ID: 1035414074

View in Genome Browser
Species Human (GRCh38)
Location 7:158668204-158668226
Sequence TAGTGGGTAAGGGGGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 2, 1: 5, 2: 1, 3: 33, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035414074_1035414088 10 Left 1035414074 7:158668204-158668226 CCTCCGCCCCCCCTTACCCACTA 0: 2
1: 5
2: 1
3: 33
4: 321
Right 1035414088 7:158668237-158668259 CTGCCCTCCTTACCCACTACTGG No data
1035414074_1035414089 11 Left 1035414074 7:158668204-158668226 CCTCCGCCCCCCCTTACCCACTA 0: 2
1: 5
2: 1
3: 33
4: 321
Right 1035414089 7:158668238-158668260 TGCCCTCCTTACCCACTACTGGG 0: 1
1: 9
2: 5
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035414074 Original CRISPR TAGTGGGTAAGGGGGGGCGG AGG (reversed) Intronic
900205656 1:1431037-1431059 TAGGGGGTGAGGGGGTGAGGGGG - Intergenic
900936297 1:5768356-5768378 TACTGGGTTAGGGTGGGCCGTGG - Intergenic
901619160 1:10568326-10568348 TAGTGGGAGTGGGGGGGGGGGGG - Intronic
902866586 1:19284123-19284145 TAGCTGGGAAGGGGGGACGGTGG + Exonic
903174091 1:21570369-21570391 TATTGGGTAAGTGGAGGGGGTGG + Exonic
903220023 1:21864328-21864350 AAGTGGGGAAGGAGGGGCGCCGG - Intronic
904008982 1:27379415-27379437 TTGTGGGTAAGCGGGGGGCGGGG - Exonic
904286616 1:29456797-29456819 GAGAGGATAAGGGGGGTCGGAGG + Intergenic
904392883 1:30197372-30197394 CAGTGGGTAAGGGGTGGAGCAGG - Intergenic
905006242 1:34712520-34712542 TAGTGGGACAGGGGGGCCTGAGG - Intergenic
905337555 1:37256066-37256088 GAGCGGGGGAGGGGGGGCGGTGG - Intergenic
905362932 1:37432768-37432790 TGGTGGGCAGGGAGGGGCGGTGG + Intergenic
905408556 1:37753394-37753416 TGGTGGATGAGGGGGGACGGGGG + Intronic
906168775 1:43707038-43707060 TGGTGGGTAAGGGGGCACGGGGG - Intronic
906642915 1:47452264-47452286 TGGTGGGGAAGGGGGAGTGGGGG + Intergenic
906753978 1:48291586-48291608 TACTGGGTGAGGGGGGCAGGTGG - Intergenic
907301174 1:53487083-53487105 CAGTGGGGAAGGGGAGGCGGTGG + Intergenic
907729496 1:57052130-57052152 TACTGGGGGCGGGGGGGCGGGGG + Intronic
907935884 1:59041926-59041948 TTGTGGGGAAGAGGGGGAGGTGG + Intergenic
909215130 1:72877432-72877454 TAGTGGGTCACTAGGGGCGGTGG - Intergenic
910449259 1:87329586-87329608 TAGTGTGTTTGGGGGGGTGGGGG + Intronic
911767917 1:101701651-101701673 GAGTGGGGAGGGGGGGGAGGGGG - Intergenic
912431509 1:109630574-109630596 TTGGGGGGATGGGGGGGCGGGGG + Intronic
913517375 1:119615966-119615988 AAGTGGGGTGGGGGGGGCGGGGG + Intergenic
913546223 1:119871558-119871580 TGGTGGGGCACGGGGGGCGGTGG + Intergenic
915350760 1:155223915-155223937 TAGTGGGTAAGGGGCAGCAGAGG - Intergenic
915522810 1:156457627-156457649 GAGGGGGTGACGGGGGGCGGGGG + Intergenic
915735013 1:158078949-158078971 GAGTGGGTGAGGGGGGGCAAGGG - Intronic
915910133 1:159909736-159909758 TGGTGGGGCAGGGGGGGTGGGGG + Intergenic
916425329 1:164674848-164674870 TGGTGGGTGGGGGGGGGGGGGGG - Intronic
917457129 1:175194551-175194573 CACTGGGTCAGGGGGAGCGGCGG - Intergenic
921219877 1:212965882-212965904 TAGTCTGTAAGGGGTGGAGGCGG + Intronic
922416149 1:225425211-225425233 TAGTGGGAGAGTGGGGGGGGAGG + Intronic
922705512 1:227788286-227788308 GGGTGGGTAGGGGCGGGCGGAGG + Intergenic
