ID: 1035414034

View in Genome Browser
Species Human (GRCh38)
Location 7:158668090-158668112
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 9, 1: 6, 2: 2, 3: 29, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035414034_1035414047 11 Left 1035414034 7:158668090-158668112 CCCTCCGCCCTCCTTACCCACTA 0: 9
1: 6
2: 2
3: 29
4: 277
Right 1035414047 7:158668124-158668146 CGCCCTCCTTACCTACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035414034 Original CRISPR TAGTGGGTAAGGAGGGCGGA GGG (reversed) Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
906196392 1:43933137-43933159 AAGTGGGTACTGAGGGCTGAAGG - Intergenic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907623019 1:56001302-56001324 AAGTGGGTAAGAAGGAAGGAAGG + Intergenic
907922844 1:58929522-58929544 GAGAGCATAAGGAGGGCGGAGGG - Intergenic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915262211 1:154685136-154685158 TAGCGGGTTAGGTGGGCAGAAGG + Intergenic
915703276 1:157818503-157818525 TAGTGGGGAAGGAGGAATGAGGG + Intronic
916959915 1:169878937-169878959 TAGTGGGTAGGGAGGAAGGTAGG - Intronic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921433425 1:215089047-215089069 TAGTGTGTAAACAGGGAGGAAGG + Intronic
921964698 1:221075965-221075987 TAGTGAGAAAGGAGGGCTGGAGG - Intergenic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063964434 10:11335669-11335691 TAGTGGGAAAGGATGGCTAAGGG + Exonic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1071676656 10:87661170-87661192 AAGTGGGGAAGGAGTGTGGAGGG + Intronic
1076000410 10:126908325-126908347 GAGTTGGTAAGGATGGTGGAGGG - Intronic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1076722851 10:132400309-132400331 GAGTGGGTAAGGAGGGTGTGGGG + Intronic
1077347503 11:2070666-2070688 TAGTGGGACAGGATGGTGGAGGG - Intergenic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1083737326 11:64688865-64688887 TCGAGAGTAGGGAGGGCGGAGGG - Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1087786223 11:102357247-102357269 GAGGGAGTAAGGAGGGAGGAGGG - Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088692159 11:112337406-112337428 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098280083 12:68853815-68853837 GAGAGGGAAAGGAGGGAGGAAGG + Exonic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1104071934 12:125353406-125353428 TAGAGGAAAAGGAGGGCAGATGG + Intronic
1104191078 12:126482445-126482467 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1104500025 12:129276131-129276153 TAGGGGTTAGGGAGGGTGGAGGG - Intronic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105865869 13:24458712-24458734 TAGTGAGTTAGGTGGGTGGAGGG + Intronic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1106464363 13:29999639-29999661 TATTGGGAAAGGAGGAGGGAAGG - Intergenic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1113510869 13:110853831-110853853 CAGGGGGTAAGGAGGGCGCCTGG + Intergenic
1113796700 13:113062426-113062448 TAGCAGGGAAGGAGGGCGCACGG - Intronic
1113796963 13:113064034-113064056 TAGCAGGGAAGGAGGGCGCACGG + Intronic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG + Intronic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1124954510 15:34351306-34351328 TAGAGGCTAAGGTGGGAGGATGG + Intronic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1127857895 15:62967558-62967580 AATTGGGTAAGGTGGGAGGAAGG - Intergenic
1127959796 15:63882314-63882336 TACTGGGTAAGGAGAAAGGAGGG + Intergenic
1128818842 15:70634264-70634286 AAGTGGGGATGAAGGGCGGATGG + Intergenic
1128861856 15:71080790-71080812 TAGTGGGTAAAGAGGGGGATAGG + Intergenic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1131046003 15:89316064-89316086 AAGTGGGTAAAGAGAGTGGATGG - Intronic
1131283251 15:91038010-91038032 TAGAGGGGAAGGAGGGAGGGAGG + Intergenic
1132288830 15:100685327-100685349 TACTCAGAAAGGAGGGCGGAAGG + Intergenic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1139376628 16:66502767-66502789 TACTGTGGAAGGAGGGGGGAAGG - Intronic
1139709308 16:68763627-68763649 AAGTGGGGGAGGAGGGCCGAGGG - Intronic
1140781989 16:78305340-78305362 TTGTGAGCAAGGAGGCCGGAGGG - Intronic
1142340447 16:89518765-89518787 TAGGGGTTAAGGATGGGGGAAGG + Intronic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1146230802 17:31107213-31107235 TTTTGGGTAATGAGTGCGGAGGG + Intronic
1147168219 17:38604541-38604563 TGGTGGGAGAGGACGGCGGAGGG - Intronic
1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG + Intergenic
1149893684 17:60412395-60412417 TAGTGGGGAATGGGGGCGGTGGG + Intronic
1151502195 17:74497700-74497722 TGGTGGGAAGTGAGGGCGGAGGG + Intergenic
1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG + Intergenic
1154031203 18:10755904-10755926 TAGAGGGTGAGGAGGAGGGATGG + Intronic
1157231428 18:45920110-45920132 GAGTGGGTAAGGGGAGAGGAAGG - Intronic
