ID: 1035413975

View in Genome Browser
Species Human (GRCh38)
Location 7:158667917-158667939
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1093
Summary {0: 5, 1: 0, 2: 3, 3: 56, 4: 1029}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035413975_1035413989 9 Left 1035413975 7:158667917-158667939 CCCTCCGCCCTCCTTACCTACCC 0: 5
1: 0
2: 3
3: 56
4: 1029
Right 1035413989 7:158667949-158667971 CCACCCTCTTACCCACTACTGGG 0: 3
1: 1
2: 0
3: 7
4: 138
1035413975_1035413987 8 Left 1035413975 7:158667917-158667939 CCCTCCGCCCTCCTTACCTACCC 0: 5
1: 0
2: 3
3: 56
4: 1029
Right 1035413987 7:158667948-158667970 TCCACCCTCTTACCCACTACTGG 0: 3
1: 1
2: 0
3: 16
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035413975 Original CRISPR GGGTAGGTAAGGAGGGCGGA GGG (reversed) Intronic
900187259 1:1338195-1338217 GGGTAGGTGAGGGCCGCGGAGGG + Intronic
900244672 1:1631579-1631601 GGGTAGGCAAGGGCCGCGGAGGG - Intergenic
900614736 1:3560461-3560483 GGGTGAGGAAGGAGGGAGGAAGG - Intronic
900681707 1:3920234-3920256 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
900859074 1:5212230-5212252 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
900969200 1:5980186-5980208 GGGTTGGTCAGGAGGCAGGAGGG - Intronic
901240772 1:7691950-7691972 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
901306441 1:8236367-8236389 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
901415538 1:9113548-9113570 GGGAAGGGCAGGAGGGCTGATGG + Intronic
901560423 1:10066032-10066054 GGGGAGGGAAGGAGGGGGGGAGG - Intronic
901779236 1:11582065-11582087 GGGGAGGAAAGGAAGGCGGCTGG + Intergenic
902036551 1:13462429-13462451 GGGAGGGTAAGGTGGGAGGATGG - Intergenic
902283022 1:15388283-15388305 GGGAAGGGAAGGAGGGAGGGAGG - Intronic
902407704 1:16194662-16194684 AGGCAGGAAAGGAGGGAGGAAGG + Intergenic
902690471 1:18107689-18107711 GGGAGGGCAAGGAGGGCGGGGGG + Intergenic
902692591 1:18119128-18119150 GGGAAGGGAAGAAGGGAGGAAGG - Intronic
902790780 1:18766389-18766411 GGGTAGGTGAAGAGGGCAGAGGG + Intergenic
903010771 1:20328546-20328568 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
903331753 1:22600187-22600209 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
903568581 1:24287044-24287066 GGGCAGGGAGGGTGGGCGGAGGG - Intergenic
903737805 1:25541402-25541424 GGGGAGGAAAGGAGGGAGGAAGG + Intergenic
904146232 1:28394282-28394304 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
904938996 1:34151796-34151818 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
905199707 1:36307407-36307429 CGGGAGGGAAGGAGGGAGGAAGG + Intronic
905223655 1:36465937-36465959 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
905322765 1:37129588-37129610 GGCCAGGTAAGGAAGGGGGAAGG + Intergenic
905753411 1:40486393-40486415 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
906954953 1:50366479-50366501 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
907101858 1:51844785-51844807 GGGAAGGGGAGGAGGGGGGAGGG + Intronic
907474910 1:54699256-54699278 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
908262501 1:62349640-62349662 GGGTAGGGGAGGAGAGAGGAGGG + Intergenic
909213105 1:72849646-72849668 GGGAAGGGAGGGAGGGAGGAGGG - Intergenic
910363246 1:86436356-86436378 AGGGAGGTAGGGAGGGAGGAAGG - Intronic
910934382 1:92475637-92475659 GGGTAGGTCAAGAGGGGGGAGGG + Exonic
910937344 1:92495241-92495263 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
912065552 1:105736472-105736494 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
912194708 1:107384050-107384072 GGTTAGATAAGGAGTGCTGAAGG - Intronic
912347637 1:108979419-108979441 GGGAAGCTAAGGCGGGAGGATGG + Intronic
913163891 1:116168186-116168208 GAGAAGCTAAGGAGGGAGGATGG + Intergenic
913183867 1:116348904-116348926 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
913558057 1:119989045-119989067 AGGTAGGTAAGAAGGGAGGTAGG + Intronic
914362266 1:146945083-146945105 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
915132843 1:153707767-153707789 GGGGAGGAAGGGAGGGCGGGAGG + Intergenic
915213203 1:154324992-154325014 GCGGAGGGAAGGAGGGCGGCGGG + Exonic
915311230 1:155006789-155006811 GGGGAGGAAAGGAGGAAGGAAGG - Intronic
916078676 1:161218405-161218427 GGCTAGGTAAGGTGGGAGGGAGG - Intronic
916242756 1:162656577-162656599 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
916512142 1:165481874-165481896 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
917234160 1:172872862-172872884 GGGGAGGGAAGGAGGGAAGAAGG - Intergenic
917447732 1:175120903-175120925 GGGAAGCTAAGGTGGGAGGATGG - Intronic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
917904118 1:179572775-179572797 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
918246201 1:182661534-182661556 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
919348021 1:196411117-196411139 AGGTAGGAAAGAAGGGAGGAAGG - Intronic
919353791 1:196495492-196495514 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
919574947 1:199296126-199296148 AGGAAGGTGAGGAGAGCGGAGGG + Intergenic
919739939 1:200975317-200975339 GGGTAGGGAAGAAGGGAGGATGG + Intronic
919801973 1:201359566-201359588 AGGTAGGGAAGGAGGGGGCAGGG + Intronic
920094248 1:203475703-203475725 GGGGAGGAGAGGAGGGAGGAGGG - Intergenic
920111690 1:203591622-203591644 GGGTCTGTGAGGAGGGTGGAAGG + Intergenic
920330412 1:205203507-205203529 GGGTAGGGAAGGGGAGGGGAGGG + Intronic
920366668 1:205451484-205451506 GGGCAGGCAAGCAGGGCGGGTGG - Intronic
920442334 1:205989408-205989430 GGCAAGGTGAGGAGGGCGGGTGG - Intronic
920634450 1:207686083-207686105 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921024771 1:211267830-211267852 GGGAGGCCAAGGAGGGCGGATGG - Intronic
921305395 1:213791585-213791607 TGGGAGGTAAAGAGGGAGGAAGG + Intergenic
921553624 1:216569246-216569268 GGAAAGGAAAGGAGGGAGGAAGG + Intronic
922315196 1:224435137-224435159 GGGCATGTAAGGTGCGCGGAGGG + Intronic
922473242 1:225889205-225889227 GGGGAGGGAAGGAGGGAGGGAGG + Intronic
922586824 1:226739373-226739395 GGGTAGTGGAGGAGGGAGGAGGG + Intergenic
922762275 1:228140511-228140533 GGGGAGCTCTGGAGGGCGGACGG + Intronic
922951441 1:229561100-229561122 TGGTAGGTAAGGAGTGAGGTGGG + Intergenic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
924570776 1:245235663-245235685 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
924728711 1:246692735-246692757 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
924852028 1:247840303-247840325 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1062989462 10:1802598-1802620 GGTTAGATAAGGAGGCCAGAAGG + Intergenic
1063025931 10:2178805-2178827 GGAAAGGGAAGGAGGGAGGAAGG - Intergenic
1063225668 10:4013137-4013159 GGGAAGGGAAGGAGGAGGGAAGG - Intergenic
1063483589 10:6398856-6398878 GGGAAGCTAAGGTGGGAGGATGG - Intergenic
1063534184 10:6866931-6866953 GGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1063869813 10:10405163-10405185 GGGGAGGCAAGAAGGGCTGAAGG + Intergenic
1064142161 10:12799451-12799473 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1064304308 10:14151723-14151745 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1064587652 10:16854897-16854919 AGGAAGGAAAGGAGGGAGGATGG - Intronic
1064677349 10:17774772-17774794 AGGTAGGGAAGGAGGGAGGGAGG - Intronic
1064787894 10:18918444-18918466 GGGAAGGTAAGCTGGGAGGATGG - Intergenic
1065129897 10:22609990-22610012 GGGAAGGTAGGGAGAGTGGATGG - Intronic
1065169191 10:23010454-23010476 GGGAAAGGAAGGAGGGAGGAGGG - Intronic
1065169198 10:23010474-23010496 GGGAAAGGAAGGAGGGAGGAGGG - Intronic
1065169205 10:23010494-23010516 GGGAAGGGAAGGAGAGGGGAGGG - Intronic
1065169353 10:23011008-23011030 GGGAAGGGAAGGAGAGAGGAGGG - Intronic
1065494976 10:26318535-26318557 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1065540848 10:26765626-26765648 GGGAAGGGAAGGAGGGAGGGAGG + Intronic
1065634991 10:27722656-27722678 GTGTAGGTAAGGAGGTTGGTTGG + Intronic
1065689134 10:28315339-28315361 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1065784850 10:29203652-29203674 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1065874186 10:29982977-29982999 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1065885374 10:30072143-30072165 GGGAAGGGAAGAAGGGAGGAGGG + Intronic
1065905628 10:30248539-30248561 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1066299769 10:34086583-34086605 GAGTAAGAAAGGAGGGAGGAAGG + Intergenic
1066761923 10:38763083-38763105 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1067449251 10:46371220-46371242 GGGCAGGGAAGGAGGGAGGGAGG + Intronic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067588119 10:47489545-47489567 GGGCAGGGAAGGAGGGAGGGAGG - Intronic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1067635244 10:47997636-47997658 GGGCAGGGAAGGAGGGAGGGAGG - Intergenic
1067921812 10:50466328-50466350 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1068051614 10:51957182-51957204 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1068329225 10:55538983-55539005 GGGAAGGAAAGGAGGAAGGAAGG - Intronic
1068945988 10:62729278-62729300 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1068983046 10:63081447-63081469 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1069855838 10:71440598-71440620 GGCCAGGAAAGGAGGGCAGAGGG - Intronic
1069961469 10:72081634-72081656 GGATAGGCACGGAGGGCTGAAGG + Intronic
1070509466 10:77147422-77147444 GGGAAGGGAAGGAGGGAGGGAGG - Intronic
1070657042 10:78278774-78278796 AGGGAGGTAAGGAGGGAGGAAGG - Intergenic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1071729898 10:88237288-88237310 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1071764664 10:88649182-88649204 TGGTAGGGAGGGAGGGGGGAGGG + Intergenic
1071867716 10:89755398-89755420 GGGAAGGAAAGGAGGGAGGGAGG - Intronic
1072580932 10:96739762-96739784 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1072662803 10:97373011-97373033 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