1063236921 10:4126827-4126849 TAGTGGGTAAGGGGAAGCCAGGG + Intergenic
1066223441 10:33358231-33358253 TATTGGGTGAGGGGCGGTGGTGG - Intergenic
1066468265 10:35672039-35672061 TTGTGTGTATGTGGGGGCGGGGG + Intergenic
1069753566 10:70760276-70760298 CAGTGGGTAAGTGGGAGGGGGGG + Intronic
1071734445 10:88282591-88282613 TAGTGGGTAGGCGGGGGGTGGGG + Intronic
1071822102 10:89289389-89289411 TAGTGTGTAAGGAAGGGAGGGGG - Intronic
1071863773 10:89703222-89703244 TCATGGGTAAGGGGGTGCAGAGG - Intronic
1072726431 10:97816804-97816826 TTGTAGGTAAGGAGGGGCAGGGG + Intergenic
1073579690 10:104653937-104653959 TAGTGGGGGAGAGGGGGAGGTGG - Intronic
1073605215 10:104887950-104887972 TGGTGGGGGCGGGGGGGCGGGGG + Intronic
1074029972 10:109677308-109677330 TAGTGGGGAAGTGGGGGAGTTGG - Intergenic
1074321879 10:112410890-112410912 TGGTGGGTTGGTGGGGGCGGGGG - Intronic
1074563791 10:114558208-114558230 TCGTGGATATGGGGGGGCGGGGG - Intronic
1074781915 10:116808293-116808315 TGGTGGGGAAAGGGGGACGGGGG + Intergenic
1074876082 10:117614412-117614434 TAGTGGGGGTGGGGGGGTGGCGG + Intergenic
1075067016 10:119295798-119295820 TTGTGGGGAAGGGTGGGGGGTGG + Intronic
1075960246 10:126562270-126562292 CAGGGGGTAAGGGAGGGCAGGGG - Intronic
1076374603 10:129974793-129974815 TGGTTGGTGGGGGGGGGCGGTGG - Intergenic
1077483516 11:2827632-2827654 AAGTGGGGTCGGGGGGGCGGGGG + Intronic
1077923120 11:6655922-6655944 CCGGGGGGAAGGGGGGGCGGCGG - Intergenic
1078514278 11:12009151-12009173 GGGTGGGTGAGGGGCGGCGGCGG - Intronic
1078822898 11:14900127-14900149 TTGTGGGTAGGGGGGGTGGGGGG - Intergenic
1079165733 11:18041113-18041135 TTGTGGGCAAGGTGGGGAGGAGG - Exonic
1080376886 11:31723333-31723355 GAGTGGGTGGCGGGGGGCGGGGG - Intronic
1080763603 11:35275864-35275886 TAGTGTGTAAGTGGTGGTGGGGG - Intronic
1082653988 11:55830165-55830187 AAGGGGGTAAGGGGAGGAGGGGG - Intergenic
1083613480 11:64015309-64015331 CAGTGGGGAAGGGGCTGCGGCGG + Intronic
1084092747 11:66889305-66889327 CAGTGGGACAGGGGTGGCGGGGG + Intronic
1084179242 11:67438326-67438348 GAGTGGGAAGGGGGCGGCGGAGG + Exonic
1084189699 11:67493350-67493372 TGGAGGGTAAGGGGGAGCGGGGG + Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085383089 11:76138429-76138451 TAGTTGGCAAGGTGGGGCAGTGG + Intronic
1085845560 11:80060685-80060707 GAGTGGGTAACGTGGGGAGGGGG + Intergenic
1086080669 11:82900218-82900240 CAGAAGGTAAGGGGGAGCGGGGG - Exonic
1086322725 11:85667202-85667224 TAGTGGGTGGGGGTTGGCGGCGG - Intronic
1087824476 11:102749431-102749453 TGGTGGGTAGGGGGGTGGGGGGG - Intergenic
1088837931 11:113594138-113594160 TAGTGTGTATGTGGGGGTGGGGG + Intergenic
1089389178 11:118088489-118088511 TAGCGGGTGAGGTGGGGAGGTGG - Intronic
1089738162 11:120564048-120564070 TAGTGGGGAAGTTGGGGTGGGGG + Intronic
1090095854 11:123741391-123741413 TCCTGGGGAAGGGGTGGCGGCGG - Intronic
1090554159 11:127855805-127855827 TACAGGGTAAGGGGGTGTGGTGG + Intergenic
1090957890 11:131529927-131529949 TAGTGTGTGAGGGGGAGAGGTGG - Intronic
1092108602 12:5943503-5943525 CAGCGGGTAAGGGTGGGAGGAGG + Intronic
1092462580 12:8698702-8698724 TTGTGGGAAGGGGGGGGAGGGGG - Intronic
1095970829 12:47901093-47901115 TTGTGGGCAAGGGGGGTAGGTGG - Intronic