1157404615 18:47412507-47412529 AAGTGTGTATGGAGGGCGCAGGG - Intergenic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1157619642 18:49008891-49008913 TCGTGGGGAAGGAGGGCTGGAGG + Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1159325792 18:66915400-66915422 TAGTTGGGGAGGAGGGTGGAGGG + Intergenic
1160469656 18:79117592-79117614 TAGTTGGAAAGGAGGTCAGAGGG + Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161131359 19:2590805-2590827 TAGTTGGTTGGGTGGGCGGATGG - Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG + Exonic
1162325230 19:9995446-9995468 TAGTGGGAAAAGAGTGCTGAAGG - Intronic
1162738956 19:12763125-12763147 TGGTGGGGAGGGAGGGCGGGAGG - Exonic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164441774 19:28284758-28284780 TAGAGGGGAAGGAGGGTGGGAGG + Intergenic
1164441791 19:28284806-28284828 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441798 19:28284822-28284844 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441805 19:28284838-28284860 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441830 19:28284900-28284922 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441866 19:28285021-28285043 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441932 19:28285238-28285260 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441961 19:28285326-28285348 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG + Exonic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1202631919 1_KI270706v1_random:7986-8008 TGGTGTGGAAGGAGGGGGGAGGG - Intergenic
926706280 2:15840063-15840085 TAGTGTGTGAGGAGGGGTGAAGG - Intergenic
927053065 2:19348856-19348878 TCTTGGGCAGGGAGGGCGGAAGG - Intergenic
928456724 2:31429046-31429068 TAGTGGGAAATGAGGCTGGAAGG - Intergenic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
928990678 2:37230668-37230690 TAGTAAGAAAGGAGGGCCGAGGG - Intronic
929558057 2:42937686-42937708 TGGTGGGGGAGGAGGGCGGGAGG - Intergenic
932895477 2:75635485-75635507 TCCTGGGTAAAGAGGGCTGAGGG - Intergenic
933486871 2:82935325-82935347 TAATGAGTAAGGAGGGCAGCTGG - Intergenic
935117336 2:100147547-100147569 AAATGGGCAAGGAGGGAGGAGGG + Intergenic
935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG + Intronic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
940900821 2:159124859-159124881 TACTTGGTGAGGAGGGCGGGGGG - Intronic
945698091 2:213134327-213134349 TAGTGGGAAAGGAGATTGGAAGG - Intronic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946129403 2:217594122-217594144 TAGGGGATAAGAAGGGAGGAAGG + Intronic
947502842 2:230683808-230683830 GAGTGGGTAAGAAAGGAGGAGGG + Intergenic
948871955 2:240805113-240805135 GAGAGGGGAGGGAGGGCGGAGGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169505724 20:6209214-6209236 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1170009079 20:11701177-11701199 TTGTGGGCAAGGAAGGCGGGAGG - Intergenic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172460285 20:35112956-35112978 GAGTGGGAAAGGAGGGAGGGAGG + Intergenic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173628965 20:44495663-44495685 TACTGTGTAAGGAGGGGGCAGGG - Intergenic
1173803513 20:45909889-45909911 GAGTGGGTCAGGAGGGCTGGAGG - Intronic
1173912611 20:46681440-46681462 AAGAGGGGAAGGAGGGAGGAGGG + Intronic
1174110536 20:48195006-48195028 CAGTGGGTATGAAGGACGGAGGG - Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180048888 21:45322343-45322365 TAGCGGGCAAGGAGGGCTGTTGG + Intergenic
1180115099 21:45697988-45698010 TAGTGTGTAGGGAAGGTGGATGG - Intronic
1180169178 21:46049076-46049098 TAGAGGGCATGGAGGGCGGTGGG - Intergenic
1182488607 22:30654728-30654750 TGGTGGCTAAGCAGGCCGGAAGG - Intronic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
950287366 3:11755361-11755383 TTGTGGGGAAGGAATGCGGAAGG + Intergenic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
954991975 3:54849380-54849402 TGGTGGTTAAGGAAGGAGGAGGG - Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
956946801 3:74232504-74232526 GAGTGAGTAAGGAGGAGGGAAGG + Intergenic
957723140 3:84031064-84031086 AAGTGGGTCAGGATGGGGGAGGG + Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
961283494 3:125781718-125781740 TAGATGGTAAGGTGGGTGGATGG - Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
963768214 3:149361054-149361076 TGGTGGTTAAGGAGGGCCCAGGG + Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
966457428 3:180133675-180133697 CAGTGAGAAAGGAGAGCGGAAGG - Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
969433937 4:7173162-7173184 TAGGGGGTCAGGAGTGTGGACGG + Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
972103200 4:35447707-35447729 TAGAGGGTAAGAAGGAAGGAAGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG + Intronic