1072754735 10:98011775-98011797 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1073215519 10:101834051-101834073 GAGTAGATATGGAGGGAGGAGGG - Intronic
1073250744 10:102119292-102119314 GGGCAGGTGGGGGGGGCGGAGGG - Intronic
1073443271 10:103565178-103565200 GGGCAGGTCAGGAGGGCAGCTGG + Intronic
1074272328 10:111966688-111966710 GGGGAGGGAAGGAGGGAGGGAGG + Intergenic
1074392658 10:113071153-113071175 GGGTAGGGAGGCAGGGTGGAAGG - Intronic
1074609201 10:115004623-115004645 GGGAAGGAAAGAAGGGAGGAAGG - Intergenic
1074827932 10:117228274-117228296 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1075026458 10:118987844-118987866 AGGGAGGGAAGGAGGGGGGAAGG + Intergenic
1075317737 10:121466026-121466048 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1075656299 10:124163346-124163368 AGGAAGGAAAGGAGGGAGGAGGG + Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076000410 10:126908325-126908347 GAGTTGGTAAGGATGGTGGAGGG - Intronic
1076108094 10:127840431-127840453 AGGTCGGTAAGGATGGTGGAGGG + Intergenic
1076232417 10:128832567-128832589 GGGGAGGGAAGGGGAGCGGAGGG + Intergenic
1076721927 10:132396747-132396769 GGGGAGGGAGGGAGGGCGCAGGG + Intergenic
1076804805 10:132850013-132850035 GAGTAGGCAAGGAGGGCAGGCGG - Intronic
1076843315 10:133057124-133057146 AGGCAGGTGAGGAGGGCGGGAGG + Intergenic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1076930627 10:133529407-133529429 GGGCAGGCAGGGAGGGAGGAAGG - Intronic
1077418247 11:2436055-2436077 GGGGAGGTCAGGGGAGCGGAAGG - Intergenic
1077779256 11:5307633-5307655 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1078254600 11:9647097-9647119 GGGGAGGGAAGGAGGGAGGGAGG - Intergenic
1078926401 11:15879450-15879472 GGGAATGTAAGGAGGAGGGAGGG + Intergenic
1079089205 11:17469053-17469075 GGGAAGGGAGGGAGGGAGGAGGG - Intronic
1079390472 11:20017944-20017966 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1079393125 11:20039432-20039454 GGGAAGGAGAGGAGGGAGGAAGG - Intronic
1079512569 11:21228687-21228709 GGGGAGGGAAGGAGAGGGGAGGG - Intronic
1080668445 11:34356213-34356235 GGATAAGTAAGATGGGCGGAGGG - Intronic
1081589406 11:44410604-44410626 AGGTAGGCAAGGAGGGAGAAAGG + Intergenic
1081693655 11:45094776-45094798 GGGAAGGAAGGGAGGGAGGAGGG + Intergenic
1083187138 11:61024272-61024294 GGGTAGGGAAGGAGGGAGGGAGG - Intergenic
1083282906 11:61638440-61638462 GGGGAGGACAGGAGGGAGGACGG + Intergenic
1083427574 11:62596527-62596549 GGGTAGCTAAGGGGGGCAGAGGG + Exonic
1084470465 11:69356363-69356385 GGGAAGGAAAGGAGGGAGGAAGG + Intronic
1084928680 11:72535938-72535960 GGGAAGGGAAGGAGGGTGGAAGG + Intergenic
1084986255 11:72875570-72875592 GGCCAGGGCAGGAGGGCGGAAGG - Intronic
1086307157 11:85493773-85493795 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1086700583 11:89896817-89896839 GGGTAGGTCAGGCGGGCGCTGGG + Intergenic
1086705586 11:89947709-89947731 GGGTAGGTCAGGCGGGCGCTGGG - Intergenic
1087919123 11:103846296-103846318 AGGAAGGGAGGGAGGGCGGAAGG - Intergenic
1087931869 11:103987275-103987297 GGGTGGGAAAGGAAGGAGGATGG - Intronic
1088063388 11:105685140-105685162 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1088652641 11:111971973-111971995 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1088868046 11:113867804-113867826 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
1089188477 11:116637052-116637074 GGGCAGGTGGGGAGGGCGGGTGG - Intergenic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1090632563 11:128662961-128662983 GGTTAGGGAGGGAGGGCAGAAGG - Intergenic
1091007403 11:131965940-131965962 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
1091192721 11:133707811-133707833 GGGAAGGAAAGGAGAGGGGAAGG + Intergenic
1091267996 11:134285675-134285697 GGGAAGCTAAGGTGGGAGGATGG + Intronic
1091339403 11:134798641-134798663 GGGGAGCGAAGGAGGGAGGATGG + Intergenic
1091539582 12:1447409-1447431 AGGTAGTTAAGGTGGGAGGATGG + Intronic
1091542255 12:1472710-1472732 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1092042364 12:5395894-5395916 GGGGAGGGAGGGAGGGCGGAGGG - Intergenic
1092092196 12:5812326-5812348 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1092103161 12:5902661-5902683 GGGGAGGGGAGGAGGGGGGAGGG + Intronic
1092103173 12:5902681-5902703 GGGGAGGGGAGGAGGGGGGAGGG + Intronic
1092113327 12:5980205-5980227 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1092179172 12:6433599-6433621 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1092229598 12:6769212-6769234 GGGCAGGCAAGGGAGGCGGAGGG + Intronic
1092361017 12:7836588-7836610 GGGAGGCTGAGGAGGGCGGATGG + Intronic
1092911171 12:13146093-13146115 GGGCAGGAAAGGAAGGAGGAAGG - Intergenic
1094292152 12:28863615-28863637 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1094493756 12:30976926-30976948 GGGTAGGAAAGGAAGGGGCAGGG + Intronic
1094578621 12:31712061-31712083 AGGTAGGGAAGGAGGGAGGGAGG - Intronic
1094589074 12:31804405-31804427 TGGGAGGGAAGGAGGGCAGAAGG - Intergenic
1095724112 12:45433451-45433473 GGGTTGGTCAGGAGGGAGGTTGG + Intronic
1096118191 12:49068673-49068695 GGGAAGCTGAGGCGGGCGGATGG - Intronic
1096242829 12:49968372-49968394 GGGAAAGTAAGGGGGGCGAAGGG - Intronic
1096521827 12:52188856-52188878 GGGGAGGCAGGGAGGGCGCAAGG - Intronic
1096592127 12:52667208-52667230 GGGAAGGGAAGGGGGGAGGAAGG + Intergenic
1096617537 12:52842494-52842516 GAGTAGGTGAGGTGGGCGGCAGG - Intronic
1096680399 12:53252035-53252057 GGTAAGGGAAGGAGGGCGGGCGG + Exonic
1096781508 12:53994820-53994842 AGGGAGGGAAGGAGGGCGGGCGG + Intronic
1096790326 12:54040373-54040395 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1096882235 12:54682604-54682626 GGGTGGGTCAGGAGGACGGGAGG - Intergenic
1096911592 12:54989739-54989761 GGGTAGGGAAGGAGAGGGGAGGG - Intergenic
1098358368 12:69631985-69632007 GGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1098448337 12:70590737-70590759 GGGTAGGGAAGGAGAGAGGATGG - Intronic
1098802426 12:74978421-74978443 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1098891668 12:76015681-76015703 GGGAAGGGAAGGAGGAAGGAAGG + Intergenic
1099034871 12:77573727-77573749 GGGTGGGTAAAGAGGGAGGGAGG + Intergenic
1099620270 12:84995194-84995216 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1100034444 12:90234327-90234349 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1100346213 12:93734052-93734074 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1100515447 12:95323112-95323134 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1100522045 12:95384666-95384688 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1100761466 12:97811830-97811852 GGGAAGGGAAGGAGGGAGGCAGG + Intergenic
1101394491 12:104333701-104333723 GGGAAGGAAAGGAGGAAGGAAGG - Intronic
1101638306 12:106565882-106565904 GGGTAGGGAGGGAGGAAGGAAGG + Intronic
1101858381 12:108462981-108463003 GGGTAGGAAAGGGGAGGGGAGGG + Intergenic
1101958926 12:109233715-109233737 GGGTAGAGAGGGAGGGCTGAGGG - Intronic
1102157458 12:110742636-110742658 TGGAAGGTAAGGGGGGCGGCGGG - Exonic
1102552550 12:113702233-113702255 GGGGAGAGAAGGAGGGAGGAAGG - Intergenic
1102625246 12:114229815-114229837 GGATAGGGAAGGAGGACAGAAGG + Intergenic
1102705703 12:114878457-114878479 GGGAAGAGAAGGAGGGTGGAGGG - Intergenic
1102754163 12:115323303-115323325 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1102999568 12:117375093-117375115 GGGAAGGTGAGCAGGGAGGAGGG + Intronic
1103246736 12:119464375-119464397 GGGGAGGGAAGGAAGGAGGAAGG - Intronic
1103437348 12:120937127-120937149 GGGTGGGTAATGAGGTTGGAAGG + Intergenic
1103444351 12:120984480-120984502 GAGAAGGGAAGGAGGGAGGAAGG + Intronic
1103587354 12:121966182-121966204 GGGGAGGGAAGGAGAGGGGAGGG - Intronic
1103589403 12:121980585-121980607 GGGAGGCTAAGGAGGGTGGATGG - Intronic
1103705166 12:122867399-122867421 GGGTAGGGAAGGGGGGCGGTAGG + Exonic
1103728844 12:123012836-123012858 GGGCATGGAAGGAGGGTGGAGGG + Intronic
1103938389 12:124488781-124488803 GGGCAGAGAAGCAGGGCGGACGG + Intronic
1104207108 12:126649723-126649745 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1105323617 13:19350440-19350462 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1105481946 13:20785859-20785881 GGGGAGGAAAGGAGGGAGGGAGG + Intronic
1105805023 13:23947603-23947625 GGGTAGGCAGGGAGAGGGGAGGG - Intergenic
1105870329 13:24499057-24499079 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1106261859 13:28074743-28074765 GGGAAGCTAAGGTGGGGGGATGG - Intronic
1106526392 13:30544445-30544467 GGGGAGGGAAGAGGGGCGGAAGG + Intronic
1106584141 13:31042856-31042878 AGGTAGGTGTGGAGGGTGGAAGG + Intergenic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1107350352 13:39507898-39507920 GGGAAGGAAAGAAGGGAGGAAGG - Intronic
1107455927 13:40554514-40554536 GGTTAGGTAAGGTAGGTGGAGGG - Intergenic
1107559191 13:41545150-41545172 GGCAAGGTGAGGAGGGCTGAAGG + Intergenic
1107788514 13:43977867-43977889 AGGTAGGGACGGAGGGAGGAAGG - Intergenic
1107798813 13:44083839-44083861 GGGAAGATTAGGAGGGAGGAGGG + Intergenic
1109281086 13:60356440-60356462 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1109971743 13:69779396-69779418 GGGAAGGAAAGGAGGGAAGAGGG - Intronic
1110247368 13:73342055-73342077 GGGTGGGAAAGGATGGGGGAGGG - Intergenic
1110325755 13:74213583-74213605 GGGGAGGGAAGGAGGGAGGGAGG - Intergenic
1110364824 13:74670021-74670043 GGGGAGGGAAGGAGGGAGGGAGG - Intergenic
1110451558 13:75642363-75642385 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1111118279 13:83811162-83811184 TGGTAGGTATGAAGGGCAGATGG - Intergenic
1111541917 13:89679691-89679713 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1111792020 13:92869538-92869560 AGGAAGGAAAGGAGGGAGGAGGG + Intronic
1112108995 13:96273956-96273978 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1113420761 13:110170034-110170056 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1113453538 13:110430872-110430894 GGGTAGGTATGGGGTGGGGATGG - Intronic
1113680661 13:112242106-112242128 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1113850542 13:113415083-113415105 GGGCAGGTGAGGAGAGGGGAGGG + Intergenic