1096596241 12:52697579-52697601 TTGTGTGTAAGGGTGGGGGGCGG - Intronic
1097024131 12:56041705-56041727 CAGGGGGGAAGGGGGGGAGGGGG + Intergenic
1097166575 12:57089357-57089379 TAGTGGGCAAAGGGAGGCAGCGG + Intronic
1097691986 12:62742068-62742090 TAGTGGGCAAGGCAGGGAGGGGG + Intronic
1098414902 12:70222107-70222129 TAGTGGGGAAGGGTGGGGGCTGG - Intergenic
1101121007 12:101580082-101580104 TTGTGGGTAGGGGTGGGAGGAGG - Intronic
1101732465 12:107437900-107437922 TAGTGGGTATTGGGGGGTGGGGG + Intronic
1102426460 12:112847982-112848004 CAGTGGGGAAGGGGGTGGGGCGG - Intronic
1103965332 12:124635337-124635359 TAGTGGCTGAGGGGGAGCAGAGG - Intergenic
1105720444 13:23108339-23108361 TAGTGGGAGGGAGGGGGCGGTGG - Intergenic
1107445080 13:40463345-40463367 TTGTGGGGAAGGGTGGGAGGGGG - Intergenic
1108418774 13:50227822-50227844 GGGTGGGTAGGTGGGGGCGGGGG + Intronic
1108546850 13:51503541-51503563 TGGTGGGGAGGGGGGGGAGGGGG - Intergenic
1111786323 13:92791417-92791439 GAGTGTGTGGGGGGGGGCGGGGG + Intronic
1113024292 13:105923209-105923231 TAGGGGGGAAAGGGGGGCGGGGG + Intergenic
1114528308 14:23379699-23379721 TATTGGGGGAGGGGGGGTGGAGG + Exonic
1115002730 14:28441591-28441613 TAGTTGGTAAAGGGGGGCAGGGG + Intergenic
1115197026 14:30812335-30812357 GGGTGGGGAAGGGGGCGCGGGGG + Intergenic
1117091815 14:52258706-52258728 TAATGGGTGAGTGGGGGTGGGGG + Intergenic
1117590828 14:57266816-57266838 TAGCGGGGAAGGGGAGGAGGTGG - Intronic
1122411523 14:101528380-101528402 GAGAAGGTAAGGGGGGACGGGGG + Intergenic
1122922147 14:104884629-104884651 TCGTGGGGAACGGGGGGTGGAGG + Intronic
1122922165 14:104884680-104884702 TCGTGGGGAACGGGGGGTGGAGG + Intronic
1122922239 14:104884886-104884908 TCGTGGGGAACGGGGGGTGGAGG + Intronic
1122922255 14:104884937-104884959 TCGTGGGGAACGGGGGGTGGAGG + Intronic
1122922288 14:104885039-104885061 TCGTGGGGAACGGGGGGTGGAGG + Intronic
1122925233 14:104896319-104896341 GTGTGTGTGAGGGGGGGCGGGGG + Exonic
1123076026 14:105667793-105667815 GAGTGGGCATGGGGGGTCGGAGG + Intergenic
1123505226 15:20935651-20935673 AATCGGGGAAGGGGGGGCGGGGG + Intergenic
1123562465 15:21509347-21509369 AATCGGGGAAGGGGGGGCGGGGG + Intergenic
1123598710 15:21946634-21946656 AATCGGGGAAGGGGGGGCGGGGG + Intergenic
1125722411 15:41851587-41851609 GGGTGGGTAGGTGGGGGCGGTGG + Intronic
1126377004 15:48006829-48006851 TGGTGGGAAAGGGGGTGAGGAGG + Intergenic
1126695561 15:51322671-51322693 TAGTGGGGAAGCGGGGGTGGGGG - Intronic
1128028800 15:64461211-64461233 TGGCGGGGGAGGGGGGGCGGGGG + Intronic
1128065672 15:64763049-64763071 TAGTGGGTAGGGGGTGGGGGTGG + Intronic
1129954968 15:79628041-79628063 TAGAGGGTAAGGGAGGGGCGAGG - Intergenic
1129965167 15:79728675-79728697 TGGTGGGAAAGGGAGGGTGGAGG - Intergenic
1130200933 15:81826253-81826275 GAGTGGGTGAGGTGGGGTGGGGG + Intergenic
1130547158 15:84865159-84865181 TTCTGGGTAATGGGGGGCGTAGG - Intronic
1132543060 16:520332-520354 TGGTTGGGAAGGGGGGGCCGTGG + Intronic
1132891065 16:2205178-2205200 TAGTGGGTCAGGGAGGGCACCGG + Intronic
1132983847 16:2753201-2753223 TGGCGGGGAAGGGGCGGCGGCGG + Intronic
1134441582 16:14302212-14302234 TGGGGGGTTGGGGGGGGCGGGGG + Intergenic
1135476257 16:22778335-22778357 TAGAGGGGAAGGGTGGGAGGTGG - Intergenic
