ID: 1035412315

View in Genome Browser
Species Human (GRCh38)
Location 7:158654751-158654773
Sequence TAGGAGAAGCTTTGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035412315 Original CRISPR TAGGAGAAGCTTTGTGAGGC TGG (reversed) Intronic
900801309 1:4738726-4738748 TAGGAGAGGCTGTGGGAAGCGGG + Intronic
900931387 1:5739966-5739988 TAGGAGCAGCTTTGAGGGGCAGG + Intergenic
901160626 1:7174159-7174181 AAGGAGCAGCTCTGTCAGGCCGG + Intronic
905489356 1:38331605-38331627 TAGGAGAAGCTATAAGAAGCAGG + Intergenic
905768004 1:40619210-40619232 TAGGAAAGTCATTGTGAGGCAGG + Intergenic
906063653 1:42964393-42964415 TAGGAGACCCAGTGTGAGGCAGG - Intergenic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907354056 1:53857683-53857705 TAGGAAATGTTTTGTCAGGCCGG + Intronic
909602555 1:77475822-77475844 TAAGAAGAGCTTTGTCAGGCTGG - Intronic
911757064 1:101570962-101570984 TCAGAGAAGCTCTGTGATGCTGG - Intergenic
912230056 1:107783123-107783145 TAAGAGCTACTTTGTGAGGCAGG + Intronic
914221846 1:145688624-145688646 TAGTAGAAGCTTGGTGAGGTAGG + Intronic
914513426 1:148353883-148353905 TAGGGGACGCATTGCGAGGCCGG - Intergenic
914764219 1:150623853-150623875 TAGGAGAAAGTTGGTGAGGAAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
918309102 1:183272844-183272866 TTGGAGAAGATATGAGAGGCTGG + Intronic
919857837 1:201717762-201717784 TAGGAAAAGCTTTGGGAATCTGG - Intronic
920437533 1:205957197-205957219 TAGGAGCAGCTCTGGGAGACAGG - Intergenic
921617820 1:217292249-217292271 TAGGAGAAACAGTGTGAGTCGGG - Intergenic
922169300 1:223141971-223141993 TGGGAGAAGTTCTGTGGGGCTGG - Intronic
922536495 1:226384961-226384983 TAGCAGTATCTTTGTGGGGCTGG - Intronic
923447264 1:234083770-234083792 TGGGAAAAGCATTGTGAGGCAGG + Intronic
924256189 1:242185205-242185227 TTGGAGTAGCTATGTGGGGCTGG - Intronic
1062898556 10:1124057-1124079 GTGGAGAGGCTTTGGGAGGCGGG + Intronic
1063009767 10:2011096-2011118 TAAGATAAGCTTTGTAAGACTGG + Intergenic
1063355888 10:5397988-5398010 CATGAGAAGGTGTGTGAGGCTGG + Intronic
1068534692 10:58229226-58229248 TAGGAAAAGCTTTGTCAAGAGGG + Intronic
1069695174 10:70381098-70381120 TAAGAGAAGTTTTTTGAGGAAGG + Intronic
1069704104 10:70446777-70446799 AAGCATAAGCTTTGTGAGGGTGG + Intronic
1069865228 10:71498266-71498288 CAGGAGAAGCTTTGGGAGCAAGG - Intronic
1069945304 10:71981409-71981431 TGGGAGCAGCTTTGCGAGGGAGG + Intronic
1071757175 10:88556097-88556119 GAGAAGTAGGTTTGTGAGGCAGG - Intronic
1074204226 10:111268199-111268221 TTGGAGATACTTTGTGAGGAGGG + Intergenic
1078082100 11:8211544-8211566 TAGGAGAGGCTCTGAGAAGCAGG - Intergenic
1078129866 11:8604625-8604647 TAGGAAAAGCTCTCTGAGGAGGG + Intergenic
1078544848 11:12240014-12240036 TTGAAGGAGCTTTGAGAGGCTGG + Intronic
1081251157 11:40836181-40836203 TAAGAGAAGATTGGTGAGGTTGG - Intronic
1081694435 11:45099976-45099998 TGGGAGAAGAATTGAGAGGCAGG + Intronic
1081852814 11:46285463-46285485 CAGGAGAAGCTGGGAGAGGCAGG + Intronic