1114339148 14:21724660-21724682 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1114872166 14:26671756-26671778 GGGTTGGTAAGGGGGGAGGCAGG + Intergenic
1115046910 14:29005812-29005834 GGGTAGGAAAGGAAGGAGAAGGG - Intergenic
1115330167 14:32188526-32188548 GGGTGGCTAAGGTGGGAGGATGG + Intergenic
1115389814 14:32842031-32842053 GGGGAGGGGAGGAGGGGGGAGGG - Intergenic
1115399580 14:32941213-32941235 GGGAAGGGAGGGAGGGAGGAGGG - Intronic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1117401108 14:55358966-55358988 GGGATGGGAAGGAGGGAGGAAGG + Intronic
1117648726 14:57880019-57880041 GGAAAGGAAAGGAGGGAGGAAGG + Intronic
1117992601 14:61449323-61449345 GGGGAGGAAAGGAGGGAGGGAGG - Intronic
1118021788 14:61724388-61724410 GGGAAGGGAAGGAGTGCGGGAGG - Intronic
1118073388 14:62271094-62271116 GGGGAGGGAAGGATGGAGGATGG - Intergenic
1118145849 14:63135749-63135771 GAGAAGGAAAGGAGGGGGGAAGG + Intergenic
1118368244 14:65113887-65113909 GGGAAGGTAAGGCTGGTGGAGGG - Intergenic
1118795480 14:69139859-69139881 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1120228606 14:81818538-81818560 GGGTAGGTGAAGAGGCAGGAGGG + Intergenic
1120416264 14:84221784-84221806 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1120635372 14:86944056-86944078 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1120909734 14:89655386-89655408 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
1121623004 14:95363164-95363186 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1122068592 14:99190619-99190641 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1122415759 14:101548775-101548797 GGGGAGGAAAGGATGGGGGAGGG + Intergenic
1122431891 14:101656303-101656325 GGGAGGCTGAGGAGGGCGGATGG + Intergenic
1123038362 14:105480414-105480436 GGGGAGGTAAGGAAGGTGGGAGG + Intergenic
1123119693 14:105910986-105911008 GGGGAGGGAAGGATGGAGGAAGG - Intergenic
1123168473 14:106349007-106349029 TGGTAGGAAAGGAAGGAGGAAGG - Intergenic
1124702340 15:31927086-31927108 GGGTAGATAAGGAGATAGGATGG - Intergenic
1124803702 15:32860222-32860244 AGGTAGGAAGGGAGGGAGGAAGG + Intronic
1124971833 15:34496079-34496101 GAGTAGGGAACCAGGGCGGAGGG - Intergenic
1125084515 15:35714498-35714520 GGGAAGGAAAGGAGGGAGGGAGG - Intergenic
1125716451 15:41822462-41822484 AGGTAGGCAAGGAGGGGAGAAGG - Intronic
1126350697 15:47742356-47742378 GGTGAGGTAAGGAGGGAGGTGGG + Intronic
1126362800 15:47863577-47863599 GGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1126478536 15:49092747-49092769 GGGGAGGGAAGGAGAGGGGAGGG - Intergenic
1126478545 15:49092767-49092789 GGGGAGGGAAGGAGAGGGGAGGG - Intergenic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1127194482 15:56568938-56568960 GGGTAGGTAGGGAAGGCTGTTGG - Intergenic
1127499207 15:59541236-59541258 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
1127534206 15:59874838-59874860 GGGCAGGTAGGGAGGGCAGGAGG - Intergenic
1127926184 15:63545728-63545750 GGGAGGCTAAGGCGGGCGGATGG + Intronic
1128355578 15:66924062-66924084 GGGGAGGGAAGGAGGAAGGAAGG - Intergenic
1128365004 15:66993321-66993343 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1130251919 15:82305386-82305408 GGTTAGGGGAGGAGGGAGGAAGG - Intergenic
1130378407 15:83351028-83351050 TGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1131009719 15:89006993-89007015 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1131588565 15:93722507-93722529 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1132209774 15:100011335-100011357 GGGAAGGAAAGGAGGAGGGACGG + Intronic
1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG + Intergenic
1132855541 16:2043021-2043043 GGGGAGGTAAGGACTGAGGAGGG - Intronic
1133330165 16:4967975-4967997 GGGAAGGGAAGGAGAGGGGAGGG - Intronic
1133588277 16:7216991-7217013 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1133795285 16:9041462-9041484 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1133962950 16:10510385-10510407 GGGGAGGGAAGGAGAGGGGAAGG + Intergenic
1134165170 16:11924190-11924212 GGGAAGCTAGGGTGGGCGGATGG - Intergenic
1134371506 16:13630211-13630233 GGGAGGCTAAGGAGGGCAGATGG - Intergenic
1134860986 16:17560605-17560627 TGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1134861003 16:17560668-17560690 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1135016518 16:18928288-18928310 GGGTAGGGAGGGAGGGAGGGAGG + Intergenic
1135110926 16:19690318-19690340 GGGGAGGGAAGGAGGGAGGGAGG + Intronic
1135250740 16:20899822-20899844 GGGAGGGAAATGAGGGCGGAGGG + Intronic
1135491466 16:22913169-22913191 AGGGAGGGAGGGAGGGCGGAAGG + Intronic
1135529079 16:23237231-23237253 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1135603351 16:23801774-23801796 GGGAAGGGAAGGGGGGGGGAGGG - Intergenic
1135701595 16:24637545-24637567 GGGAAAGTAAGGAAGGAGGAAGG + Intergenic
1135708704 16:24696781-24696803 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1135873431 16:26173794-26173816 GGGAGGCTAAGGAGGGCAGATGG + Intergenic
1135892642 16:26371450-26371472 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1135913107 16:26579094-26579116 GGGAAGGAAAGAAGGGAGGAAGG - Intergenic
1136007112 16:27338456-27338478 GGGAGGCTAAGGAGGGAGGATGG - Intronic
1136042944 16:27594690-27594712 GGGCAGCTAAGGTGGGAGGATGG - Intronic
1136285527 16:29238323-29238345 GGGGAGGAAAGGAGGGAGGGAGG + Intergenic
1136333476 16:29596351-29596373 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1136333482 16:29596371-29596393 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1137931307 16:52590052-52590074 AGGAAGGTAAGAAGGGAGGAGGG + Intergenic
1139246796 16:65452412-65452434 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1139363649 16:66419351-66419373 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1139423467 16:66863797-66863819 GGGTAGGGAAGGGGAGGGGAAGG + Intronic
1139486963 16:67263253-67263275 AGGTAGATGAGGAGGGCAGATGG + Intronic
1139701551 16:68710959-68710981 GGGAGGGGAAGGAGGGGGGAGGG + Intronic
1139711550 16:68780150-68780172 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1139828826 16:69780080-69780102 GGGTAGGGGAGGAGGGAGCAGGG - Intronic
1140221447 16:73047532-73047554 GGGAAGGGAAGGAAGGAGGAAGG + Intronic
1140270168 16:73458368-73458390 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1140338095 16:74130676-74130698 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1140386315 16:74542683-74542705 GGGAAGGGAAGGAGGGAGGGAGG + Intronic
1140733321 16:77875831-77875853 AGGGAGGTTAGGAGGGAGGAAGG + Intronic
1140833791 16:78774999-78775021 AGGTAGGTAAGTTGGGCAGATGG + Intronic
1140866438 16:79066498-79066520 GGGAAGGGAAGAAGGGAGGAAGG + Intronic
1141193623 16:81842873-81842895 GGGTAGGCAGGGAGGGCTGAGGG + Intronic
1141348472 16:83270891-83270913 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
1141427096 16:83951757-83951779 AGGGAGGGAAGGAGGGTGGAAGG - Intronic
1141473977 16:84259529-84259551 GGGGAGGTAATGAGGTCAGAGGG - Intergenic
1141557581 16:84846206-84846228 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
1141603113 16:85138016-85138038 AGGTAGGGAGGGAGGGAGGAAGG - Intergenic
1141682942 16:85554780-85554802 GGGGAGGGAGGGAGGACGGACGG + Intergenic
1141694633 16:85613697-85613719 GGGCAGGTAAAGTGGGGGGATGG + Intronic
1141790119 16:86228697-86228719 AGGTAGGTAGGGAGGGAGGGAGG - Intergenic
1143473823 17:7192007-7192029 GGGCAGGCAGGGTGGGCGGAGGG + Intronic
1143524141 17:7462679-7462701 GGGCAGGTAAAGCGGGTGGAGGG + Exonic
1143894497 17:10125646-10125668 GGGGAGATGAGGAGGGAGGAGGG + Intronic
1144560987 17:16320244-16320266 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1144877719 17:18411124-18411146 GGGTCGGGAAGGAGAGGGGAGGG - Intergenic
1145154502 17:20533264-20533286 GGGTCGGGAAGGAGAGGGGAGGG + Intergenic
1145154508 17:20533279-20533301 GGGGAGGGAAGGAGAGGGGAGGG + Intergenic
1145214607 17:21042487-21042509 GGGAAGGAAAGGAGGGGGAAGGG + Intronic
1146410671 17:32581482-32581504 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1146693676 17:34893265-34893287 GGGTCAGGAAGGAGGGTGGAGGG + Intergenic
1146944551 17:36864766-36864788 AGGAAGGAAAGGAGGGAGGAGGG - Intergenic
1147273145 17:39291347-39291369 TGGTAGGTAGGGAGGGAGGGAGG + Intronic
1147617408 17:41837699-41837721 GGGGTGGTAAGGAGGGGAGAAGG + Intronic
1147970792 17:44218567-44218589 GGGTTGGGAAGCGGGGCGGAGGG - Intronic
1148255195 17:46125026-46125048 GGGGAGGTAGGGAGGGAGGGAGG + Intronic
1148255197 17:46125030-46125052 AGGTAGGGAGGGAGGGAGGAGGG + Intronic
1148469222 17:47883249-47883271 GGAGAGGTAAGGTGGGCGGTGGG - Intergenic
1148549345 17:48541555-48541577 GGGAAGGGAAGGAGAGCGGCGGG - Intronic
1148637603 17:49160597-49160619 GGGTATGACAGGATGGCGGATGG - Exonic
1149159149 17:53668939-53668961 GGGAAGGAAGGGAGGGGGGAGGG + Intergenic
1149424934 17:56545936-56545958 GGGAAGGGAAGGAGGCAGGAGGG + Intergenic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1150293170 17:63993283-63993305 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1150293188 17:63993336-63993358 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1150293243 17:63993469-63993491 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1150369543 17:64624824-64624846 GGGGAGGGAAGGAGAGGGGAGGG + Intronic
1150519565 17:65852265-65852287 GGGAAGGGAAGGAGGGAGGGAGG - Intronic
1150519592 17:65852334-65852356 GGGAAGGGAAGGAGGGAGGGAGG - Intronic
1150820130 17:68428135-68428157 GGGAGGCCAAGGAGGGCGGATGG - Intronic
1151051012 17:70978584-70978606 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1151338915 17:73457282-73457304 GGGGAGGGAGGGAGGGGGGAAGG - Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151852254 17:76697919-76697941 GGATAGATAAGGCGGGGGGAGGG + Intronic
1152300173 17:79491041-79491063 GGGGAGGAAAGGAGAGGGGAGGG + Intronic
1152445493 17:80340351-80340373 GTGTTGGTAAGGAGAGCGGCAGG + Exonic
1152841418 17:82571085-82571107 GGGTGGGTAAGGCTGGCTGAGGG - Intronic