1135992071 16:27224343-27224365 CAGTGGGTGGGGGGAGGCGGTGG + Intergenic
1136219965 16:28822807-28822829 GAGTGGGTAAGGAGCGGCGCGGG - Intergenic
1136292509 16:29284403-29284425 TAGGGGGTAAGCTGGGGGGGGGG - Intergenic
1139133090 16:64169644-64169666 GAGTGGGAAATGGGGGGAGGAGG - Intergenic
1139308197 16:66005954-66005976 GAGTGGGTAAGGGGAGGCTGGGG + Intergenic
1140103450 16:71938337-71938359 GGGAGGGTAAGGGGGGGCTGAGG + Intronic
1140222072 16:73050899-73050921 GAGTGGGTAAGGGGAGGAGTAGG - Intronic
1141706570 16:85668419-85668441 TAGAAGGTAAGGGGGTGCTGGGG + Exonic
1141916004 16:87097569-87097591 GTGTGTGTCAGGGGGGGCGGGGG + Intronic
1142098401 16:88258418-88258440 TAGGGGGTAAGCTGGGGGGGTGG - Intergenic
1142145179 16:88489924-88489946 TGGTGGGTGAGGGAGGGAGGGGG + Intronic
1142601175 17:1053653-1053675 GAGTGGGTCAGGGGTGGCGGCGG + Intronic
1142685850 17:1576580-1576602 CTGTGGGTAAGAGGGGTCGGGGG - Exonic
1142831082 17:2549502-2549524 TAGTGTATAGGTGGGGGCGGTGG + Intergenic
1142977865 17:3656198-3656220 CAGTGGGTAAGGACTGGCGGGGG - Intronic
1143658586 17:8311501-8311523 AACTGGGAAATGGGGGGCGGAGG + Intronic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1146950462 17:36901746-36901768 TGGTGGGTATGGAGGGGCTGTGG + Intergenic
1147042932 17:37731853-37731875 TGGTGAGTGAGGGGGGGCGGGGG + Intronic
1147662605 17:42125081-42125103 GGGTGGGTAAGGGGGGGAGTGGG - Intronic
1147691036 17:42314609-42314631 TAGTGAGTAAGGCTGGGCAGAGG - Exonic
1148430978 17:47643259-47643281 TTGTGGGTGTTGGGGGGCGGTGG - Intergenic
1148603134 17:48908873-48908895 TAGTGGGAGAGGGTGGGGGGCGG - Intronic
1149345358 17:55728805-55728827 TAGGGGGTAGGGGGTGGTGGAGG + Intronic
1149530027 17:57387815-57387837 TAGTGGGGAAGGGAAGGTGGTGG + Intronic
1149573997 17:57698315-57698337 AAGTGGGCAAGGGAGGGAGGAGG - Intergenic
1150251055 17:63704613-63704635 TAGCGGGTGGGGGGGGGGGGTGG + Intronic
1150561937 17:66302370-66302392 CACTGGGCAAGGGGAGGCGGCGG - Intergenic
1151408814 17:73907221-73907243 TAGTGGGCAAGGGAGGAGGGAGG + Intergenic
1151565600 17:74895981-74896003 GAGTGGGAAAGGGAGGGAGGAGG - Intergenic
1153402982 18:4701566-4701588 TTGTGGGTAAGGGTGGGAGGGGG + Intergenic
1156470967 18:37377003-37377025 GAGAGGGTAAGGGGAGGTGGAGG + Intronic
1158203027 18:54960859-54960881 TAGATGTTGAGGGGGGGCGGAGG - Intergenic
1159108176 18:64027124-64027146 TAGTGGAGATGGAGGGGCGGGGG + Intergenic
1159502845 18:69296197-69296219 TAGTGGGGATGGGGGGGACGTGG - Intergenic
1160454493 18:78990980-78991002 AAGAGGGTAAGGGGAGACGGAGG + Intronic
1160989518 19:1854784-1854806 CAGCGGGTCAGCGGGGGCGGGGG + Intronic
1161495022 19:4581781-4581803 TTGCTGGAAAGGGGGGGCGGAGG - Intergenic
1163136828 19:15317608-15317630 TGGTGGGCAAGGGGTGGTGGTGG + Intronic
1163398046 19:17075627-17075649 TAGTGGGTAGGGGCGGTGGGTGG + Intergenic
1163883242 19:19945345-19945367 GAGTGGGTAAGGGGTGGTGATGG - Intergenic
1164456788 19:28414501-28414523 TAGTGGGACAGGTGGGGCAGGGG - Intergenic
1164667659 19:30052212-30052234 CAGAGGGTAATGGGGTGCGGCGG + Intergenic
1165106736 19:33474566-33474588 TAGTGGGGAGGCGGGGGCTGAGG + Intronic
1165366459 19:35370398-35370420 AAGTGGGGGAGGGAGGGCGGAGG + Intergenic