1082206147 11:49436469-49436491 AAGGATAAGCTTTGTCAGACGGG - Intergenic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1085440611 11:76559259-76559281 GAGGAGAAAGTTTGTGATGCAGG + Intergenic
1085500913 11:77022818-77022840 TAGAAAATACTTTGTGAGGCCGG + Exonic
1086572555 11:88302289-88302311 TAAGAGAAGCTGTGAGAGACGGG - Intronic
1086649119 11:89265302-89265324 AAGGATAAGCTTTGTCAGACGGG + Intronic
1089134379 11:116237614-116237636 TAGGAGAACCTCCGGGAGGCTGG - Intergenic
1089291300 11:117439246-117439268 AAGGTGAGGCTCTGTGAGGCAGG - Exonic
1089332158 11:117697223-117697245 AAGAAGGAGCTATGTGAGGCAGG - Intronic
1089510474 11:118993665-118993687 TAATAGAAAATTTGTGAGGCAGG + Intergenic
1091901063 12:4144459-4144481 GAGGAGAACAATTGTGAGGCGGG - Intergenic
1092755967 12:11763668-11763690 TCACAGAAGCTTTGTGAAGCAGG - Intronic
1092965215 12:13634737-13634759 TTGGGGAAGGTGTGTGAGGCTGG + Intronic
1093689956 12:22099750-22099772 TAGAAGAAGCTTAGTTTGGCTGG + Intronic
1099311851 12:81035806-81035828 TAAGAAAAGCTTTATGAGGTAGG + Intronic
1100445553 12:94656603-94656625 TAGGATAAGGCTTCTGAGGCTGG - Intergenic
1100977434 12:100137105-100137127 TAGGAAAAGCTATCTGAGGCTGG - Intronic
1101837188 12:108303841-108303863 CAGGAGAAGCCTTTGGAGGCGGG + Intronic
1106086171 13:26543781-26543803 GAGGTCAAGCTTAGTGAGGCTGG - Intergenic
1108128784 13:47274365-47274387 CAGGAGAAGCTTTGGGGGGTTGG + Intergenic
1108418104 13:50221538-50221560 TTGGGGAAGGTTTCTGAGGCAGG + Intronic
1110278016 13:73661291-73661313 CAGGAGAGGCGTTGTGGGGCAGG - Intergenic
1110564964 13:76948892-76948914 TAAGATAAGCTTTTTGAGGCAGG + Intronic
1110952254 13:81510628-81510650 TACGAAAAGCTTTGTATGGCAGG - Intergenic
1111027661 13:82553063-82553085 TAGGAGAAGAATTCTAAGGCGGG + Intergenic
1112684192 13:101803973-101803995 TAGGAATAGGTGTGTGAGGCTGG + Intronic
1113876400 13:113597463-113597485 TGGAGGAAGCTGTGTGAGGCAGG + Intronic
1116248817 14:42455600-42455622 TGGGAGAACCCTGGTGAGGCTGG + Intergenic
1117975015 14:61288624-61288646 TAGGAAAAGTTCTGTGAGGATGG + Intronic
1118528253 14:66670265-66670287 TAGGAGTATCTTTGTGGGGTTGG + Intronic
1121436283 14:93922391-93922413 TAAGAGAAGCTTTTTTAGGCTGG + Intronic
1121519661 14:94577336-94577358 TAGGAAAAGCTTTGTGAAGGTGG - Intronic
1122031107 14:98913223-98913245 TAGGACCAGCTATGTGAGCCTGG + Intergenic
1125130423 15:36278501-36278523 TGGGAGGGGCTTTATGAGGCAGG + Intergenic
1126142734 15:45451013-45451035 TAGCACAGGCTCTGTGAGGCTGG + Intergenic
1127051642 15:55089938-55089960 TGGCCGAAGCTTTGTCAGGCTGG + Intergenic
1128676857 15:69615978-69616000 TAGGAGGAGCTGGGTGAGGCGGG + Intergenic
1130934018 15:88453755-88453777 TGGAAGAAGCTCTGTGGGGCTGG - Intergenic
1131835217 15:96383636-96383658 TAGGAGGAGCTTGGTGAGATGGG + Intergenic
1132657975 16:1049209-1049231 GAGCAGAGGCTCTGTGAGGCCGG - Intergenic
1138105124 16:54283990-54284012 TAGGGGAAGCCTTGCGTGGCTGG - Intronic
1139310635 16:66025188-66025210 TAGGAGTATCTTTGTTACGCAGG - Intergenic
1139587545 16:67913854-67913876 TAGGAGCAGGTTTTTTAGGCAGG + Intronic
1147995554 17:44358394-44358416 CAAGAGCAGCTTGGTGAGGCCGG + Intronic
