ID: 1035414063

View in Genome Browser
Species Human (GRCh38)
Location 7:158668175-158668197
Sequence GGGTCGGTAAGGAAGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 5, 3: 10, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035414063_1035414077 11 Left 1035414063 7:158668175-158668197 CCCTCCGCCTTCCTTACCGACCC 0: 1
1: 0
2: 5
3: 10
4: 189
Right 1035414077 7:158668209-158668231 GCCCCCCCTTACCCACTACTGGG 0: 2
1: 6
2: 1
3: 17
4: 81
1035414063_1035414076 10 Left 1035414063 7:158668175-158668197 CCCTCCGCCTTCCTTACCGACCC 0: 1
1: 0
2: 5
3: 10
4: 189
Right 1035414076 7:158668208-158668230 CGCCCCCCCTTACCCACTACTGG 0: 2
1: 5
2: 2
3: 19
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035414063 Original CRISPR GGGTCGGTAAGGAAGGCGGA GGG (reversed) Intronic
900093423 1:930349-930371 GGGCCGGACAGGAAGGCGCAAGG + Intronic
900317825 1:2068269-2068291 GGGGTGGCAAGGAAGGCGGGGGG - Intronic
901101321 1:6721299-6721321 GGGTGGCCAAGGCAGGCGGATGG - Intergenic
901779236 1:11582065-11582087 GGGGAGGAAAGGAAGGCGGCTGG + Intergenic
901919729 1:12527650-12527672 GTGTCGGCCAGGAAGGAGGAAGG - Intergenic
902621940 1:17655883-17655905 GGGGCGGACAGGAAGGCGCAGGG + Exonic
903225064 1:21890082-21890104 GGCTCGGAAGGGAATGCGGATGG - Exonic
905140044 1:35836158-35836180 GGGGCCATAAGGAAGGCTGATGG - Intronic
905322765 1:37129588-37129610 GGCCAGGTAAGGAAGGGGGAAGG + Intergenic
906324444 1:44836074-44836096 GGGTCTGTTAGAAAGGAGGAAGG - Intronic
908811020 1:67982402-67982424 AGGTCGCTAAGGAAGGCAAAAGG - Intergenic
915164188 1:153939508-153939530 GGCTCTGTCAGAAAGGCGGAGGG - Intronic
915951396 1:160191996-160192018 GGGTGGGGAAGGGAGGCGGTTGG - Intronic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
919183445 1:194114865-194114887 GGGGCGGTAAGGAAGACAGATGG + Intergenic
920111690 1:203591622-203591644 GGGTCTGTGAGGAGGGTGGAAGG + Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
922804517 1:228378475-228378497 GGGGCGGGACGGAAGGAGGAGGG - Intronic
1062894585 10:1093051-1093073 AGGCTGGGAAGGAAGGCGGATGG + Intronic
1065366636 10:24943789-24943811 GGGAGGCTAAGGCAGGCGGATGG - Intronic
1067047997 10:42996692-42996714 AGGTTGGTAATGAAGGCGCAGGG + Intergenic
1072641386 10:97213689-97213711 GGGTGGGAAAGTAAGGTGGAAGG - Intronic
1072939517 10:99747758-99747780 GGGAGGGCAAGGAAGGCAGATGG - Intronic
1076000410 10:126908325-126908347 GAGTTGGTAAGGATGGTGGAGGG - Intronic
1076108094 10:127840431-127840453 AGGTCGGTAAGGATGGTGGAGGG + Intergenic
1076801771 10:132834345-132834367 GGGGTGGGAAGGAAGGCAGAGGG - Intronic
1077368768 11:2171934-2171956 GGGTGGGTGAGGAAGGAGGGAGG + Intergenic
1078619715 11:12895935-12895957 GGGACTGAAAGGAAGACGGAGGG - Intronic
1084104887 11:66975003-66975025 GGGAGGGGAAGGAAGGGGGAGGG + Intergenic
1086518747 11:87646060-87646082 GGGAGGGGAAGGAAGGGGGAAGG - Intergenic