1165981779 19:39730419-39730441 TACTGGGTGAGGGGAGGCAGTGG + Intergenic
1166567902 19:43776310-43776332 GAGTGTGCAAGGGGGGGCTGGGG + Intronic
1166732995 19:45069128-45069150 AAGTGGGAAAGGGAGGGCTGGGG + Intronic
1167616254 19:50535851-50535873 TGGTGGGGAAGGGTGGGAGGCGG - Intronic
1168235375 19:55059579-55059601 TTGGGGGTGGGGGGGGGCGGGGG + Intronic
1168254378 19:55157771-55157793 TAGTGGGCAGGGGGAGGAGGAGG - Intronic
925804454 2:7634319-7634341 TAATGGGGAAGGGGTGGGGGTGG + Intergenic
927363686 2:22268699-22268721 AAGTGGGTGGGGGGGGGCGGGGG - Intergenic
928602451 2:32916221-32916243 GCGTGGGTAGGGGGGGGGGGTGG + Intergenic
929606844 2:43240510-43240532 TAGAGGGTAAGGGGAGGTAGGGG - Intronic
931361397 2:61580851-61580873 TAGTGGCGGGGGGGGGGCGGTGG - Intergenic
934044885 2:88164749-88164771 TAGTGGGTAGGAGGTGGAGGTGG + Intergenic
935945677 2:108284550-108284572 TTGTGGGGTAGCGGGGGCGGAGG - Intergenic
937094269 2:119225277-119225299 TAATGGGTAAGTGGGCGGGGTGG + Intronic
937751669 2:125482774-125482796 TTGTGGGAAAGGGTGGGAGGGGG - Intergenic
938393162 2:130921021-130921043 TAGTGGGTAGGGCAGGGAGGAGG - Intronic
938968302 2:136407766-136407788 TAGTGTGCAAGGGGGAGCGGGGG - Intergenic
940942252 2:159575158-159575180 TAGTGGGTAATGGGAGTTGGGGG + Intronic
941894426 2:170614924-170614946 TAGTGAGCAAGGGAGGGAGGGGG - Intronic
942970665 2:181954229-181954251 TAGCGGGTAGTGGGGCGCGGGGG - Intronic
943449035 2:188025352-188025374 TTGGGGGTAAGGGTGGGAGGTGG - Intergenic
943973136 2:194437147-194437169 TTGGGGGTAAGGGTGGGCGGGGG - Intergenic
944465659 2:199997196-199997218 TAGTGGGTAGGTGGTAGCGGTGG + Intronic
944669569 2:201983889-201983911 GAGAGGGTAAGGGGTGGCGGTGG - Intergenic
945844122 2:214923218-214923240 TAGTGGGGGAGGGGGAGCAGGGG - Intergenic
946457316 2:219837943-219837965 TACAGGGTATGTGGGGGCGGGGG - Intergenic
947160325 2:227208013-227208035 TCGTGTGTGTGGGGGGGCGGGGG - Intronic
948227562 2:236323340-236323362 AAGTGGGTAAGGGGAGTCTGTGG + Intergenic
1168847437 20:955049-955071 TGGGGGGTAAGGAGGGGCAGCGG + Intergenic
1169368227 20:5008627-5008649 TCGTGGATAAGGGGAGGTGGGGG - Intronic
1170308895 20:14971436-14971458 TAGTAGGTAAAGGGAGGGGGGGG + Intronic
1170823082 20:19770875-19770897 TAGTGGGAAGGTGGGGGGGGGGG - Intergenic
1173313074 20:41917682-41917704 GAGTGGGGAAGGGGGAGGGGAGG + Intergenic
1173644624 20:44625787-44625809 CAGTGGGTCAGTGGGGGAGGAGG - Intronic
1174109963 20:48192219-48192241 GATTGGTTAACGGGGGGCGGGGG - Intergenic
1174287264 20:49482495-49482517 TGGGGGGGCAGGGGGGGCGGGGG - Exonic
1174390101 20:50213749-50213771 TATTGGGTGGGGTGGGGCGGGGG + Intergenic
1174468823 20:50739859-50739881 TAGAGGGGAAGGGTGGGGGGAGG + Intronic
1175237770 20:57525728-57525750 TAATGGATAAGGAGGGGAGGGGG + Intergenic
1175237828 20:57525895-57525917 TAATGGATAAGGAGGGGAGGAGG + Intergenic
1175429572 20:58891860-58891882 TGCTGGGTAAGGGCGGGCGGGGG + Intronic
1175777694 20:61663510-61663532 GAGTGGGTCAGAGGGGCCGGAGG + Intronic
1176172430 20:63702001-63702023 TAGTGGGTGACGGGGGGGGGGGG - Intronic
1176299323 21:5091118-5091140 TAGGGGGTAAGCGGGGGCTGTGG - Intergenic
1177667612 21:24181415-24181437 TAGAGGGTAGGGGGGTGGGGGGG - Intergenic