1149980960 17:61310838-61310860 TAGGGGAGGCTCTGGGAGGCAGG + Intronic
1150447511 17:65238625-65238647 TTGGGGATGCTTTATGAGGCTGG + Intergenic
1151357697 17:73570240-73570262 TAGGAGATGCATGTTGAGGCCGG - Intronic
1151399288 17:73845159-73845181 ATGGAGAAGCTGTGTGATGCTGG - Intergenic
1152002161 17:77653759-77653781 TGGGAGAAGAGTTGGGAGGCGGG - Intergenic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1153329739 18:3861820-3861842 TTGGAAAAGCTTATTGAGGCAGG - Intronic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1162306905 19:9880370-9880392 GAGCAGAAGCTTTATGAGGTTGG - Intronic
1164650010 19:29884744-29884766 CAGGAGTAGCTGTGTCAGGCAGG + Intergenic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166636816 19:44458137-44458159 GAGAAGAAGCTGGGTGAGGCAGG + Intergenic
1167000339 19:46742030-46742052 GAGGGGAAGCTTTTTGAGGATGG - Intronic
1168290262 19:55354124-55354146 TAGGAGGAGCAGTGTGAGGGAGG - Exonic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
926704309 2:15826003-15826025 TAGGAGGAACTGTGTGGGGCAGG + Intergenic
927158593 2:20236669-20236691 TAGGAGAAACCGTGTGTGGCAGG - Intergenic
927704314 2:25287543-25287565 TGTGAGCAGCTTTTTGAGGCAGG + Intronic
928013192 2:27629660-27629682 TAGGGGAAGCTTTGTTAGATGGG + Intronic
929455510 2:42062032-42062054 TAGGAGAGGCTTTCTGGAGCTGG - Intergenic
932658089 2:73627496-73627518 TAGAAGTAGCTCTGTGTGGCTGG + Intergenic
932664716 2:73687533-73687555 TAGAAGTAGCTCTGTGTGGCTGG + Intergenic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
934651138 2:96091942-96091964 CAGGGGAAGCTTGGTGAGGCAGG + Intergenic
935277612 2:101488755-101488777 TAGGAGAAACTGTGTGTGGGAGG - Intergenic
936226267 2:110656215-110656237 TAGAGGAAGCTTGGTGAGGAGGG - Intronic
936706398 2:115079924-115079946 AAGGAGAGGCTTTGTGATGATGG + Intronic
937119572 2:119432121-119432143 CGGGAGCAGCTATGTGAGGCAGG - Intronic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
939327614 2:140713845-140713867 TAGTAGAAGCTTTGTGGAGGAGG - Intronic
941090951 2:161175022-161175044 TAGGAAAGGCTTTGAGAGGTAGG - Intronic
946046572 2:216826342-216826364 AAGGAGAGCCCTTGTGAGGCAGG - Intergenic
946472584 2:219975925-219975947 TAGGAGAGGCTGTGTCAGGTGGG + Intergenic
947790932 2:232868761-232868783 TAGGAGCAGCTCTGTTTGGCTGG - Intronic
947840040 2:233201987-233202009 GAGGGGAAGCTTGGTGGGGCGGG - Intronic
948711761 2:239829534-239829556 CTGGAGCAGCTTTGCGAGGCAGG + Intergenic
948759526 2:240182172-240182194 TAGGAGATGCTAGGAGAGGCTGG - Intergenic
1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG + Intronic
1173035195 20:39402221-39402243 TAGGAAGAGCTTTGTGTTGCAGG + Intergenic
1173574872 20:44106238-44106260 TAGGAGTAGCCTTGTGATCCAGG - Intergenic
1174085645 20:48005668-48005690 TAGGAGAGGCTTTGGGGAGCAGG + Intergenic
1174191222 20:48742116-48742138 TCACAGCAGCTTTGTGAGGCTGG + Intronic
1174918428 20:54677279-54677301 TGGGAGAAGTTTTGAGGGGCTGG + Intergenic
1175881514 20:62262139-62262161 TAGGAGCAGGAGTGTGAGGCCGG - Intronic