1203183865 17_KI270729v1_random:93198-93220 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1153320812 18:3772426-3772448 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1155280354 18:24233372-24233394 GGGTAGCAAAGGAGGAAGGAGGG - Intronic
1155500352 18:26481380-26481402 GGTTAGGTAAGCAGGGAGAAGGG + Intronic
1155518089 18:26642877-26642899 GGGGAGGGTGGGAGGGCGGAAGG + Intronic
1155730965 18:29157506-29157528 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1155813783 18:30276329-30276351 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1156075638 18:33275641-33275663 GGGTAGGAAAGGGGAGGGGAGGG + Intronic
1156146963 18:34194405-34194427 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1156524439 18:37753418-37753440 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1157119467 18:44895276-44895298 GGGGAGGGAAGGAGGGAGGGAGG + Intronic
1157220365 18:45825124-45825146 AGGTAGGAAAGGAGGGAGGGAGG + Intergenic
1157411832 18:47469524-47469546 GGGCAGGCAAGAAGGGAGGAAGG - Intergenic
1157612717 18:48968437-48968459 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1158103842 18:53861531-53861553 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1158153112 18:54394441-54394463 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1158321652 18:56270520-56270542 GGGGAGGGAGGGAGGGAGGAGGG + Intergenic
1159139310 18:64373463-64373485 AGGTAGGGACGGAGGGAGGAAGG - Intergenic
1159356104 18:67338409-67338431 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1159512633 18:69416067-69416089 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1160356088 18:78229531-78229553 GGGGAGGAAGGGAGGGAGGAGGG - Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160714640 19:570684-570706 GGGTGGGTGGGGGGGGCGGAGGG + Intergenic
1160758624 19:771638-771660 GGGGAGATAGGGAGGGAGGAGGG - Intergenic
1161141605 19:2651318-2651340 GGGAAGGTAGGGAGGGAGGGAGG - Intronic
1161468630 19:4445598-4445620 GAGAAGGTCAGGAGGGCAGAGGG + Exonic
1161554496 19:4932982-4933004 GGGGAGGAAAGGAGAGAGGAAGG - Intronic
1161756605 19:6138536-6138558 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
1161789434 19:6350154-6350176 GGGAAGGGAAGGAGAGGGGAGGG + Intergenic
1161834456 19:6636377-6636399 GGAGAGGGAAGGAGGGAGGAAGG - Intergenic
1161935264 19:7368004-7368026 AGGGAGGGAGGGAGGGCGGAAGG + Intronic
1162072971 19:8165910-8165932 GGAGAGGGAAGGAGGGAGGAGGG + Intronic
1162338983 19:10080052-10080074 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1162435423 19:10654944-10654966 GGGTAGGGAAGGAGTGAGGAAGG - Intronic
1162533931 19:11252267-11252289 GGGCAGGTAGGGAGGGCTGAGGG + Intronic
1162872749 19:13598656-13598678 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1162877635 19:13632573-13632595 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1163004762 19:14390136-14390158 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1163204898 19:15795197-15795219 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1163566138 19:18052291-18052313 GGGGAGGGGAGGAGGGGGGAGGG + Intergenic
1163738950 19:18998996-18999018 GGGTAGGGAAGGAAGGGGAAAGG + Intronic
1163790359 19:19302661-19302683 GGGTAGGGCAGGAAGGCAGATGG + Intronic
1164025355 19:21346650-21346672 GGGTAGGGAGGGAGGGAGGGAGG + Intergenic
1164392714 19:27839883-27839905 GGGTAGGGGAGGAAGGGGGAGGG - Intergenic
1164441779 19:28284774-28284796 TGGGAGGAAAGGAGGGTGGAAGG + Intergenic
1164443856 19:28300560-28300582 GGGAAGGTTAGGAGGGGGAAAGG + Intergenic
1164667361 19:30050445-30050467 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1165080350 19:33302894-33302916 GGGTAGGGGTGGGGGGCGGAGGG + Intergenic
1165331392 19:35142795-35142817 TGGGAGGGAAGGAGGGAGGAAGG + Intronic
1165385012 19:35505222-35505244 GGGTAGGCAGGGAGGAAGGAGGG + Intronic
1165440650 19:35825107-35825129 GGGGAGGTAAGGGGAGGGGAGGG + Intergenic
1165465889 19:35974574-35974596 GGGAAGCTGAGGAGGGAGGATGG - Intergenic
1166062419 19:40334955-40334977 GGGTAGGGAGGGAGGGAGGGAGG + Intronic
1166674635 19:44732510-44732532 GGGTATGTATGGAAGGAGGATGG + Intergenic
1166707250 19:44914812-44914834 AGGGAGGTAGGGAGGGAGGAGGG + Intronic
1166767844 19:45263084-45263106 GGGGAGGAAAGGAGGAGGGACGG - Intronic
1166948086 19:46409251-46409273 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1167195226 19:48023567-48023589 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1167197612 19:48041517-48041539 GGGCAGGTCAGGTGGGTGGATGG + Intronic
1167303943 19:48696278-48696300 AGGGAGCTAAGGAGGGCGGCTGG - Intronic
1167393615 19:49212640-49212662 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1167396849 19:49235077-49235099 GGGGAGGAAAGGAGAGAGGAAGG + Intergenic
1167476272 19:49703128-49703150 AGGTAGGAAAGGAGGGAGGGAGG - Intronic
1167506012 19:49871509-49871531 GGGGAGGTAGGGAGGGCAGCTGG - Intronic
1167789716 19:51666669-51666691 AGGTAGGAAGGGAGGGAGGAAGG + Intergenic
1168143944 19:54408655-54408677 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1168143956 19:54408678-54408700 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1168296692 19:55380390-55380412 GGGGAGGGGAGGAGGGGGGAAGG - Intronic
1168407171 19:56116747-56116769 GGGCAGGTGAGGTGGGAGGAAGG - Intronic
925222161 2:2150851-2150873 GGGAAGGGAAGGAGGGAAGAAGG + Intronic
926266787 2:11330727-11330749 GGGAAGATGAGGAGGGAGGAGGG + Intronic
926269441 2:11354261-11354283 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
926495040 2:13575842-13575864 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
926700250 2:15798680-15798702 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
926740215 2:16104304-16104326 TGGAAGGAAAGGAGGGTGGAAGG + Intergenic
926762448 2:16290950-16290972 GGGGAGGGAAGAGGGGCGGAAGG - Intergenic
926974020 2:18495364-18495386 AGGGAGGGAGGGAGGGCGGAAGG - Intergenic
927667848 2:25044583-25044605 GGGGAGGTCAGGAGGTGGGAGGG - Intronic
927877882 2:26670826-26670848 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
927964719 2:27262050-27262072 GGGTGGGCAGGGAGGTCGGACGG + Intronic
927981049 2:27375461-27375483 GGGTAGATTAGGAGGGAGAATGG - Intronic
928602381 2:32916072-32916094 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
928602405 2:32916139-32916161 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
929371868 2:41234956-41234978 GGGAAGCTAAGGTGGGTGGATGG + Intergenic
929508304 2:42546096-42546118 GGGAAGGGAAGGAGGGAGGGAGG + Intronic
929617763 2:43325554-43325576 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
929635971 2:43521158-43521180 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
929668504 2:43851973-43851995 GGGTTTGAAAGGAGGGTGGAGGG - Intronic
929680110 2:43985490-43985512 GGGTTCGGAAGGAGGGTGGAAGG - Intronic
930234737 2:48877700-48877722 GGGTGGGTAAGCAGAGAGGAAGG - Intergenic
930352647 2:50277396-50277418 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
930654188 2:53992034-53992056 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
931217622 2:60261275-60261297 GGGTAGATAAGGAGGGGTGTGGG - Intergenic
932071612 2:68626361-68626383 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
932455823 2:71849346-71849368 AGGTCGGAAAGGAGGGCGTAGGG + Intergenic
932693466 2:73933509-73933531 TGGTAGGCAAGGCGGGAGGAGGG + Intronic
932880853 2:75500725-75500747 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
933069269 2:77836811-77836833 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
933069281 2:77836845-77836867 GGAGAGGGAAGGAGGGAGGAAGG + Intergenic
933635883 2:84708482-84708504 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
933775219 2:85767570-85767592 GGGAAGGGAAGGAGAGGGGAGGG - Intronic
933898589 2:86833502-86833524 GGGGAGGGGAGGAGAGCGGAGGG - Intronic
933898605 2:86833542-86833564 GGGGAGGGGAGGAGAGCGGACGG - Intronic
933946241 2:87288536-87288558 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
934561502 2:95315847-95315869 GGGCAGGTCTGGAGGGCGCAGGG - Intronic
934621625 2:95813287-95813309 GGTGATGTAAGGAGGTCGGAGGG - Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
936333974 2:111573047-111573069 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
936673162 2:114683469-114683491 GGGAAGGAAAGGAGGTTGGAAGG - Intronic
937216096 2:120314592-120314614 GGGGAGGGAAGGAGGGCCGGGGG - Intergenic
937224038 2:120357963-120357985 GGGGAGGTAAGCAGGGCCGGGGG - Intergenic
937914707 2:127093106-127093128 GGTCAGGGAGGGAGGGCGGAAGG + Intronic
938228193 2:129635868-129635890 GGGTGGCCATGGAGGGCGGATGG - Intergenic
938482382 2:131672817-131672839 GGGCAGGTAAGGTCGGAGGAGGG + Intergenic
938582821 2:132662576-132662598 AGGAAGGTAGGGAGGGCGGGCGG + Intronic
939733870 2:145819377-145819399 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
940356634 2:152750507-152750529 AGGAAGGGAGGGAGGGCGGAAGG + Intronic
941339305 2:164286966-164286988 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
941513697 2:166445375-166445397 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
941867617 2:170351054-170351076 GGGAAGGCAGGGAGGGAGGAAGG + Intronic
941901845 2:170686358-170686380 GGGGAGGGAAGGAGAGAGGAGGG + Intergenic
942276728 2:174328544-174328566 GGGCAGGGAAGGCGGGCGGGCGG + Intergenic
942362646 2:175188512-175188534 GGGTAGGAGAGAAGGGGGGATGG - Intergenic
942469341 2:176243510-176243532 GGGAAGGGAAGTAGGGAGGATGG - Intergenic
942494837 2:176529188-176529210 GGGTATGGGAGGAGGACGGAGGG - Intergenic
942602411 2:177654823-177654845 TGGGAGGAAAGGAGGGAGGAAGG - Intronic
942629440 2:177939514-177939536 GGGAAGGGAGGGAGGGAGGAAGG + Intronic
943613851 2:190068572-190068594 GGGAAGCTGAGGTGGGCGGATGG - Intronic
943703063 2:191006953-191006975 GGGAAGGCAAGGAGGGGGCAGGG - Intronic
944183784 2:196926289-196926311 GGGGAGGTGAGGGGGGCAGAAGG + Intronic
944408532 2:199413527-199413549 GGGTAGGTAAGGAGCACTGTTGG - Intronic
944897211 2:204177521-204177543 GAGTAGGGAAGGAGGGAGGGAGG - Intergenic
945028955 2:205645805-205645827 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
945056981 2:205877974-205877996 GGGTAGGAAAGTTGGGGGGAAGG - Intergenic
945142384 2:206700420-206700442 GGGAAGGAGAGGAGGGAGGAGGG + Intronic
945588337 2:211695980-211696002 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
945876119 2:215279854-215279876 GGGAAGGGAGGGAGGGAGGAAGG + Intergenic
945951344 2:216041730-216041752 GGGGAGGTAAGAGGGGCTGAAGG + Intronic
946452098 2:219789074-219789096 GGGGAGGGAAGGAGGAAGGAAGG - Intergenic
946519080 2:220446611-220446633 GGGCAGGGAGGGAGGGGGGAAGG - Intergenic
946519093 2:220446634-220446656 GGGGAGGAAGGGAGGGGGGAAGG - Intergenic
946552972 2:220823513-220823535 AGGTAGGGAGGGAGGGAGGAGGG - Intergenic
946686968 2:222280298-222280320 AGGGAGGGAAGGAGGGAGGAGGG + Intronic
946730772 2:222707293-222707315 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
947030009 2:225782870-225782892 GGGAAGGAAAGAAGGGAGGAAGG - Intergenic
947030128 2:225783262-225783284 GGGAAAGGAAGGAGGGAGGAAGG - Intergenic
947077051 2:226355952-226355974 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
948019002 2:234714966-234714988 TGGGAGGTAGGGAGGGCTGAGGG + Intergenic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
948677636 2:239608161-239608183 GGGAAGGAAGGGAGGGAGGAGGG - Intergenic
1168744113 20:221470-221492 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1168918558 20:1511923-1511945 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1169009809 20:2241205-2241227 GGGAAGGAAAGAAGGGAGGAAGG - Intergenic
1169597849 20:7221096-7221118 GGGAAGGGAAGGAGAGGGGAGGG - Intergenic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1170501817 20:16982450-16982472 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1170631749 20:18072333-18072355 AGGGAGGGAAGGAGGGAGGAGGG - Intergenic
1170907045 20:20525756-20525778 TGGTAGGAAAGAGGGGCGGAAGG - Intronic
1170938247 20:20827876-20827898 GGGAAGGGAGGGAGGGAGGAAGG + Intergenic
1172101183 20:32484478-32484500 GGGGCGGGGAGGAGGGCGGAGGG - Intronic
1172245758 20:33443877-33443899 GGGTGGGTCAGAAGGGCGGCGGG + Exonic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173427901 20:42958444-42958466 GAGGAGGAAAGGAGGGGGGAGGG + Intronic
1173440103 20:43068110-43068132 GGGAAGGAAAGAAGGGAGGAAGG + Intronic
1173618652 20:44419692-44419714 GGGTTGGGAGGGAGGGAGGATGG - Intronic
1174062723 20:47843975-47843997 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1174346300 20:49932602-49932624 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1174354926 20:49991135-49991157 GGGAAGGAAAGGAGGGAGGATGG + Intergenic
1174692038 20:52515967-52515989 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1174692077 20:52516074-52516096 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1174799474 20:53550992-53551014 GGGGAGGGAAGGATGGCGGGTGG + Intergenic
1174899931 20:54488742-54488764 GGGTAGGGAAAGAGGGAGGGAGG - Intronic
1175499862 20:59442102-59442124 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1175899462 20:62354338-62354360 GGGTAGGGAGGGAGGGAGGGAGG - Intronic
1176274477 20:64255941-64255963 GGGTGGGGAAGGAGGAGGGAAGG - Intronic
1177109751 21:17010850-17010872 GGGAAGGGAAGAAGGGAGGAAGG + Intergenic
1178170588 21:30035314-30035336 GGGAAGGGAAGGAGAGGGGAGGG - Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178532947 21:33390256-33390278 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178887695 21:36496712-36496734 GGGGAGGAAGGGAGGGAGGAAGG + Intronic
1179090102 21:38256921-38256943 GGATAGGGAAGGAGGGAGGGAGG - Intronic
1179291326 21:40020701-40020723 AGGTAGGTGAGCAGGGCAGAAGG - Intronic
1179296820 21:40070243-40070265 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1179296847 21:40070334-40070356 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1179358372 21:40682763-40682785 GGGGAGGGAAGGAGAGGGGAGGG + Intronic
1180672784 22:17566228-17566250 GGGTAGGTAAGGAGACGGGGAGG - Intronic
1180923820 22:19538278-19538300 GGGGAGGGAAGGAGGAAGGAGGG + Intergenic
1181166218 22:20984601-20984623 GGGCAAGTAAGGAGGGGGGGGGG + Intronic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181552032 22:23645357-23645379 GGGGAGGGAAGGAGGGGGAAGGG - Intergenic
1181747849 22:24968189-24968211 AGGTAGGGAAGGGGGGCGGCGGG + Intronic
1181780865 22:25192229-25192251 GGGGAGGTGAGGAGGGTGGCAGG - Intronic
1181924657 22:26348732-26348754 GGGAAGGGAAGAAGGGAGGAAGG + Intronic
1181969477 22:26679478-26679500 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1182025688 22:27116709-27116731 AGGTAGGAAAGGAGGAAGGATGG + Intergenic
1182050694 22:27310582-27310604 AGGGAGGGAAGGAGGGGGGAGGG + Intergenic
1182050704 22:27310601-27310623 AGGGAGGGAAGGAGGGGGGAGGG + Intergenic
1182050714 22:27310620-27310642 AGGGAGGGAAGGAGGGGGGAGGG + Intergenic
1182217343 22:28730261-28730283 GGGGAGGAAAGGAAAGCGGAAGG + Intronic
1182232502 22:28849459-28849481 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1182249627 22:28989779-28989801 GGGTAGGTGAAGAGGGTGGGTGG - Intronic
1182657733 22:31903517-31903539 GGGTAGGTGTGGAAGGTGGAAGG - Intronic
1182698380 22:32211670-32211692 GGGTAGGTCAGGTGGGGTGATGG - Intergenic
1182708894 22:32308060-32308082 AGGTAGGTAAGAAGGAAGGAAGG - Intergenic
1182709023 22:32308933-32308955 AGGTAGGTAAGAAGGAAGGAAGG - Intergenic
1182962436 22:34488276-34488298 GGGAAGGGAAGGAGGAAGGAAGG - Intergenic
1183042623 22:35193614-35193636 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1183085827 22:35486405-35486427 GTGGAGGTAAGGAGGGGAGAGGG - Intergenic
1183924005 22:41192689-41192711 GGGAAGCTAAGGTGGGAGGATGG + Intergenic
1184026747 22:41863334-41863356 GGAAAGCTAAGGAGGGCAGAAGG - Intronic
1184116341 22:42424857-42424879 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1184303435 22:43577779-43577801 GGGGAGGGAAGGAGTGAGGAGGG - Intronic
1184345424 22:43909944-43909966 GGGAAGGAAAGGAGGGAGGGAGG + Intergenic
1184396545 22:44245307-44245329 AGGTAGGTAAGAAGGAAGGAAGG - Exonic
1184410424 22:44323053-44323075 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184410547 22:44323571-44323593 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184642420 22:45879566-45879588 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1203322946 22_KI270737v1_random:86263-86285 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
949262711 3:2121071-2121093 GGGAAGGAAGGGAGGGAGGAAGG - Intronic
950016989 3:9761358-9761380 GGGAAGGAAGGGAGGGCAGAGGG + Intronic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950958427 3:17079588-17079610 GGGCAGGAAAGGACGGCGGCAGG - Intronic
951800130 3:26586656-26586678 AGGTAGGTGAGGAGGAGGGAAGG - Intergenic
952814900 3:37438697-37438719 GGGAAGGAAAGGAGGGCAGGTGG + Intergenic
952970788 3:38649276-38649298 GGGAAGGGAAGGGGGGCGCACGG + Intronic
953029860 3:39172097-39172119 GGGCAGGGATGGAGGGAGGAGGG + Intergenic
953098850 3:39806648-39806670 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
953176608 3:40559252-40559274 TGGTAGGTAAGGATTGGGGATGG - Intronic
953235382 3:41102031-41102053 GGATAAGTAAAGAGGGTGGAAGG - Intergenic
953357423 3:42266629-42266651 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
953439238 3:42904075-42904097 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
954691195 3:52396576-52396598 GGGGAGGTGAGGAGCGGGGACGG - Intronic
954904686 3:54050479-54050501 GGTTAGGTAGGGAGGAGGGATGG + Intergenic
955349297 3:58182181-58182203 GGGGAGGGGAGGAGGGAGGAGGG + Intergenic
956148341 3:66214886-66214908 GGGAAGCTGAGGTGGGCGGATGG + Intronic
956159672 3:66335899-66335921 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
956470930 3:69566200-69566222 GGCAAGGTGAGGAGGGCAGAAGG - Intergenic
956643442 3:71435378-71435400 GGGAAGGGAAGGAGGGAGGGAGG + Intronic
957293826 3:78310911-78310933 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
957416935 3:79917465-79917487 GGGAAGAGAAGGAGGGAGGAAGG + Intergenic
958070161 3:88599656-88599678 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
959185253 3:103038647-103038669 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
959416237 3:106078986-106079008 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
959963983 3:112333239-112333261 GGCTTGGGAAGGAGGGCGCAGGG + Intronic
960023629 3:112984177-112984199 GGATGGGTAAGGAGGTTGGAGGG + Intergenic
960597147 3:119416496-119416518 GGTTAGGTAAGGGGAGAGGATGG + Exonic
960740941 3:120832768-120832790 GGGGAGGGGAGGAGAGCGGAGGG - Intergenic
960854645 3:122090743-122090765 GGGTAGTGAAGGAGGGAGGAGGG + Intronic
961340106 3:126212209-126212231 GGGAAGGAAAGGAGGGAGAAGGG + Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961660241 3:128464836-128464858 GGGAAGGGAGGGAGGGAGGAGGG - Intronic
961995006 3:131233109-131233131 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
962490867 3:135892974-135892996 GGGAAGGGAGGGAGGGAGGAAGG + Intergenic
962506114 3:136047953-136047975 GGGTAGGGATGGAGGGAGCAAGG + Intronic
962711679 3:138091634-138091656 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
962844179 3:139260651-139260673 GGGTAGGCAGGGAGGGAGGGAGG + Intronic
962979874 3:140478789-140478811 GGGAAGGGAAGAAGGGAGGAAGG + Intronic
964629601 3:158795752-158795774 GGGAGGCCAAGGAGGGCGGATGG - Intronic
966140589 3:176752154-176752176 GGGGAGGGAAGGAGAGGGGAGGG + Intergenic
966273774 3:178141225-178141247 AGGTACGTATGGAGGGTGGAAGG - Intergenic
966273812 3:178141333-178141355 AGGTACGTATGGAGGGTGGAAGG - Intergenic
966311026 3:178594039-178594061 GGGTAGGTAAGGAGGGAGGGAGG - Intronic
966431154 3:179832623-179832645 GGGTAGGTAAGTAAGTAGGAAGG - Intronic
966461506 3:180181717-180181739 AGGGAGGGAAGGAGGGAGGATGG - Intergenic
966902030 3:184493495-184493517 GGGTAGGAAAGGAAGGAGGAAGG + Intronic
967033645 3:185631474-185631496 GGGGAGGGAGGGAGGGGGGAGGG - Exonic
967190117 3:186977590-186977612 AGGCAGCCAAGGAGGGCGGAAGG + Intronic
967360466 3:188624674-188624696 GGGAAGGGAAGGAGGGAGGGAGG - Intronic
967449098 3:189602445-189602467 GGCTAAGAAAGGAGGGAGGAGGG + Intergenic