1087931869 11:103987275-103987297 GGGTGGGAAAGGAAGGAGGATGG - Intronic
1089654331 11:119935862-119935884 GGGTCTATAAGGAAAGCAGAGGG + Intergenic
1089720593 11:120416581-120416603 GGATGGGTAAGGAAGACAGAAGG - Intronic
1092038891 12:5365991-5366013 GGGTTTGAAAGGAAGGTGGAAGG + Intergenic
1092140322 12:6179214-6179236 GGATGGGGAAGGAAGGAGGAGGG - Intergenic
1092229598 12:6769212-6769234 GGGCAGGCAAGGGAGGCGGAGGG + Intronic
1092911171 12:13146093-13146115 GGGCAGGAAAGGAAGGAGGAAGG - Intergenic
1094485907 12:30926212-30926234 GGGCTGGTGAGGAAGGGGGATGG + Intergenic
1094493756 12:30976926-30976948 GGGTAGGAAAGGAAGGGGCAGGG + Intronic
1098275226 12:68805863-68805885 GGGTCAGAAATGAAGGCAGAAGG - Intergenic
1098358368 12:69631985-69632007 GGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1103238970 12:119397905-119397927 GGGTGGGGAAGGAAGGGGGCGGG + Intronic
1103246736 12:119464375-119464397 GGGGAGGGAAGGAAGGAGGAAGG - Intronic
1105437625 13:20391342-20391364 GGGTGGGGAAGGAAGGCGAGGGG + Intergenic
1106269571 13:28139347-28139369 GGGGCGGGGAGGAAGGGGGATGG + Intronic
1107455927 13:40554514-40554536 GGTTAGGTAAGGTAGGTGGAGGG - Intergenic
1110247368 13:73342055-73342077 GGGTGGGAAAGGATGGGGGAGGG - Intergenic
1112380189 13:98881875-98881897 GACTCGGTAAGGGAGGTGGATGG - Exonic
1115046910 14:29005812-29005834 GGGTAGGAAAGGAAGGAGAAGGG - Intergenic
1115253353 14:31372911-31372933 GGGTCGGGAGGGAAGGAGGGAGG - Intronic
1119080581 14:71689841-71689863 GTGTCTGTAAGGAAGGAGGGAGG - Intronic
1121230519 14:92354253-92354275 GGGTGGGTAAGGCAGGAGAATGG - Intronic
1122324953 14:100876271-100876293 GGGTCGGGAAGGGAGGTTGATGG + Intergenic
1123038362 14:105480414-105480436 GGGGAGGTAAGGAAGGTGGGAGG + Intergenic
1123168473 14:106349007-106349029 TGGTAGGAAAGGAAGGAGGAAGG - Intergenic
1127194482 15:56568938-56568960 GGGTAGGTAGGGAAGGCTGTTGG - Intergenic
1128472495 15:67967170-67967192 GGGACGCTGAGGCAGGCGGATGG - Intergenic
1129782219 15:78280010-78280032 GGGTCAATTAGGAAGGAGGAAGG - Intronic
1131203250 15:90418905-90418927 GGGAGGGTAAGGCAGGTGGATGG + Intronic
1133755236 16:8757662-8757684 GGGTTGGAAAGGAAGGGAGAGGG + Intronic
1135701595 16:24637545-24637567 GGGAAAGTAAGGAAGGAGGAAGG + Intergenic
1140221447 16:73047532-73047554 GGGAAGGGAAGGAAGGAGGAAGG + Intronic
1143750371 17:9022683-9022705 AGGTCGGTGAGGAAGGCGGGCGG - Exonic
1144248867 17:13395721-13395743 GGATGGGAAAGGAAGGAGGAAGG - Intergenic
1144877719 17:18411124-18411146 GGGTCGGGAAGGAGAGGGGAGGG - Intergenic
1145154502 17:20533264-20533286 GGGTCGGGAAGGAGAGGGGAGGG + Intergenic
1146693676 17:34893265-34893287 GGGTCAGGAAGGAGGGTGGAGGG + Intergenic
1152841418 17:82571085-82571107 GGGTGGGTAAGGCTGGCTGAGGG - Intronic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1155710735 18:28875519-28875541 GTGTGGGTCAGGAAGGGGGAAGG - Intergenic
1157464366 18:47930998-47931020 GGGCGGGTATGGAAGACGGAGGG + Intronic
1157941895 18:51938159-51938181 GGGCCTGTCAGGAAGGTGGAGGG - Intergenic
1159966199 18:74598108-74598130 GTGTCGGGAAGGAAGGCGACAGG - Intronic
1160074177 18:75656245-75656267 AGGTGGGAAGGGAAGGCGGATGG - Intergenic
1160423814 18:78767081-78767103 GGGCCGTGAAGGAAGGAGGAGGG + Intergenic
1161203394 19:3028461-3028483 AGGTCTGTAAGGAAGTCGGGAGG - Intronic
1161306650 19:3572750-3572772 AGGTTGGTAAGGAAGGCTGCGGG - Intronic
1161680881 19:5679242-5679264 GTGTCGGGCAGGAAGGAGGATGG + Intronic
1163738950 19:18998996-18999018 GGGTAGGGAAGGAAGGGGAAAGG + Intronic
1163790359 19:19302661-19302683 GGGTAGGGCAGGAAGGCAGATGG + Intronic
1164392714 19:27839883-27839905 GGGTAGGGGAGGAAGGGGGAGGG - Intergenic
1164441096 19:28281617-28281639 GTGTGGGGAAGGAAGGCGGTAGG - Intergenic
1164873157 19:31663945-31663967 GGGCCGGTAAGTGAGCCGGAAGG - Intergenic
1166674635 19:44732510-44732532 GGGTATGTATGGAAGGAGGATGG + Intergenic
925260672 2:2525700-2525722 GTTTCTGTAAGGAAGGAGGAGGG + Intergenic
925435850 2:3837063-3837085 GAGACGGAAAGGAAGGCTGAAGG - Intronic
930619292 2:53627369-53627391 GGGTCAGTAGGGCAGGGGGAGGG - Intronic
932455823 2:71849346-71849368 AGGTCGGAAAGGAGGGCGTAGGG + Intergenic
932689065 2:73897066-73897088 GGGTGGGGAAGGCAGGGGGAAGG - Exonic
932809561 2:74812850-74812872 GGGTGGCTAAGGTAGGAGGACGG + Intergenic
934676711 2:96254447-96254469 GGGTCTGTAGGGAAGCAGGAAGG + Intronic
941644666 2:168027097-168027119 GGGTGGGTAAGGTAGGGGAAAGG + Intronic
947502842 2:230683808-230683830 GAGTGGGTAAGAAAGGAGGAGGG + Intergenic
948646987 2:239411488-239411510 GGGTCAGTAAGGAAGGGGTCAGG + Intergenic
1170338874 20:15301120-15301142 GGGCCAGTAAGGCAGGCGAATGG - Intronic
1172101183 20:32484478-32484500 GGGGCGGGGAGGAGGGCGGAGGG - Intronic
1176350860 21:5795388-5795410 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176357674 21:5915972-5915994 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176545181 21:8193458-8193480 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176564132 21:8376503-8376525 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1180947413 22:19704127-19704149 GGGTGGGGCAGGAAGGAGGAAGG + Intergenic
1182217343 22:28730261-28730283 GGGGAGGAAAGGAAAGCGGAAGG + Intronic
1182250489 22:28996176-28996198 GGGAGGCTAAGGAAGGAGGATGG - Intronic
1182657733 22:31903517-31903539 GGGTAGGTGTGGAAGGTGGAAGG - Intronic
1183245772 22:36692328-36692350 GTGTCAGTAAGGAAGTGGGACGG + Intronic
1203250051 22_KI270733v1_random:109696-109718 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
952859518 3:37801301-37801323 GGGACTGGAAGGAAGGGGGAAGG + Intronic
954991975 3:54849380-54849402 TGGTGGTTAAGGAAGGAGGAGGG - Intronic
956747763 3:72323080-72323102 GGGACAGTAAGGAAGAAGGAAGG - Intergenic