1176168974 20:63688653-63688675 TTGGGGAAGCTGTGAGAGGCAGG - Intronic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176964755 21:15199618-15199640 TAGGATCAGCTATGTGAGGCAGG + Intergenic
1178566955 21:33695390-33695412 TAGGAAAAGCTTTGTTAGAGAGG + Intronic
1179462468 21:41547022-41547044 GAGGCCCAGCTTTGTGAGGCAGG + Intergenic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180924772 22:19545828-19545850 TGAGAGCAGCTTTGTGAGGCAGG + Intergenic
1182488440 22:30653761-30653783 GAGGAGAACCCTTGTTAGGCTGG + Intronic
1183031971 22:35113326-35113348 AGGGAGGAGCTTTGTGAGGAAGG - Intergenic
1184100414 22:42339052-42339074 TCAGAAAAGCTCTGTGAGGCAGG + Intronic
1184365130 22:44046352-44046374 TAGGAGATGCGTCCTGAGGCTGG + Intronic
950323683 3:12083519-12083541 AAGGAGAAACTTTGGGAGGAAGG - Intronic
950487333 3:13281491-13281513 GAGGAGGAGCATTGTGAGGATGG - Intergenic
953877815 3:46676468-46676490 TGGGAGAAGTGTTGGGAGGCTGG - Intronic
960390721 3:117074506-117074528 TATAAGAAGCTTTGTATGGCTGG + Intronic
962478393 3:135777925-135777947 TAGGAAAGCCTTGGTGAGGCTGG + Intergenic
964316750 3:155452930-155452952 TAGTAGATACCTTGTGAGGCTGG - Intronic
965506492 3:169521085-169521107 TCGGAGAAGATAGGTGAGGCTGG + Intronic
965720375 3:171654970-171654992 TAGGGGAATTGTTGTGAGGCTGG + Intronic
967346936 3:188467769-188467791 GAGGAGTAGCTTTGAGAAGCTGG + Intronic
969122556 4:4920697-4920719 TAAGAAAAGCTTGGTGAGGGAGG - Intergenic
972860712 4:43166530-43166552 TAGGAGAAACTTTGCAAGACTGG + Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
974123607 4:57668447-57668469 CAGGAGAAGCTTTGGTAGTCAGG - Intergenic
975414246 4:74089288-74089310 TAGAAGTAGCTTTGTGCGCCAGG + Intergenic
975585256 4:75941928-75941950 TAGGAAAATCTTAGTAAGGCTGG + Intronic
982065585 4:151651632-151651654 CAGGAGAAGCCTGGTGAGGAGGG + Intronic
984482205 4:180319734-180319756 GAGGGGAAGCTTAGTGATGCAGG + Intergenic
984691997 4:182736988-182737010 TAGGCCAAGTTTGGTGAGGCAGG - Exonic
990098679 5:52155020-52155042 TAGGCAAAGCTTTGTGATGCGGG + Intergenic
992282612 5:75197196-75197218 TATTAGAAACATTGTGAGGCTGG - Intronic
997768142 5:136525818-136525840 CAGGAGAAGCTTTGAGATGAAGG - Intergenic
997996948 5:138594521-138594543 TAGCAGCTGCTTTGTGATGCTGG - Intergenic
999628085 5:153541195-153541217 TAGGACAAGCTCTGTGAAGGAGG - Intronic
1001573415 5:172745778-172745800 TAGCAGAAGCTCTGTGAGGTGGG - Intergenic
1001779043 5:174351703-174351725 AAGGAGAAGCTTTTTGAGCTAGG - Intergenic
1003317615 6:5026385-5026407 CAGGAGAGGCTCTGGGAGGCGGG - Intergenic
1004207346 6:13604404-13604426 CAGGATAAACTTTGTGAAGCAGG + Intronic
1005102792 6:22191389-22191411 GAGGACAAGCTGAGTGAGGCAGG + Intergenic
1006517006 6:34550736-34550758 TGGGTGAGGCTTTGTGGGGCGGG + Intronic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1010398249 6:75417740-75417762 TAGGAGTAGCTGTGTGATACAGG - Intronic
1012085026 6:94813864-94813886 TAGGTGAAACTTTAAGAGGCAGG - Intergenic
1012588950 6:100955504-100955526 TAGGGCAAGATTTTTGAGGCAGG - Intergenic
1013201537 6:107901551-107901573 TATGAAAAGCTTTGTGAGTTAGG - Intronic
1016272804 6:142308669-142308691 GAGCAGAAGAGTTGTGAGGCAGG - Intronic
1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG + Intronic
1020916230 7:14197105-14197127 AAGGAGTTGCTTTGTGGGGCGGG + Intronic
1020950350 7:14668197-14668219 TAGAATAAAATTTGTGAGGCTGG + Intronic
1022978028 7:35576307-35576329 GAAGAGAAGCTTGGAGAGGCTGG + Intergenic
1024802194 7:53092962-53092984 AAAGAGAATGTTTGTGAGGCCGG - Intergenic
1026828331 7:73597186-73597208 TGTGAGCAGCTGTGTGAGGCAGG + Exonic
1028709500 7:93890925-93890947 CAGGAGAAAGTTTGGGAGGCAGG - Exonic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1036095627 8:5721930-5721952 TTTGAGAAGCTTTGTGACCCAGG - Intergenic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1040872358 8:52113694-52113716 AAGGTGAATATTTGTGAGGCTGG + Intronic
1041244198 8:55875390-55875412 TACAAGGAGCTTTGTGAGACTGG + Intergenic
1042187931 8:66155458-66155480 TAGTAGAAGCTGTGTGCGGAGGG + Intronic
1042876482 8:73444937-73444959 TAGGAGAAGCCTTCAGAGGAAGG + Intronic
1044197105 8:89390610-89390632 TAGGATTAGCTTGGTGATGCGGG - Intergenic
1044207755 8:89511067-89511089 TAGGATTAGCTTGGTGATGCGGG + Intergenic
1045038080 8:98193042-98193064 TAGGATAAGCTATGTGAATCTGG + Exonic
1048534749 8:135282900-135282922 TAGGAGAAACTTTTTTAGACAGG + Intergenic
1050317552 9:4418852-4418874 TAGGAGGAGCAATGTGAGCCAGG + Intergenic
1050687946 9:8192460-8192482 CAGCAGAAACCTTGTGAGGCAGG + Intergenic
1052032282 9:23642423-23642445 TAGGAGATGCTTCTTGAGCCTGG + Intergenic
1052552233 9:29966954-29966976 AAGGAGAAGCTCTGTGGAGCTGG + Intergenic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1056977694 9:91274798-91274820 TAGGTGAAGCTTGGTTAGCCAGG - Intronic
1057533493 9:95875783-95875805 CAGGGGACGCTGTGTGAGGCTGG - Exonic
1060382309 9:123187778-123187800 TAGGAGAAACTATGTGTGGTGGG - Intronic
1062419089 9:136470622-136470644 TTGGAGGTGCTTTGTGAAGCAGG - Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1186671666 X:11773343-11773365 TAGGATGAGCTGGGTGAGGCAGG - Intronic
1189279679 X:39812363-39812385 TCAGAGATGCTTGGTGAGGCCGG - Intergenic
1190937780 X:55012288-55012310 TTGGAGAGGCTTTGTGAGTAAGG - Intronic
1191863665 X:65686489-65686511 TTTCAGGAGCTTTGTGAGGCAGG + Intronic
1191947209 X:66547872-66547894 GAGCAGAAGCTCTGTGAGGAGGG + Intergenic
1193502244 X:82293221-82293243 TAGCAAAAGCTTTGTGAGAGTGG + Intergenic
1194193026 X:90860249-90860271 TAGGTGAAGCTTTGTGGGGCTGG + Intergenic
1195568238 X:106370163-106370185 GAGTAAAAGCTTTCTGAGGCCGG - Intergenic
1196371861 X:114987916-114987938 TAAGGGAAGATTTGTTAGGCAGG + Intergenic
1196408604 X:115393046-115393068 TAAGAGAAGTTTCCTGAGGCTGG - Intergenic
1196906659 X:120443733-120443755 AAAGAGAAACATTGTGAGGCAGG + Intronic
1198874284 X:141206108-141206130 TAGGAGAAACTGTGTGTGGGAGG + Intergenic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1200539646 Y:4442699-4442721 TAGGTGAAGCTTTGTGGGGCTGG + Intergenic