967882655 3:194312955-194312977 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
967899982 3:194440058-194440080 GGGTAGGGAGGGAGGGAGGTGGG + Intronic
967909268 3:194527833-194527855 GGGAAGGGAAGGAGGAAGGAAGG - Intergenic
967997051 3:195174676-195174698 GGGAAGGGAGGGAGGGGGGAGGG - Intronic
968356049 3:198108153-198108175 GGGTAGGGAGGGAGGGAGGGAGG + Intergenic
968442406 4:630542-630564 GGGAAGCTGAGGAGGGCAGAGGG + Intronic
968686109 4:1959963-1959985 GGGAAGCTAAGGTGGGAGGATGG - Intronic
968889226 4:3359043-3359065 GGGGAGGGGAGGAGGGAGGAGGG - Intronic
968909310 4:3469480-3469502 GGGTGGGTGAGCAGGGCCGATGG + Intronic
968991662 4:3917385-3917407 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
969051359 4:4375496-4375518 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969467286 4:7365304-7365326 GGGGAGTTCAGGAGGGCGCAAGG + Intronic
969481570 4:7449282-7449304 GGGGAGGAAGGGAGGGAGGAAGG - Intronic
969504291 4:7574598-7574620 AGGGAGGCAAGGAGGGAGGAAGG + Intronic
969535608 4:7754746-7754768 GGGCAGGTGTGGAGGGTGGAAGG + Intergenic
969823703 4:9740216-9740238 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
970396917 4:15677673-15677695 GGGAAGGTATGGAGGACAGAGGG - Intronic
970539972 4:17067862-17067884 GGGTAGGGAATGAGGGAGGTAGG - Intergenic
970689990 4:18611668-18611690 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690068 4:18611890-18611912 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690154 4:18612128-18612150 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690240 4:18612366-18612388 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970728496 4:19075422-19075444 AGGAAGGAAAGGAGGGAGGAGGG + Intergenic
970932668 4:21531320-21531342 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
971394422 4:26215164-26215186 GGATAGGGAAGGAGGAAGGAAGG + Intronic
971563085 4:28106215-28106237 GGGAAGGGAGGGAGGGAGGAAGG + Intergenic
971563103 4:28106268-28106290 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
972579910 4:40385966-40385988 GGGGAGGGAAGGAGAGGGGAGGG + Intergenic
972579916 4:40385981-40386003 GGGGAGGGAAGGAGAGGGGAGGG + Intergenic
973851469 4:54965465-54965487 GGTTAGGTCATGAGGGTGGAGGG + Intergenic
974333583 4:60510496-60510518 GGGAAGGAAAGGAGGGAGGAAGG + Intergenic
974333598 4:60510539-60510561 GGGAAGGAAAGGAGGGAGGAAGG + Intergenic
974374814 4:61062252-61062274 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
975470679 4:74762573-74762595 AGGAAGGAAAGGAGGGCTGAAGG + Intronic
975905323 4:79204522-79204544 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
976245516 4:83002446-83002468 GGGGAGGGAAGGAGGAAGGAGGG + Intronic
976476684 4:85492083-85492105 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
976616788 4:87086409-87086431 GGGAAGGGAAGGAGGACGGATGG - Intronic
976753876 4:88477580-88477602 GGGAAGGGAAGGAGGAGGGAGGG + Intronic
976890808 4:90045230-90045252 GGGTTGGTAGGAAGGGCAGAAGG - Intergenic
977290563 4:95160602-95160624 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
977416876 4:96744202-96744224 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
977807885 4:101324139-101324161 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
979506456 4:121502741-121502763 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979506466 4:121502765-121502787 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979563317 4:122124602-122124624 AGGGAGGTATGGAGGGTGGAGGG - Intergenic
979687257 4:123524529-123524551 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
979698513 4:123640848-123640870 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980038684 4:127914275-127914297 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
981205595 4:142035882-142035904 GGGTAGGTAGGGAGAGGGGCAGG + Intronic
981413335 4:144458747-144458769 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
981413343 4:144458767-144458789 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
981611918 4:146602236-146602258 TGGAAGGGAAGGAGGGTGGAAGG - Intergenic
982967338 4:161929107-161929129 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
983503136 4:168523245-168523267 GGGAGGGTAAGGAAGGAGGAAGG + Intronic
983927924 4:173421781-173421803 GGGCAGGTAGGGTGGGAGGATGG + Intergenic
984703091 4:182831254-182831276 GGTTAGGTATGAAGGGGGGAAGG + Intergenic
984831251 4:183976556-183976578 GGGGAGGGAGGGAGGGAGGAGGG + Intronic
985095594 4:186409507-186409529 GGGGAGGAAATGAGGGAGGAGGG + Intergenic
985733139 5:1562813-1562835 GCTTAGGTCATGAGGGCGGAGGG - Intergenic
985957774 5:3277458-3277480 GGGTAGGAAATGAGGGTGGAGGG + Intergenic
986078467 5:4363280-4363302 GGGGAGGGAGGGAGGGAGGAGGG - Intergenic
986490746 5:8286981-8287003 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
986834176 5:11616554-11616576 GGGAAGGGAAGGAGGGAGGGAGG - Intronic
987050331 5:14143319-14143341 GGGGAAGGAAGGAGGGGGGAGGG - Intergenic
987361512 5:17111533-17111555 AGGGAGGGAAGGAGGGGGGAGGG - Intronic
988898335 5:35702359-35702381 GGGGATGTAAGGAGGGGGAATGG + Intronic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989697719 5:44223161-44223183 GGGGAGGGAGGGAGGGAGGAGGG + Intergenic
989969917 5:50511299-50511321 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
990334110 5:54755658-54755680 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
990446155 5:55896514-55896536 GGGAAGGGAAGGAGGATGGAAGG - Intronic
990485638 5:56257284-56257306 GGGGAGGAAGGGAGGGAGGAGGG - Intergenic
990762312 5:59143157-59143179 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
991518927 5:67472496-67472518 AGGGAGGGAAGGAGGGTGGAAGG - Intergenic
991921581 5:71662779-71662801 GGCTAGGGAAGGTGGGCCGAGGG + Intergenic
991971247 5:72143789-72143811 GGGAGGCTAAGGAGGGAGGATGG - Intronic
992087143 5:73288034-73288056 GGGGAGCTAAGGTGGGAGGATGG + Intergenic
992792775 5:80228257-80228279 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
992895413 5:81240912-81240934 TGGTATTTAAGGAGGGCTGAGGG + Intronic
993322629 5:86492114-86492136 AGGAAGGAAAGGAGGGAGGACGG - Intergenic
994198854 5:96949907-96949929 AGGGAGGGAAGGAGGACGGAAGG - Intronic
995324518 5:110875315-110875337 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
995499561 5:112789962-112789984 GGGAAGCTGAGGAGGGAGGATGG - Intronic
995717939 5:115098715-115098737 TGGTAGGGAATGAGGGAGGATGG + Intergenic
995814985 5:116158117-116158139 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
995868369 5:116717339-116717361 AGTTAGGGAAGGAGGGAGGAAGG - Intergenic
995878786 5:116820986-116821008 GGGTAGGTAGGGTGGTGGGATGG - Intergenic
996731186 5:126718768-126718790 GGGCAGGAAAGGATGGAGGAGGG + Intergenic
996871857 5:128201204-128201226 GGGGAGGGAAGGAGGGAGGGAGG - Intergenic
997013355 5:129904426-129904448 GGCTCGGGAAGGAGGGAGGAGGG + Intergenic
998352014 5:141508102-141508124 GGGTAGGTTAAGAGGACAGAGGG + Intronic
999184757 5:149698825-149698847 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
999751670 5:154632231-154632253 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
999751681 5:154632259-154632281 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
999768631 5:154757861-154757883 GGGAAGGGGAGGAGGGGGGAAGG - Intronic
999768648 5:154757893-154757915 GGGAAGGGGAGGAGGGGGGAAGG - Intronic
1000132064 5:158309911-158309933 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
1000132088 5:158309968-158309990 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
1000132109 5:158310025-158310047 GGGAAGGAAAGGAGGGAGGGAGG - Intergenic
1000132171 5:158310174-158310196 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
1000900118 5:166902519-166902541 GGGTAGGTGAGGAGGAGGAAAGG + Intergenic
1000997523 5:167974101-167974123 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997575 5:167974255-167974277 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997591 5:167974308-167974330 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1001301487 5:170536853-170536875 GGGCAGGAAAGGAGGGAGGCAGG + Intronic
1001312122 5:170618529-170618551 AGGGAGGAAAGGAGGGAGGAGGG + Intronic
1001490908 5:172154471-172154493 GGGTAGATAAAGAGGGGGAAAGG - Intronic
1001896325 5:175384994-175385016 GGGGAGGGAAGGAGAGAGGAAGG + Intergenic
1002490032 5:179569234-179569256 GGGTGGGGAAGGAGTGGGGATGG + Intronic
1002539025 5:179893912-179893934 AGGGAGGCAAGGAGGGAGGAGGG + Intronic
1002700746 5:181122753-181122775 GGGAGGCTAAGGAGGGAGGACGG - Intergenic
1002917660 6:1542026-1542048 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1002917709 6:1542170-1542192 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1002917717 6:1542190-1542212 GGGGAGGGAAGGAGGGAGGCAGG + Intergenic
1002917724 6:1542206-1542228 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
1002924496 6:1597217-1597239 GGGCTGGTAAGGAGGGTTGAGGG - Intergenic
1002963401 6:1938938-1938960 GGGGAGGAAAGAAGGGAGGAAGG - Intronic
1003226077 6:4207148-4207170 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1003812222 6:9796891-9796913 GGGAAGGTAAGGGGAGGGGAGGG + Intronic
1003812241 6:9796933-9796955 GGGAAGGGAGGGAGGGAGGATGG + Intronic
1004015449 6:11727972-11727994 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1004131172 6:12921519-12921541 GGGGAGGGAGGGAGGGAGGAGGG + Intronic
1004239596 6:13907996-13908018 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1004303435 6:14478645-14478667 GGGTAGGGGAGGAGAGGGGAAGG + Intergenic
1004494709 6:16152818-16152840 AGGTAGGGAAGGTGGGTGGAAGG + Intergenic
1004561818 6:16760069-16760091 GGGCAGGGAAGGGGGCCGGACGG - Intronic
1004697338 6:18045835-18045857 GGGAAGGAAGGGAGGGGGGAAGG - Intergenic
1004752838 6:18581579-18581601 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1004761119 6:18667655-18667677 AGGAAGGTAGGGAGGGAGGAAGG - Intergenic
1004771354 6:18786126-18786148 GGGAAGGTAAGGGGAGGGGAGGG - Intergenic
1004934857 6:20497169-20497191 GGGGAGGGAAGGAGGGAGGGAGG + Intergenic