1179857703 21:44170829-44170851 TAGGGGGTAAGCGGGGGCTGTGG + Intergenic
1181694710 22:24587339-24587361 TAGAGGGTTGGTGGGGGCGGGGG - Intronic
1181729912 22:24837579-24837601 GACTGGGAAAGGGGGGGGGGGGG - Intronic
1182456104 22:30451419-30451441 TGTTTGGTAAGGGGGGGCCGGGG - Intronic
1183237436 22:36630189-36630211 TAGTTTGTAAGGGGTGGCAGTGG + Intronic
1183848425 22:40562629-40562651 AAGGGGGAAAGGGGGGGAGGAGG + Intronic
1185109644 22:48893851-48893873 TAGAGGGTATGGGGAGGCAGAGG + Intergenic
1185153561 22:49180011-49180033 CAGGGGGTACGGGGGGACGGCGG - Intergenic
949627690 3:5886820-5886842 GTGTGTGTATGGGGGGGCGGTGG - Intergenic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
950290200 3:11777919-11777941 AAGTGGGTAATGGGGGGCTTGGG - Intergenic
953598441 3:44338882-44338904 TAGGGGGGAAGCGGGGTCGGAGG + Intronic
955570189 3:60296209-60296231 TAGAGGGGAAGGGGGGAAGGAGG + Intronic
956407296 3:68941170-68941192 GGTTGGGCAAGGGGGGGCGGTGG + Intergenic
956694491 3:71906924-71906946 TAGGGGGAAAGGGGGGAAGGAGG + Intergenic
960272516 3:115690219-115690241 TGGTGGGCAGGGGGTGGCGGGGG - Intronic
961384601 3:126516544-126516566 TAGTGGGCACTGGGGGGAGGGGG - Intronic
961519318 3:127457419-127457441 GAGTGGGGAAGGGCAGGCGGCGG + Intergenic
965496128 3:169401314-169401336 AAGTGGGTCAGGGGTGGGGGTGG - Intronic
966221827 3:177558936-177558958 TCGTGGGGAAGGGTGGGAGGGGG - Intergenic
967858640 3:194135688-194135710 CAGTGGTTAAAAGGGGGCGGGGG - Intergenic
968647985 4:1749412-1749434 TAGTGGGGAAGGGGGAGGTGGGG - Intergenic
968713449 4:2137621-2137643 TAGTGGGTGAGGGGGGCCACGGG - Intronic
968731610 4:2271781-2271803 TAGTGGAGAAGGGGGGCCGTCGG + Intronic
968911973 4:3480999-3481021 CAGAGGGTAAGGGGTGGAGGGGG + Intronic
968912204 4:3482155-3482177 TAGAGGGTAAGCGGTGGAGGGGG - Intronic
969652106 4:8474073-8474095 TGGTGGGGAAGGGGGTGCCGAGG + Intronic
974665585 4:64957108-64957130 GAGTGGGGAGGGGGCGGCGGTGG - Intergenic
975786966 4:77900990-77901012 TAGGGGGTAAGGGAGGGGGAAGG + Intronic
975822893 4:78289821-78289843 TGGTGGGGAAGGTGGGGAGGGGG - Intronic
975858444 4:78649964-78649986 AAGTGGGTAAGAGGTGGTGGAGG - Intergenic
979357441 4:119721616-119721638 TCGTGGGGAAGGGTGGGAGGGGG + Intergenic
981956768 4:150484740-150484762 GAGAGGGTAAGGGGGAGGGGAGG - Intronic
982380700 4:154744486-154744508 TAGTGGGTCAGGTGGGTCCGGGG - Exonic
982678315 4:158400773-158400795 AAGTGGGTGAGGGAGGGAGGAGG + Intronic
982722931 4:158877942-158877964 CGGTGGGTGAGGGGGGGTGGGGG - Intronic
983077476 4:163343867-163343889 CGGTGGGGAAGAGGGGGCGGGGG - Intronic
983247002 4:165298934-165298956 TGGGGGGGGAGGGGGGGCGGGGG - Intronic
984935780 4:184888343-184888365 AAGGGGGTAAGTGGGGGTGGTGG + Intergenic
985651918 5:1111517-1111539 TAGTGGGACAGGGGTGGCGGTGG - Intronic
986382876 5:7204424-7204446 TAGTGAGTAAGGAGGGACTGTGG + Intergenic
987959814 5:24791673-24791695 TTGTGGGGCGGGGGGGGCGGGGG + Intergenic
988797677 5:34666974-34666996 TGGTGGGAATGGGGTGGCGGTGG + Intronic
990467834 5:56086514-56086536 TAGGCGGGAAGTGGGGGCGGGGG - Intergenic
995544390 5:113215463-113215485 TAGTGGTTAAGGGTGGGGGTTGG + Intronic
997258728 5:132449186-132449208 TACTGGGTAGGGGGGTGGGGCGG - Intronic
