:34363868-34363890 GACTGAGAGCTCCCCAGAACGGG + Intergenic
1057865624 9:98678172-98678194 AAATCAGTACTCCCCAGTACTGG - Intronic
1057911094 9:99021241-99021263 CACTCAGGAGGCCCCAGGACGGG - Intronic
1059104007 9:111496044-111496066 TACTCTCAACTCCCCCTGACAGG - Intergenic
1060113070 9:120920300-120920322 CACTCAGAGCTCCCCAGGGTAGG + Intronic
1061412677 9:130429831-130429853 TTCTCAGAACTCAACAGCACTGG - Intronic
1185599265 X:1327786-1327808 TGCTCAGAGCCCCCCAGGGCAGG - Intergenic
1185775872 X:2802542-2802564 CACTCAGCACTCCCCACGCCCGG - Intronic
1188761778 X:34041356-34041378 GACTCACAGCTCCACAGGACTGG - Intergenic
1189717001 X:43877320-43877342 TCCTCAGAAGTCACCAGGGCAGG - Intronic
1190431520 X:50382263-50382285 TACACAGAAATCCACAGGTCTGG + Intronic
1194129322 X:90060586-90060608 TATAAAGAACTCCCCAAGACTGG - Intergenic
1198569548 X:137940406-137940428 AAATCAGAACTCTCCAGAACTGG + Intergenic
1201485123 Y:14485892-14485914 TGCTCAGAAATCCACAGGATTGG - Intergenic