1005024388 6:21448756-21448778 GGGTAGGGATGGAGGGTGGGAGG - Intergenic
1005319835 6:24642140-24642162 GGGGAGGGAAGGAGGGAGGGAGG + Intronic
1005361360 6:25034319-25034341 GGGTAGGGTAGGAGGGGGTAAGG + Intronic
1006151602 6:31992955-31992977 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006157903 6:32025693-32025715 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006308811 6:33242619-33242641 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1006452473 6:34113114-34113136 GGGAAGGGAAGGAGGAAGGAAGG - Intronic
1007079901 6:39092579-39092601 GGGTAGGGAAGGAGGGAAAAAGG - Intergenic
1007375930 6:41456751-41456773 GGGGAGGAAAGAAGGGAGGAAGG - Intergenic
1007741066 6:44009691-44009713 AGGAAGGGAGGGAGGGCGGAGGG + Intergenic
1008286206 6:49654104-49654126 GGGAAGGGAAGGGGAGCGGAGGG - Intergenic
1008386933 6:50902432-50902454 GGAAAGGGAAGGAGGGAGGAAGG + Intergenic
1008394841 6:50994329-50994351 GGGTAGGGAAGGAGGAAGGGTGG + Intergenic
1008418612 6:51271717-51271739 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1010331632 6:74629963-74629985 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1010484786 6:76397100-76397122 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1010749039 6:79597376-79597398 GGGAAGGGAAGGAAGGAGGAAGG + Intergenic
1011841196 6:91501085-91501107 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1012111628 6:95242154-95242176 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1012639163 6:101587432-101587454 AGGTAGGTAAGTAGGTAGGAAGG - Intronic
1012734158 6:102917948-102917970 GGGAAAGGAAGGAGGGAGGAGGG - Intergenic
1012872842 6:104692139-104692161 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1013537325 6:111075134-111075156 GGGTAGGTGAGAAGGAGGGAAGG + Intergenic
1013599952 6:111694289-111694311 GGGAAGGGAAGGAGGAAGGAAGG + Intronic
1014248626 6:119093981-119094003 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1014381170 6:120744144-120744166 GGGAAGGTAGGGAGGAAGGAAGG - Intergenic
1014416375 6:121190146-121190168 GGAGAGGTAAGGAGGGTGGTGGG - Intronic
1015631520 6:135236533-135236555 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1015805809 6:137107270-137107292 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1015890499 6:137965354-137965376 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1016091573 6:139985662-139985684 GGGAAGGTAGGAAGGGAGGAAGG - Intergenic
1016421743 6:143892260-143892282 GGGAAGGGAAGGAGGTGGGAAGG + Intronic
1016449492 6:144166863-144166885 GGGAAGGGAAGGAGAGGGGAGGG - Intronic
1016534229 6:145092684-145092706 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1016902418 6:149115495-149115517 GAGTAGGTCAGGAAGGAGGAAGG + Intergenic
1017041111 6:150309213-150309235 AGGGAGGTAGGGAGGGAGGAAGG + Intergenic
1017245840 6:152223635-152223657 GGGGAGGGAAGGAGAGGGGAAGG + Intronic
1017334066 6:153234493-153234515 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1017720622 6:157240913-157240935 GGGGAGGGAGGGAGGGAGGAGGG + Intergenic
1017876479 6:158529150-158529172 GGAAAGGAAAGGAGAGCGGAAGG - Intergenic
1017931904 6:158963387-158963409 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1017994875 6:159523221-159523243 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1018050753 6:160006003-160006025 GGGGAGGTATGGGGCGCGGAGGG - Intronic
1018232729 6:161691021-161691043 GGAAAGGAAAGGAGGACGGATGG - Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1018509162 6:164506334-164506356 GGGAAGGGAAGGAGAGGGGAGGG - Intergenic
1018614001 6:165668796-165668818 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
1019147058 6:169982259-169982281 GGGAAGGAAAGGAGGGAGGGGGG + Intergenic
1019157144 6:170046727-170046749 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1019313494 7:374121-374143 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1019335009 7:478780-478802 GGGAAGGGAAGGAGGAGGGAAGG + Intergenic
1019335045 7:478883-478905 GGGAAGGGAAGGAGGAGGGAAGG + Intergenic
1019335067 7:478946-478968 GGGAAGGGAAGGAGGAGGGAAGG + Intergenic
1019335103 7:479049-479071 GGGAAGGGAAGGAGGAGGGAAGG + Intergenic
1019335139 7:479152-479174 GGGAAGGGAAGGAGGAGGGAAGG + Intergenic
1019335161 7:479215-479237 GGGAAGGGAAGGAGGAGGGAAGG + Intergenic
1019335176 7:479257-479279 GGGAAGGGAAGGAGGAGGGAAGG + Intergenic
1019422826 7:958950-958972 GGGGAGGAAAGGATGGGGGATGG - Intronic
1019830296 7:3321737-3321759 GGGAGGGGAAGGAGGGGGGAGGG - Intronic
1019947705 7:4343104-4343126 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
1020128913 7:5548785-5548807 AGGAAGGGAAGGAGGGAGGAGGG + Intronic
1020369597 7:7417504-7417526 GGGGAGGGAAGGAGGGAGGGGGG + Intronic
1020412231 7:7905301-7905323 GGATAGGGAAGGAGGGGAGAGGG + Intronic
1020877252 7:13713488-13713510 GGGAAGGGAAGGAAGGGGGAAGG + Intergenic
1020877259 7:13713504-13713526 GGGAAGGGAAGGAAGGGGGAAGG + Intergenic
1021329944 7:19324020-19324042 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1021352280 7:19609903-19609925 AGGAAGGTCAGGAGGGAGGAAGG - Intergenic
1021868432 7:24980405-24980427 GGATGGGTTGGGAGGGCGGAGGG + Intronic
1022109236 7:27218185-27218207 AGGTAGGTAAGGAGGGAGGGAGG - Intergenic
1022194232 7:28049004-28049026 GGGAAGGGAGGGAGGGAGGAAGG - Intronic
1022522844 7:31019148-31019170 GGGTAGGGCAGGAGGGAGGTGGG + Intergenic
1022541789 7:31144413-31144435 AGGGAGGTAGGGAGGGAGGAAGG - Intergenic
1022813649 7:33893469-33893491 GGGTAGGTATGGAGGCTAGAAGG - Intergenic
1022993886 7:35733974-35733996 GGATGGGTAAGAAGGGGGGAAGG + Intergenic
1023011196 7:35926046-35926068 GGGGAGGGAGGGAGGGAGGAGGG + Intergenic
1023505870 7:40899220-40899242 AGGGAGGGAAGGAGGGCGGGCGG - Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024079932 7:45847804-45847826 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1024439775 7:49403746-49403768 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1024471288 7:49770781-49770803 GGGAAGGGAAGGAGAGAGGAAGG + Intergenic
1025321609 7:58100280-58100302 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1025948593 7:66124519-66124541 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1026179784 7:68028785-68028807 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1026277752 7:68895041-68895063 GGGTAGGGAAGGAGGAGAGAGGG - Intergenic
1026288553 7:68985503-68985525 GGGAAGTCAAGGAGGGAGGATGG - Intergenic
1026464853 7:70645218-70645240 GGGGAGGTTGGGAGGGCTGAGGG - Intronic
1026471265 7:70695204-70695226 GGGGAGGAAAGAAGGGAGGAGGG - Intronic
1026492149 7:70872200-70872222 GGGAAGGGAGGGAGGGTGGAAGG + Intergenic
1026662831 7:72317190-72317212 GGGGAGGGAAGGAGGGAGGGAGG + Intronic
1026670573 7:72387239-72387261 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
1026677205 7:72437895-72437917 GGGAAGGGAAGGAGGGAGGGAGG - Intronic
1027352702 7:77327828-77327850 GGATAGGTTAGGAGCGGGGATGG - Intronic
1029607808 7:101609611-101609633 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1030377799 7:108773668-108773690 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
1031051505 7:116950344-116950366 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
1031929867 7:127674125-127674147 GGGCAGGAAGGGAGGGAGGAAGG - Intronic
1031929874 7:127674145-127674167 GGGGACGGAAGGAGGGAGGAGGG - Intronic
1031976313 7:128095694-128095716 GGGGAGTTTAGGAGGGAGGAAGG + Intergenic
1032097673 7:128947586-128947608 GGATTGGCAAGGAGGGTGGAGGG + Intronic
1032165622 7:129542593-129542615 GGGAAGCTGAGGCGGGCGGATGG - Intergenic
1032167989 7:129560725-129560747 GGGTAGGCAAGGAGTGGGGAAGG - Intergenic
1032184231 7:129709967-129709989 GGGAGGCTGAGGAGGGCGGATGG - Intronic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032364100 7:131283318-131283340 GGGAAGGGAAGGAGGGAGGGAGG - Intronic
1032996124 7:137448580-137448602 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1032996138 7:137448616-137448638 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1032996152 7:137448652-137448674 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1032996166 7:137448688-137448710 GGGAAGGAAGGGAGGGAGGAAGG + Intronic
1033286335 7:140043769-140043791 GGGAGGCTGAGGAGGGCGGATGG - Intronic
1033478659 7:141716358-141716380 GGGTAGGGAAGAAGGGAGGAGGG - Intronic
1033537299 7:142323881-142323903 GGCCAGGAAGGGAGGGCGGAAGG + Intergenic
1033825732 7:145187052-145187074 GGGGAGGGAAGGAGAGGGGAGGG - Intergenic
1033892018 7:146025133-146025155 AGGGAGGGAAGGAGGGTGGAAGG - Intergenic
1034030903 7:147762726-147762748 GGGGAGGGAGGGAGGGAGGAAGG + Intronic
1034065893 7:148136120-148136142 GGGAAGGGAGGGAGGGAGGAAGG + Intronic
1034415682 7:150963213-150963235 GGACAGACAAGGAGGGCGGAGGG + Intronic
1034480567 7:151317220-151317242 GTGGGGGTAAGGAGGTCGGATGG + Intergenic
1034492515 7:151401400-151401422 GGGAAGGAGAGGAGGGAGGAAGG - Intronic
1034605325 7:152307371-152307393 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1035143317 7:156786202-156786224 GGGAAGGGAAGGAAGGAGGAAGG + Intronic
1035167174 7:156998712-156998734 GGGTAGGTAGGGAGGGTTAATGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414063 7:158668175-158668197 GGGTCGGTAAGGAAGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414134 7:158668379-158668401 TAATAGGTAAGGAGGGCGGAGGG - Intronic
1035531010 8:350840-350862 AGGTAGGTAAGTAGGTAGGAGGG + Intergenic
1035776256 8:2191160-2191182 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1035992730 8:4510655-4510677 GGGAAGGAAAGGAAGACGGAAGG - Intronic
1036089924 8:5654426-5654448 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1036822463 8:11951803-11951825 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1036989728 8:13578907-13578929 GGGGAGGGGAGTAGGGCGGAAGG - Intergenic
1037667325 8:20981217-20981239 GGGGAGGGAAGAAGGGCTGAAGG + Intergenic
1037680531 8:21093556-21093578 AGGAAGGAAGGGAGGGCGGAAGG + Intergenic
1037867413 8:22457032-22457054 GGGAAGGAAGGGAGGGAGGAAGG - Intronic
1037907907 8:22726271-22726293 GCTTAGGTATGGAGGGCAGATGG + Intronic