998166582 5:139847878-139847900 TAGTGGGGCGGGCGGGGCGGAGG + Exonic
1000486304 5:161848501-161848523 TAGTCGGGGGGGGGGGGCGGGGG + Intronic
1004562203 6:16761324-16761346 GCGTGGGGAAGGGGGGGCAGAGG + Exonic
1004989785 6:21124556-21124578 TAGTGGGTAAAGGGAGTGGGAGG - Intronic
1006105468 6:31713744-31713766 CACTGGGTAAGGGTGGGCTGGGG - Exonic
1006271106 6:32968397-32968419 TAGTGGGGGAGGGGGCGCTGAGG + Intronic
1007465520 6:42048729-42048751 AAGTGGGGAAGAGGGGGCGGAGG + Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1017980560 6:159397726-159397748 TAGTGGGTAAGTGGGTAGGGAGG - Intergenic
1019492695 7:1322597-1322619 TCGGGGGTGAGGGAGGGCGGGGG - Intergenic
1020418149 7:7969235-7969257 GAGTGTGTAAGGGGGAGGGGCGG - Exonic
1021528674 7:21618330-21618352 TAGAGGGTAGGGAGGGGCAGAGG + Intronic
1021717259 7:23471129-23471151 GAGTGGGTGAGGGGGGCAGGGGG + Intergenic
1022050021 7:26657739-26657761 CAGTGCGTAAGTTGGGGCGGGGG - Intergenic
1022467361 7:30660796-30660818 TGGTGGGTAAGGGTGGTCAGTGG - Intronic
1024048505 7:45601392-45601414 TTGTGGGTGATGAGGGGCGGTGG + Intronic
1024529051 7:50375703-50375725 TGGTGGGTGGGGGGGGGGGGTGG - Intronic
1024566899 7:50688781-50688803 GGGTGGGTGAGGGGGGGCAGAGG + Intronic
1025065937 7:55856143-55856165 TAGAGGGTGAGGGAGGGAGGGGG - Intronic
1025553605 7:62276567-62276589 TAGGGGGCAAGGAGGCGCGGCGG + Intergenic
1029746026 7:102516325-102516347 CAATGGGGAAGGGAGGGCGGTGG - Intronic
1029763964 7:102615304-102615326 CAATGGGGAAGGGAGGGCGGTGG - Intronic
1030051961 7:105545996-105546018 GGATGGGGAAGGGGGGGCGGGGG + Intronic
1030139908 7:106293738-106293760 CAGTGGGCAGGGTGGGGCGGGGG - Intergenic
1031525117 7:122816170-122816192 TAGTGGGTAAGGGGTGGGTGGGG - Intronic
1031576989 7:123426997-123427019 TTGTGGGGTGGGGGGGGCGGGGG - Intergenic
1032084008 7:128874271-128874293 GAGTGGGTGAGGGGGCACGGCGG - Intronic
1032345235 7:131110252-131110274 AGGGGGGTAAGGTGGGGCGGCGG + Intronic
1032388459 7:131540460-131540482 TGATGGGTATTGGGGGGCGGGGG - Intronic
1032916449 7:136495407-136495429 TAGTGGGGGGGGGGGGGGGGTGG - Intergenic
1032962113 7:137047649-137047671 TTGTGGGGTGGGGGGGGCGGAGG + Intergenic
1033168000 7:139058150-139058172 TAGTGGGGGAGGGTGGGGGGTGG - Intronic
1034990950 7:155548019-155548041 TAGTGGGTCAGAGAGGGCAGAGG - Intergenic
1035413782 7:158667367-158667389 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413854 7:158667569-158667591 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413913 7:158667741-158667763 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413924 7:158667771-158667793 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413945 7:158667830-158667852 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414014 7:158668032-158668054 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414074 7:158668204-158668226 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414104 7:158668291-158668313 TAGTGGGTAAGGGAGGGCCTAGG - Intronic
1035414114 7:158668321-158668343 TTGTGGGTAAGGGAGGGCGGAGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036529848 8:9574870-9574892 GAGTGAGTAAAGGGGGGCGCGGG - Intronic
1036767650 8:11558895-11558917 TACTGGGTAAGGCTGGGCGAGGG - Intronic