975786966 4:77900990-77901012 TAGGGGGTAAGGGAGGGGGAAGG + Intronic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978297283 4:107220570-107220592 GAGTGGGGAAGGAGGGAGGGAGG + Intronic
979138491 4:117141972-117141994 CAGAGGGTAAGGAGGGTGGGTGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
980513661 4:133825398-133825420 TAGTGGGTCATGAGGGGTGAGGG - Intergenic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG + Intergenic
987346996 5:16987841-16987863 TTATGGCTAAGGAGGGGGGAAGG - Intergenic
988029124 5:25739507-25739529 TGGTGGGTCAGGAGGGTGGGCGG - Intergenic
988424676 5:31049743-31049765 TAGTAGGAAAGGTGGGAGGAAGG - Intergenic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989963313 5:50441000-50441022 TCCAGGGTAGGGAGGGCGGAGGG - Intronic
993521234 5:88904264-88904286 TAGGGGGTCGGGAGGGGGGAGGG - Intergenic
996201992 5:120686558-120686580 TAGTGGGAAAGGAGGGAGATGGG - Exonic
997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG + Intronic
997649830 5:135508152-135508174 AAGAGGGGAAGGAGGGCGGGAGG + Intergenic
998127004 5:139631038-139631060 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1000593385 5:163185556-163185578 TAGCGGGTCAGGAGGAAGGAAGG + Intergenic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1008927027 6:56897832-56897854 TAGTGAGTCAGGAGGGAGCAGGG - Intronic
1011389403 6:86835661-86835683 TAGTGGGTTAGGTTGGCGGTGGG - Intergenic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1014509415 6:122302670-122302692 TGGTGGGTAAGAAGGAGGGAGGG - Intergenic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019575621 7:1736288-1736310 CAGGGGGAAAGGTGGGCGGAGGG - Intronic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1022561023 7:31349649-31349671 TAGTGGTTAAGGATGGCAAATGG + Intergenic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023265275 7:38398551-38398573 TAGTGAGGAAGTAGGGGGGATGG + Intronic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG + Intergenic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1031972496 7:128074724-128074746 TAGTGTGTGAGGAGGACGGGAGG - Intronic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1033855234 7:145552877-145552899 TAATGGGTACAGAGGGCGGAAGG + Intergenic
1034480567 7:151317220-151317242 GTGGGGGTAAGGAGGTCGGATGG + Intergenic
1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG + Intergenic
1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG + Intronic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035413782 7:158667367-158667389 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414063 7:158668175-158668197 GGGTCGGTAAGGAAGGCGGAGGG - Intronic
1035414074 7:158668204-158668226 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414134 7:158668379-158668401 TAATAGGTAAGGAGGGCGGAGGG - Intronic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1038164229 8:25069268-25069290 TGGAGGGTCAGGAGGGAGGAAGG - Intergenic
1038491963 8:27977767-27977789 AATTAGGTAAGGAGGCCGGAAGG - Intronic
1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG + Intergenic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1045661785 8:104445627-104445649 TAGTGGGGAGGGATGGCGGTGGG + Intronic
1046128446 8:109939883-109939905 TAGTGGGTCAGTAGGGGTGATGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1051598588 9:18849632-18849654 GAGTGGGAAAGGAAGACGGAGGG + Intronic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1053405424 9:37871187-37871209 TATTGGGGAAGGTGGGGGGAGGG + Intronic
1055497092 9:76866740-76866762 AAGTGGGTAAGAAAGGAGGAAGG + Intronic
1055907691 9:81313242-81313264 TAGTGGGTAGTGAAGGCTGAAGG - Intergenic
1057759368 9:97860239-97860261 TAGGGGCTAAGGAGTGGGGATGG + Intergenic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG + Intergenic
1061509490 9:131051821-131051843 TACTGGGAAAGGAGGAGGGAGGG + Intronic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1188016494 X:25112744-25112766 TAGTGGCTAAGATGGGAGGATGG - Intergenic
1188366562 X:29322926-29322948 TATTGGCTAAGGAGAGGGGAAGG - Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1191735105 X:64380735-64380757 TAGGGTGGAAGGAGGGGGGAGGG - Intronic
1192848062 X:74925762-74925784 GAGAGGGTAAGGAGAGCGGGAGG - Intergenic
1193682198 X:84535753-84535775 TAGAGGGTAAGAAGGTAGGAGGG + Intergenic
1193846142 X:86473503-86473525 TAGTGGGTGATGGGGGAGGAAGG - Intronic
1195345891 X:103950893-103950915 TAGTGGGAAAGGAGAGTGGCTGG + Intronic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196106253 X:111899092-111899114 TAGTGGGTGAGGAGAGGGCAAGG - Intronic
1197986716 X:132273840-132273862 TAATGGGTATGGGGGGTGGATGG - Intergenic
1198177825 X:134173029-134173051 TAGTGGGTGAAGAGGGCGCCTGG - Intergenic
1198229738 X:134677620-134677642 TAGTGAGTAAGGAGAGTGGTAGG + Intronic
1198416660 X:136427029-136427051 TAGTTGCTAATGAGGGAGGAAGG + Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic