ID: 1035413814

View in Genome Browser
Species Human (GRCh38)
Location 7:158667454-158667476
Sequence TAGTGGGTAAGGCGGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 3, 1: 9, 2: 3, 3: 6, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035413814_1035413828 11 Left 1035413814 7:158667454-158667476 CCCTCCGCCCGCCTTACCCACTA 0: 3
1: 9
2: 3
3: 6
4: 126
Right 1035413828 7:158667488-158667510 CGCCCGCCTTACCCACTACTGGG 0: 3
1: 9
2: 3
3: 4
4: 61
1035413814_1035413827 10 Left 1035413814 7:158667454-158667476 CCCTCCGCCCGCCTTACCCACTA 0: 3
1: 9
2: 3
3: 6
4: 126
Right 1035413827 7:158667487-158667509 CCGCCCGCCTTACCCACTACTGG 0: 3
1: 9
2: 3
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035413814 Original CRISPR TAGTGGGTAAGGCGGGCGGA GGG (reversed) Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
906503213 1:46357420-46357442 GAGAGGCCAAGGCGGGCGGATGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915262211 1:154685136-154685158 TAGCGGGTTAGGTGGGCAGAAGG + Intergenic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917435469 1:175016948-175016970 TAGGGGGTATGGCGGGCAGGGGG - Intronic
921339642 1:214121980-214122002 TAGTGGGGAAAGCTGGCTGAAGG + Intergenic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1071328255 10:84537554-84537576 TAGTGGGGAGGGCCGGCGGGAGG + Intergenic
1077036407 11:497004-497026 TACTGGGAAAGGCGGGCTGGCGG - Intronic
1081591127 11:44423916-44423938 TGGTGAGTGAGGCGGGGGGAGGG - Intergenic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1096340694 12:50796287-50796309 TAGAGGCTAAGGCGGGAAGATGG + Intronic
1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG + Intronic
1098284569 12:68894445-68894467 TAGTGGGAAATTCGGGTGGAGGG - Intronic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1104200207 12:126581481-126581503 TACTGGGCATGGCAGGCGGAAGG + Intergenic
1105865869 13:24458712-24458734 TAGTGAGTTAGGTGGGTGGAGGG + Intronic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1108518056 13:51221552-51221574 AAGTTGGCAGGGCGGGCGGAAGG - Intergenic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1122861898 14:104586536-104586558 GAGAGGGTAAGGCGGGCCGCTGG + Exonic
1124883307 15:33661541-33661563 TGGTGGGTGAGGCTGGGGGAGGG + Intronic
1124954510 15:34351306-34351328 TAGAGGCTAAGGTGGGAGGATGG + Intronic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1127857895 15:62967558-62967580 AATTGGGTAAGGTGGGAGGAAGG - Intergenic
1127926184 15:63545728-63545750 GGGAGGCTAAGGCGGGCGGATGG + Intronic
1128156908 15:65396817-65396839 TGCTGGGTGAGGCGGGCCGAAGG - Exonic
1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG + Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1143539810 17:7562238-7562260 GAGCGGGGAAGCCGGGCGGACGG - Exonic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1147360009 17:39924528-39924550 TAGGGGGTGAGGCTGGGGGATGG - Intronic
1148354797 17:46968685-46968707 TGGTGGGGAAGGCAGGCAGAGGG - Intronic
1148450845 17:47777132-47777154 CAGTGGGTGAGGCTGGTGGAGGG - Intergenic
1149893684 17:60412395-60412417 TAGTGGGGAATGGGGGCGGTGGG + Intronic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG + Intergenic
1152841418 17:82571085-82571107 GGGTGGGTAAGGCTGGCTGAGGG - Intronic
1157231428 18:45920110-45920132 GAGTGGGTAAGGGGAGAGGAAGG - Intronic
1158062831 18:53366810-53366832 GAGTGGGCAAGGCCGGAGGATGG - Intronic
1161131359 19:2590805-2590827 TAGTTGGTTGGGTGGGCGGATGG - Intronic
1161249023 19:3270665-3270687 CGGTGGGTAAGGCGGGCGCCGGG + Intronic
1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG + Exonic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164758683 19:30710433-30710455 TGGAGGCTAAGGCGGGAGGATGG + Intronic
1167056305 19:47113139-47113161 TAGAGGCTGAGGCGGGAGGAAGG + Intronic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG + Intronic