1037880982 8:22573233-22573255 TAGTGGGGGAGGGAGGGAGGCGG + Intronic
1038394730 8:27238366-27238388 CAGTGGGTAAAGGGGAGCAGGGG + Intronic
1039588972 8:38730625-38730647 TAGTGGTGAAGGTGGGGCTGGGG + Intronic
1039863221 8:41477445-41477467 AAGTGGGTCAGGGTGGGAGGTGG + Intergenic
1039873023 8:41562922-41562944 TAGGGGGTGAGCGGGGGCAGAGG + Intergenic
1040030479 8:42819374-42819396 TGGTGGGTAAGCGGGGGAGGGGG - Intergenic
1040661577 8:49582255-49582277 TGGTGGGGGTGGGGGGGCGGTGG - Intergenic
1041163868 8:55072292-55072314 CAGGGGGTCAGGGGGGGGGGTGG + Intergenic
1042859436 8:73297614-73297636 TACTGAGTTAGGGGTGGCGGGGG - Intronic
1046968552 8:120194391-120194413 TTGGGGGTAAGGGGGGGCTTGGG - Intronic
1047024583 8:120811889-120811911 AAGTGGGGAAGGGTGGCCGGGGG + Exonic
1047246001 8:123145308-123145330 TGGTGGGAAAGGGTGGGCTGAGG + Intronic
1048244210 8:132775640-132775662 GAGTCGGTAAGAGGCGGCGGCGG + Exonic
1050477226 9:6052919-6052941 TTGTGGGGGGGGGGGGGCGGGGG - Intergenic
1051726180 9:20089683-20089705 TGGTGGGCAGGGGGTGGCGGGGG - Intergenic
1053268190 9:36731209-36731231 TTTTGGGTAAGGGGCGGAGGCGG + Intergenic
1055037964 9:71838417-71838439 GAGTGGGGAACGGGGGGCGGGGG - Intergenic
1055928712 9:81537884-81537906 TAGGGGGAAAGGGTGGGAGGGGG - Intergenic
1059507076 9:114809198-114809220 CAGTGGGTGAGGGGGAGTGGGGG + Intergenic
1059633875 9:116154138-116154160 CAGGGGCGAAGGGGGGGCGGGGG + Exonic
1059887892 9:118767526-118767548 TAGTGGGTAATGGAGGTGGGGGG - Intergenic
1060315180 9:122503199-122503221 TAGTGGCTAAGGCATGGCGGAGG + Intergenic
1061484885 9:130915205-130915227 CAGTGGGAAAGAGGGGGCTGAGG - Intronic
1061732285 9:132625038-132625060 TACTGAGTAAGGGGGTGGGGTGG + Intronic
1062547924 9:137072077-137072099 GTGTGGGGATGGGGGGGCGGGGG - Intergenic
1203787586 EBV:136577-136599 TGGTGGGAAAAGGGGGGCAGCGG - Intergenic
1202630999 M:16250-16272 TAGTGGGTGAGGGGTGGCTTTGG - Intergenic
1185479730 X:437469-437491 GAGTGGGTGGGGGGTGGCGGGGG - Intergenic
1185505762 X:631365-631387 TGGTGGGTAGCGGGGTGCGGGGG + Intronic
1185608539 X:1380661-1380683 TAGGGGGGAAGGGGTGGAGGAGG + Intronic
1186789075 X:12979402-12979424 GAGTGTGTATGGGGGGGAGGTGG + Intergenic
1186933254 X:14418272-14418294 TTGTGGGGAGGGGGGGGAGGGGG - Intergenic
1189864969 X:45318286-45318308 TAGTGGGTGAGTTGGGGAGGTGG + Intergenic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1191726826 X:64290599-64290621 TGGTGGGTATGAGGGGGAGGTGG - Intronic
1194767722 X:97861748-97861770 AAGTGGGTAAAGGAGGGCAGGGG + Intergenic
1194906435 X:99582333-99582355 TTGAGGGAAAGGGTGGGCGGAGG - Intergenic
1194907262 X:99593558-99593580 TTGAGGGAAAGGGTGGGCGGGGG + Intergenic
1195335505 X:103849287-103849309 ATGTGGGTGTGGGGGGGCGGGGG + Intergenic
1198509573 X:137336595-137336617 TAGTGGGAAAGGGGGGATGGTGG + Intergenic
1198533523 X:137566590-137566612 TAGTCGGAAAGGGGTGGCGGCGG - Exonic
1199772126 X:150981849-150981871 GAGTTGGTAAGAGGGGGCGTAGG + Intronic
1199873074 X:151914547-151914569 TAATGGGAAAGGGGAGGCGGTGG - Intronic
1199873601 X:151916591-151916613 TAATGGGAAAGGGGAGGCGGTGG - Intronic
1199874307 X:151919308-151919330 TAATGGGAAAGGGGAGGGGGTGG - Intronic