1037996038 8:23352977-23352999 GGATAGGTAAGGAAGGAGGTGGG + Intronic
1038001591 8:23396376-23396398 GGGAAGGGAAGGAGGGAGGAAGG + Intronic
1038012456 8:23486026-23486048 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1038046372 8:23768794-23768816 GGGAAGGGAAGGAGGGAGGGAGG - Intergenic
1038070314 8:24006184-24006206 GGGAAGGAAAGGAGGGAGGGAGG - Intergenic
1038150399 8:24938258-24938280 AGATAGGGAAGGAGGGCAGAAGG + Intergenic
1038156975 8:25000406-25000428 GGGGAGGGAGGGAGGGAGGAAGG + Intergenic
1038296052 8:26291721-26291743 GGGGGGGTAGAGAGGGCGGATGG - Intronic
1038425291 8:27460663-27460685 GGGGAGGGAAGGAGGGGTGAAGG + Exonic
1038491963 8:27977767-27977789 AATTAGGTAAGGAGGCCGGAAGG - Intronic
1039028677 8:33285973-33285995 GGGAAGGAAAGGAGGAAGGAAGG + Intergenic
1039352970 8:36782361-36782383 AGGGAGGTAGGGAGGGAGGAAGG - Intergenic
1039493554 8:37965244-37965266 GGGTAGGTAACCGGGGCAGAGGG - Exonic
1040681894 8:49820714-49820736 GGGGAGGGAAGGAGAGGGGAGGG + Intergenic
1041126884 8:54650676-54650698 GGGGAGGGGAGGAGGGAGGAGGG - Intergenic
1041135892 8:54758471-54758493 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG + Intergenic
1041203448 8:55473874-55473896 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1041212146 8:55563371-55563393 GTGTAGGTAAGGTGAGAGGAGGG + Intergenic
1041444184 8:57931899-57931921 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041690336 8:60680247-60680269 GGAGAGGAAAGGAGGGCGGTGGG + Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042732238 8:71948797-71948819 GGGGAGGGAAGGAAGGAGGAAGG + Intronic
1042828641 8:73003443-73003465 GGGAAGGAAAGGAGGGAGGGAGG + Intergenic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043667436 8:82833709-82833731 GGGAGGCTAAGGAGGGAGGATGG + Intergenic
1044253199 8:90028688-90028710 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1044590864 8:93913528-93913550 AGGTAGGGAAGGAGAGAGGAAGG - Intronic
1045412066 8:101929500-101929522 GGGAAGGGAAGGAGGGAGGGGGG + Intronic
1045544713 8:103118223-103118245 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1045936128 8:107681568-107681590 GGGAAGGGAAGGAGGGGGCAAGG - Intergenic
1046157217 8:110308419-110308441 GGGGAGGCAAAGAGGGAGGATGG + Intergenic
1046774760 8:118152439-118152461 AGGTAGGGAGGGAGGGAGGAAGG - Intergenic
1046941810 8:119938836-119938858 GGGGAGGGAGGGAGGGAGGAAGG - Intronic
1047081556 8:121467352-121467374 GGGTAGGTAACTAGGCTGGATGG + Intergenic
1047130124 8:122009413-122009435 AGGAAGGTAAGGAGGGAGGGAGG - Intergenic
1047240787 8:123086190-123086212 GGTGTGGTAAGGAGGGAGGAGGG - Intronic
1047537934 8:125736515-125736537 GGGAAGGTAGGGTGGGAGGAGGG - Intergenic
1047700091 8:127440885-127440907 GGGTAGGGAAGGAGGGAGCATGG + Intergenic
1047942147 8:129836543-129836565 GGGATGGCAAGGAGGGAGGAGGG + Intergenic
1047953665 8:129956812-129956834 GGGGAGGGAGGGAGGGAGGAGGG - Intronic
1048754812 8:137727189-137727211 GGGGAGGGAAGGAGAGGGGAGGG + Intergenic
1048904108 8:139070724-139070746 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1049408737 8:142463177-142463199 GGGGAGGGATGGAGGGGGGATGG - Intronic
1049429129 8:142551055-142551077 GGGTAGGCAGGGAGGGTGCAGGG + Intergenic
1049445687 8:142630319-142630341 GGGTAGGTAAGATGGGTAGATGG - Intergenic
1049707405 8:144049259-144049281 GGGTGGCTGAGGAGGGCGGCGGG + Intergenic
1050204017 9:3178607-3178629 GGGAAGCTGAGGAGGGAGGATGG + Intergenic
1051165046 9:14252940-14252962 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1051440246 9:17075477-17075499 AGGGAGGGAAGGAGGGGGGAAGG - Intergenic
1052174637 9:25443609-25443631 GGGAAGGAAGGGAGGGAGGAAGG - Intergenic
1052346225 9:27412541-27412563 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1053095973 9:35328659-35328681 GGGAAGGAAGGGAGGGAGGAAGG - Intronic
1053130157 9:35610044-35610066 GGGTGGGGGAGGAGGGCGCACGG - Exonic
1053301233 9:36951102-36951124 GGGTAGGGAAGTAGGGTGGTAGG + Intronic
1053337319 9:37286988-37287010 AGGGAGGGAAGGAGGGGGGAGGG - Intronic
1055007654 9:71526941-71526963 GGGGAGGGAAGGAGGATGGAGGG - Intergenic
1055028932 9:71752481-71752503 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
1055103883 9:72492854-72492876 AGGAAGGTAGGGAGGGAGGAAGG - Intergenic
1055505817 9:76948047-76948069 GGCTGGGGAAGGAGGGTGGATGG - Intergenic
1056965190 9:91159467-91159489 GAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1057173725 9:92978788-92978810 GGGAAGGGAAGGAGAGGGGAGGG - Intronic
1057298783 9:93864709-93864731 GGGTAGAAAAGGAAGGAGGAGGG - Intergenic
1057479511 9:95433776-95433798 GGGAAGGGAAGGAGGGAGGGTGG - Intergenic
1057519769 9:95751741-95751763 CGGGAGGTAGGGAGGGAGGAAGG + Intergenic
1057835937 9:98445354-98445376 GGGTAGGTAAGGAGGACCATTGG + Intronic
1058227454 9:102383094-102383116 GGGTGGGGGAGGAGGGGGGAGGG - Intergenic
1058663637 9:107289075-107289097 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1058909334 9:109506547-109506569 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1058936599 9:109775154-109775176 GGGTAGATAAGGAGAGTGTACGG - Intronic
1059083792 9:111277762-111277784 GGGTAGGGAAGGAGGACTCAAGG + Intergenic
1059241141 9:112806719-112806741 AGGTAAGTAAGAAGGGCTGAGGG - Intronic
1059534577 9:115069574-115069596 GGGAAGGAAAGAAGGGAGGAGGG - Intronic
1059638196 9:116191019-116191041 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1060023579 9:120152395-120152417 GGTTAGCCAGGGAGGGCGGAAGG - Intergenic
1060045805 9:120339178-120339200 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1060082600 9:120665158-120665180 GGGTAGGTGAGAAGGAAGGATGG - Intronic
1060332469 9:122685843-122685865 GGTGAGGGAAGGAGAGCGGATGG - Intergenic
1060967657 9:127720841-127720863 GGGAAGGGGAGGAGGGAGGAAGG - Intronic
1061060270 9:128246743-128246765 AGGGAGGAAAGGAGGGAGGATGG - Intronic
1061255826 9:129453834-129453856 GGGTATGGAAGGATGGGGGATGG + Intergenic
1061523548 9:131138222-131138244 GGGGAGGGGAGGAGAGCGGAGGG - Intronic
1061534155 9:131237311-131237333 TGGGAGCCAAGGAGGGCGGATGG - Intergenic
1061682552 9:132250150-132250172 GGGTAGGGGATGAGGGCAGAGGG + Intergenic
1062050519 9:134444440-134444462 GGGGAAGGAAGGAGGGGGGAAGG - Intergenic
1062144069 9:134979127-134979149 GGGGAGGGAAGGAAGGAGGAAGG + Intergenic
1062201707 9:135306224-135306246 GGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1062328238 9:136023039-136023061 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1185698384 X:2213158-2213180 GGGAAGGGAAGGAGGAAGGAAGG + Intergenic
1185698404 X:2213228-2213250 GGGAAGGGAAGGAGGAAGGAAGG + Intergenic
1185698568 X:2213795-2213817 GGGAAGGGAAGGAGGAAGGAAGG + Intergenic
1185700575 X:2227908-2227930 GGGAAGGGAGGGAGGGAGGAAGG + Intronic
1185700656 X:2228083-2228105 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1185820229 X:3195942-3195964 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1185999222 X:4989354-4989376 GGGGAGGTAGGGAGGAAGGAAGG - Intergenic
1186156591 X:6732601-6732623 GGGAAGGGAAGGAGGGAGGGAGG + Intergenic
1186473953 X:9842815-9842837 GGGGAGGGAAGGAGGAGGGAGGG - Intronic
1186490018 X:9964217-9964239 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1186654522 X:11598488-11598510 GGGGAGGAAAGGAGGGGGTATGG - Intronic
1187068172 X:15861451-15861473 GGGGAGGGAAGGAGGGAAGAAGG - Intergenic
1187444050 X:19344978-19345000 GTGTAGGTAAGGGGAGGGGAGGG - Intronic
1187783537 X:22857336-22857358 GGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1188052058 X:25499756-25499778 AGGTAGGTAAGGAGGTAGGTAGG - Intergenic
1188489659 X:30723816-30723838 GGGAGGGTGAGGAGGGAGGATGG - Intronic
1188607856 X:32054842-32054864 GGGAAGGGAAGGAGAGGGGAGGG + Intronic
1188699190 X:33237180-33237202 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1188958430 X:36462168-36462190 GGGAAGGAAGGGAGGGAGGAAGG + Intergenic
1189425265 X:40894901-40894923 GGGTAGTCAAGGAAGGTGGAAGG + Intergenic
1189935551 X:46064867-46064889 GGGGAGGGAAGAAGGGCTGAAGG - Intergenic
1190333334 X:49248757-49248779 GGGTAGCTTAGGAGGGTGGGGGG + Intronic
1190682696 X:52841638-52841660 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1190708685 X:53050073-53050095 GGGGAGGTGGGGAGGGTGGAAGG - Intronic
1190712169 X:53078978-53079000 GTGTAGGTAAGGGTGGGGGAAGG - Exonic
1190753234 X:53380272-53380294 GGGCAGGTATGTAGGGAGGAGGG - Intronic
1190862502 X:54358041-54358063 GGGTAGGAGAGAGGGGCGGAGGG + Intronic
1192806104 X:74510810-74510832 GGGAGGCTAAGGAGGGAGGACGG + Intronic
1195210798 X:102651383-102651405 GTGTCGGGAAGGGGGGCGGAGGG - Exonic
1195216947 X:102712348-102712370 GTGTCGGGAAGGGGGGCGGAGGG - Exonic
1195221089 X:102745960-102745982 GTGTCGGGAAGGGGGGCGGAGGG - Intronic
1195534154 X:105992057-105992079 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1195596085 X:106691518-106691540 GGGAAGGGAAGGAGGAGGGAGGG - Intergenic
1195654705 X:107323786-107323808 GGGGAGGTAGGGAGGGTGGGCGG - Intergenic
1195684084 X:107570162-107570184 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1196939447 X:120761027-120761049 GGGAAGGGAAGGAGAGAGGAGGG - Intergenic
1197437153 X:126445270-126445292 GGGAAGGTTAGGAGGAGGGAGGG - Intergenic
1197507524 X:127325497-127325519 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1198229190 X:134673333-134673355 GGGAAGGGAAGGAGGGAGGGAGG + Intronic
1198321281 X:135521189-135521211 GCGTAGGAAAGGAGGGGGGAGGG - Intronic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1198870866 X:141176462-141176484 GGGTAGGTAAGGGGACCGGAGGG + Exonic
1199784301 X:151090643-151090665 GGGTAGATTAGGAGTGGGGAGGG + Intergenic
1200238051 X:154478652-154478674 GAGAAGGAAAGGAGGGCGGGCGG - Intronic
1200243167 X:154508243-154508265 GAGCAGGGAAGGAGGGCGGCAGG + Intronic
1200817464 Y:7548377-7548399 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1201698498 Y:16854170-16854192 GGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1201741096 Y:17325431-17325453 GGGGAGGGAAGAAGGGAGGAGGG + Intergenic
1201741117 Y:17325505-17325527 GGGAAGGGAGGGAGGGAGGAGGG + Intergenic