961090858 3:124111513-124111535 GGGTCTGTAAGCAAGGAAGAAGG + Intronic
962556184 3:136554239-136554261 GGGAGGGTAAGGAAGGGGAAAGG + Intronic
963088760 3:141462806-141462828 GGGTCTATAAGGAAGGGAGAGGG - Intergenic
963814266 3:149812667-149812689 GGCACGGTACGGAAGGCGGGCGG + Intronic
966311026 3:178594039-178594061 GGGTAGGTAAGGAGGGAGGGAGG - Intronic
966431075 3:179832323-179832345 GGGTGGGTAAGTAAGCAGGAAGG - Intronic
966431154 3:179832623-179832645 GGGTAGGTAAGTAAGTAGGAAGG - Intronic
966902030 3:184493495-184493517 GGGTAGGAAAGGAAGGAGGAAGG + Intronic
968224290 3:196963707-196963729 GGTTCTGTTAGGAAGGAGGAAGG + Intronic
969350108 4:6593476-6593498 GGGTCTGCAGGGAAGGAGGATGG - Intronic
970473100 4:16395845-16395867 GGGTCTGTTAAGAAGGAGGAAGG + Intergenic
971378915 4:26078750-26078772 GGTGCAGTCAGGAAGGCGGAGGG - Intergenic
972653793 4:41046827-41046849 GGGGTGGGAAGGAAGGCTGAGGG + Intronic
972732928 4:41813033-41813055 GGGTGTGGAAGGAAGGCAGAAGG - Intergenic
976616789 4:87086413-87086435 GGGTGGGAAGGGAAGGAGGACGG - Intronic
976753825 4:88477463-88477485 GGAACGGAAAGGAAGGGGGAGGG + Intronic
976753840 4:88477507-88477529 GGAACGGAAAGGAAGGGGGAGGG + Intronic
980603157 4:135052452-135052474 GGTTCTGGGAGGAAGGCGGATGG - Intergenic
982573063 4:157075014-157075036 GGGAGGCTAAGGCAGGCGGATGG + Intergenic
983503136 4:168523245-168523267 GGGAGGGTAAGGAAGGAGGAAGG + Intronic
985670962 5:1206526-1206548 GGGTCGGGAAGGGAGGCGATGGG + Intronic
990174438 5:53091520-53091542 GGTTCAGTAAGGGAGGAGGAAGG - Exonic
997013355 5:129904426-129904448 GGCTCGGGAAGGAGGGAGGAGGG + Intergenic
998807309 5:145931269-145931291 GGGAGGCTAAGGCAGGCGGATGG - Intergenic
1001363181 5:171108515-171108537 GGGAGGGTAAGGTAGGAGGACGG - Intronic
1004135044 6:12957844-12957866 CGGCCGGGAAGGAAGGCGAAGGG + Intronic
1006151602 6:31992955-31992977 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006157903 6:32025693-32025715 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006321671 6:33322919-33322941 GGAGTGGGAAGGAAGGCGGAGGG - Exonic
1006380618 6:33695147-33695169 GGGTGGGTCAGGAAGGATGAAGG - Intronic
1010749039 6:79597376-79597398 GGGAAGGGAAGGAAGGAGGAAGG + Intergenic
1014972962 6:127841423-127841445 GTGCCGGTAAGAAAGACGGATGG + Intronic
1015818338 6:137233525-137233547 GGGAGGGCAAGGCAGGCGGATGG - Intergenic
1016902418 6:149115495-149115517 GAGTAGGTCAGGAAGGAGGAAGG + Intergenic
1017158285 6:151341802-151341824 GGGACGGGAAGGAAGGAGGCTGG - Intronic
1017746034 6:157447500-157447522 GGGACTGTATGGAAGGAGGATGG + Intronic
1019515513 7:1438232-1438254 GGGGCGGTGAGGATGCCGGAGGG + Intronic
1020877252 7:13713488-13713510 GGGAAGGGAAGGAAGGGGGAAGG + Intergenic
1020877259 7:13713504-13713526 GGGAAGGGAAGGAAGGGGGAAGG + Intergenic
1021201393 7:17732002-17732024 GGGTCTGTGAGGAAGACAGAAGG - Intergenic
1029522615 7:101073236-101073258 GGGAGGCTAAGGAAGGAGGATGG + Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1035115876 7:156523588-156523610 GGCTCGAGACGGAAGGCGGAAGG + Intergenic
1035143317 7:156786202-156786224 GGGAAGGGAAGGAAGGAGGAAGG + Intronic
1035413756 7:158667266-158667288 GGGTCTCTGAGGGAGGCGGAGGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414063 7:158668175-158668197 GGGTCGGTAAGGAAGGCGGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035992730 8:4510655-4510677 GGGAAGGAAAGGAAGACGGAAGG - Intronic
1036496987 8:9278574-9278596 GAGCCTGGAAGGAAGGCGGAAGG - Intergenic
1036911340 8:12759809-12759831 GGGGCAGCAAGGAAGGAGGATGG - Intergenic
1037996038 8:23352977-23352999 GGATAGGTAAGGAAGGAGGTGGG + Intronic
1038037214 8:23696613-23696635 GGGTCAGGGAGGAAGGCAGATGG + Intergenic
1040286624 8:46103786-46103808 GGGTCGTTAAGGCAGGCACAGGG - Intergenic
1040289675 8:46117873-46117895 GGGACGTTGAGGAAGGCCGAGGG - Intergenic
1040310073 8:46232272-46232294 GGGACGTTAAGGCAGGCAGAGGG + Intergenic
1040312657 8:46244697-46244719 GGGTCGTTGCGGAAGGCAGAGGG + Intergenic
1040324255 8:46333706-46333728 GGGACGTTAAGGCAGGCAGAAGG + Intergenic
1040335028 8:46411725-46411747 GGGACGTTAAGGCAGGCAGAGGG + Intergenic
1040337835 8:46425110-46425132 GGGACGGCAAGGCAGGCAGAGGG + Intergenic
1042570921 8:70163738-70163760 AGGTGGGTAAGGGAGACGGAGGG + Intronic
1042732238 8:71948797-71948819 GGGGAGGGAAGGAAGGAGGAAGG + Intronic
1043525486 8:81092111-81092133 GGGAGGCTAAGGAAGGTGGATGG + Intronic
1044915544 8:97109490-97109512 GGGTCAGGAAGGAAGATGGAGGG - Intronic
1051598588 9:18849632-18849654 GAGTGGGAAAGGAAGACGGAGGG + Intronic
1057298783 9:93864709-93864731 GGGTAGAAAAGGAAGGAGGAGGG - Intergenic
1060907011 9:127315534-127315556 GGGAGGGTAAGGCAGGAGGATGG + Intronic
1061365713 9:130171865-130171887 GGGTCAGGAAGGGAGGTGGATGG - Intergenic
1062144069 9:134979127-134979149 GGGGAGGGAAGGAAGGAGGAAGG + Intergenic
1203466451 Un_GL000220v1:92963-92985 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1188571385 X:31589257-31589279 GGGTTGGTCAGGTAGGGGGAAGG - Intronic
1189257918 X:39654557-39654579 AGGTCGGTAAGGAAAGGGGTTGG + Intergenic
1189425265 X:40894901-40894923 GGGTAGTCAAGGAAGGTGGAAGG + Intergenic
1192274534 X:69616103-69616125 GGGTGGGAAAGGGAGGAGGAGGG - Exonic
1195210798 X:102651383-102651405 GTGTCGGGAAGGGGGGCGGAGGG - Exonic
1195216947 X:102712348-102712370 GTGTCGGGAAGGGGGGCGGAGGG - Exonic
1195221089 X:102745960-102745982 GTGTCGGGAAGGGGGGCGGAGGG - Intronic
1196173295 X:112613527-112613549 GTGTCAGAAAGGAAGGCAGAAGG - Intergenic
1198724064 X:139658115-139658137 GGGTCAGTAAGGGAGGCAGGAGG + Intronic
1199793436 X:151175582-151175604 GGGGCAGTCAGGAAGGCTGAAGG - Intergenic
1200057779 X:153470656-153470678 GGGTCGGTCGGGAAGGGGGTGGG - Intronic