932087256 2:68773500-68773522 AAGTGGGGAAGGCAGGAGGAAGG + Intronic
932693466 2:73933509-73933531 TGGTAGGCAAGGCGGGAGGAGGG + Intronic
938924229 2:136024571-136024593 TAGAGGCTGAGGCGGGAGGATGG - Intergenic
947488753 2:230575905-230575927 TAATCGGTAAGGCTGGTGGAGGG - Intergenic
948197793 2:236108126-236108148 TAGGGGGTCAGGCGGAGGGACGG - Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
959129154 3:102331357-102331379 TAGTGGGGAGGGCAGGAGGAAGG - Intronic
961009192 3:123424638-123424660 TTCTGGGTAAGGCTGGAGGAAGG - Intronic
961283494 3:125781718-125781740 TAGATGGTAAGGTGGGTGGATGG - Intergenic
969675301 4:8611231-8611253 TGGTGGGTCAGGCAGGCGAAGGG - Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
975786966 4:77900990-77901012 TAGGGGGTAAGGGAGGGGGAAGG + Intronic
975992223 4:80268563-80268585 AAGTGGGTAAGGCGGTAGGCTGG + Intronic
979226147 4:118287248-118287270 GAGTGGCTAAGGCAGGAGGATGG - Intronic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
988424676 5:31049743-31049765 TAGTAGGAAAGGTGGGAGGAAGG - Intergenic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG + Intronic
998036720 5:138923627-138923649 TAGAGGCTGAGGCGGGAGGATGG - Intronic
1000335388 5:160238115-160238137 TAGTGGGAGAGGCAGGCGGGGGG - Intronic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1003226514 6:4210934-4210956 CAGTGGGTGAGGCGGGGGGCGGG - Intergenic
1007326610 6:41066229-41066251 TAGAGGTTGAGGCGGGAGGATGG - Exonic
1011389403 6:86835661-86835683 TAGTGGGTTAGGTTGGCGGTGGG - Intergenic
1017017540 6:150113884-150113906 TAGTGGGGAGGACGGGTGGAAGG - Intergenic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1019575621 7:1736288-1736310 CAGGGGGAAAGGTGGGCGGAGGG - Intronic
1020065742 7:5187279-5187301 CAGAGGCTAAGGCGGGAGGATGG - Intergenic
1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG + Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1027987911 7:85318551-85318573 CAGTGGGTAGGGCTGGGGGAGGG - Intergenic
1030779937 7:113587864-113587886 TAGTGGGGAAGGCTGGGGTAGGG - Intergenic
1033855234 7:145552877-145552899 TAATGGGTACAGAGGGCGGAAGG + Intergenic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035413782 7:158667367-158667389 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414074 7:158668204-158668226 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414134 7:158668379-158668401 TAATAGGTAAGGAGGGCGGAGGG - Intronic
1036405396 8:8450388-8450410 GAGAGGCCAAGGCGGGCGGATGG + Intergenic
1036584076 8:10106882-10106904 TAGAGGGGTAGGCGGGTGGAGGG - Intronic
1036767650 8:11558895-11558917 TACTGGGTAAGGCTGGGCGAGGG - Intronic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG + Intergenic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG + Exonic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1048409407 8:134156545-134156567 GAGTGGGTAAGGCGTGCCTAAGG - Intergenic
1049745715 8:144262452-144262474 GAGTGGGTACCGCGGGTGGAAGG + Exonic
1052002044 9:23295685-23295707 TACTGGATAAGGCATGCGGAAGG + Intergenic
1053405424 9:37871187-37871209 TATTGGGGAAGGTGGGGGGAGGG + Intronic
1056393780 9:86162946-86162968 TTGTGGGTTCGGCGGGGGGAGGG + Intergenic
1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG + Intergenic
1061594794 9:131621810-131621832 TGGGGGGTAGGGCGGGCGGCGGG + Exonic
1062219478 9:135406927-135406949 TGGTGGGGAAGGCAGGAGGATGG - Intergenic
1188016494 X:25112744-25112766 TAGTGGCTAAGATGGGAGGATGG - Intergenic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1192821726 X:74653407-74653429 AAGTGGGCAAAGCGGGGGGACGG - Intergenic
1193846142 X:86473503-86473525 TAGTGGGTGATGGGGGAGGAAGG - Intronic
1196105136 X:111887204-111887226 TAGTGGGTAATGCCAGAGGAAGG + Intronic
1197986716 X:132273840-132273862 TAATGGGTATGGGGGGTGGATGG - Intergenic
1198051392 X:132956341-132956363 TAGGGGGGAAAGCGGGGGGAGGG + Intronic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic