ID: 1035414095

View in Genome Browser
Species Human (GRCh38)
Location 7:158668262-158668284
Sequence AGGTAGGTAAGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1557
Summary {0: 1, 1: 0, 2: 11, 3: 85, 4: 1460}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035414095_1035414105 10 Left 1035414095 7:158668262-158668284 CCCTCTGCCCTCCTTACCTACCT 0: 1
1: 0
2: 11
3: 85
4: 1460
Right 1035414105 7:158668295-158668317 GGCCCTCCCTTACCCACTACTGG 0: 1
1: 5
2: 4
3: 9
4: 141
1035414095_1035414106 11 Left 1035414095 7:158668262-158668284 CCCTCTGCCCTCCTTACCTACCT 0: 1
1: 0
2: 11
3: 85
4: 1460
Right 1035414106 7:158668296-158668318 GCCCTCCCTTACCCACTACTGGG 0: 6
1: 3
2: 0
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035414095 Original CRISPR AGGTAGGTAAGGAGGGCAGA GGG (reversed) Intronic
900356795 1:2268844-2268866 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
900497094 1:2980698-2980720 AGGGAGGGAAGGGGGGCAGCTGG + Intergenic
900681719 1:3920260-3920282 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
900926747 1:5710750-5710772 AGGAAGGGAAGGAGGGAAGAGGG + Intergenic
900932136 1:5744126-5744148 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
900932143 1:5744146-5744168 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
900932166 1:5744202-5744224 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
900932175 1:5744226-5744248 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
900932200 1:5744286-5744308 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
900970772 1:5991659-5991681 AGGCAGGAAAGGGGCGCAGAAGG + Intronic
901211862 1:7531183-7531205 AGGGAGGGAAGGAGGGAAGGTGG + Intronic
901497798 1:9631960-9631982 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
901559346 1:10057926-10057948 ATGTAGGTAAAGAGAGGAGAAGG + Intronic
901895805 1:12310896-12310918 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
901898523 1:12337029-12337051 AGGGAGGCAGGGAGGGAAGAAGG - Intronic
901938609 1:12645077-12645099 AGGAAGGAAAGGAGCGGAGAAGG - Intronic
902289475 1:15427094-15427116 AGGGAGGGAAGGAGGGGAGCCGG - Intronic
902407704 1:16194662-16194684 AGGCAGGAAAGGAGGGAGGAAGG + Intergenic
902464410 1:16607158-16607180 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
902790780 1:18766389-18766411 GGGTAGGTGAAGAGGGCAGAGGG + Intergenic
902914800 1:19630655-19630677 AGCTAGGCTAGGAGGGGAGAAGG + Intronic
903010771 1:20328546-20328568 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
903299716 1:22370150-22370172 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
903369175 1:22824266-22824288 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
903474115 1:23607629-23607651 AGATGGGGAAAGAGGGCAGAAGG - Intronic
903749190 1:25609613-25609635 AGGATGGTAAGAAGGGCTGAAGG - Intergenic
904203872 1:28839874-28839896 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
904215273 1:28914362-28914384 AGGCCGGTAAGGAGAGGAGAGGG - Intronic
904353604 1:29924558-29924580 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
904784065 1:32972657-32972679 AGGTAGGTAAGGTAGAAAGAGGG + Intergenic
904918088 1:33984817-33984839 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
905191449 1:36238205-36238227 AGGAAGCTGAGGTGGGCAGATGG - Intronic
905197919 1:36295604-36295626 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
905258361 1:36700275-36700297 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
905418425 1:37821069-37821091 AGGAAGCTAAGGTGGGAAGATGG + Intronic
905662349 1:39737309-39737331 AGGTGGGAAAGGTAGGCAGAGGG - Intronic
905681233 1:39872817-39872839 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
905753411 1:40486393-40486415 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
905815752 1:40949446-40949468 AGGTAAGGAGGGAGGGCAAAGGG + Intergenic
905921540 1:41722545-41722567 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
906282701 1:44565292-44565314 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
906315437 1:44784156-44784178 CGGGAGGGAAGGAGGGCAGTGGG + Exonic
906529152 1:46513244-46513266 AGGGAGGCAGGCAGGGCAGAAGG - Exonic
906558917 1:46739566-46739588 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
906702166 1:47867501-47867523 AGGAAGGTGAGAAGGACAGAGGG + Intronic
906794970 1:48689487-48689509 AGGAAGGGAAGAAGGACAGAAGG - Intronic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907474910 1:54699256-54699278 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
907492858 1:54820048-54820070 AGATAGGGAGGGAGGGAAGAAGG - Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
907589008 1:55647745-55647767 TGGGAGGTGAGGAGGGGAGAAGG + Intergenic
907644896 1:56232577-56232599 AGTTAGACAAGAAGGGCAGAGGG - Intergenic
907728114 1:57039351-57039373 AGGAAGGAAGGGAGGGCAGGAGG + Intronic
908216969 1:61964073-61964095 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
908789753 1:67769965-67769987 TGGGAGGGAAGGAGGGGAGATGG + Intronic
908811020 1:67982402-67982424 AGGTCGCTAAGGAAGGCAAAAGG - Intergenic
908871390 1:68616791-68616813 AGGCAGGCAAATAGGGCAGATGG + Intergenic
908921752 1:69202771-69202793 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
909005060 1:70265923-70265945 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
909184634 1:72470976-72470998 AGGTAGGTAAGAAGTGTAGAAGG - Intergenic
909721040 1:78769784-78769806 CGGAAGCCAAGGAGGGCAGATGG - Intergenic
909745842 1:79096261-79096283 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
909829209 1:80164541-80164563 AGGGAGGGAGGGAGGGGAGATGG - Intergenic
910229075 1:84967851-84967873 AGGGAGGGAAGGAAGGAAGAAGG + Intronic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
910363246 1:86436356-86436378 AGGGAGGTAGGGAGGGAGGAAGG - Intronic
910937344 1:92495241-92495263 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
911090613 1:94014264-94014286 AGGAAGGGAAGGAGGGACGAAGG + Intronic
911094395 1:94044041-94044063 AGGGAGGGAGGGAGGGGAGAAGG - Intronic
911094405 1:94044069-94044091 AGGGAGGGAGGGAGGGGAGAAGG - Intronic
911204482 1:95078683-95078705 AGGTAGTGATGGAAGGCAGATGG + Intergenic
911708593 1:101043048-101043070 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
912065552 1:105736472-105736494 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
912556084 1:110517144-110517166 AGGGAGGAAGGGAAGGCAGAAGG + Intergenic
913063610 1:115229924-115229946 AGGGAGGTGAGGAGGAGAGAGGG - Intergenic
913305413 1:117425144-117425166 AGGAAGAAAAGGAGGGCAAAGGG + Intronic
913502038 1:119480335-119480357 AGGGAGGGAAGGAGGGAAGAAGG + Intergenic
913555559 1:119963149-119963171 AGGAAGGGAAGAAGGGAAGAAGG + Intronic
913558057 1:119989045-119989067 AGGTAGGTAAGAAGGGAGGTAGG + Intronic
913601050 1:120421439-120421461 AGGAAGGGAGGGAAGGCAGAAGG - Intergenic
913976677 1:143464004-143464026 AATTACGTAGGGAGGGCAGAAGG + Intergenic
914003560 1:143713020-143713042 AGGCAGCTGAGGAGGGAAGAAGG - Intergenic
914071078 1:144289621-144289643 AATTACGTAGGGAGGGCAGAAGG + Intergenic
914086003 1:144455190-144455212 AGGAAGGGAGGGAAGGCAGAAGG + Intronic
914108077 1:144676734-144676756 AATTACGTAGGGAGGGCAGAAGG - Intergenic
914240298 1:145848625-145848647 AGATTGGGAAGGAGGGCACAGGG + Exonic
914362266 1:146945083-146945105 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
914454393 1:147822325-147822347 TGGTAGGAAGGTAGGGCAGAGGG - Intergenic
914489436 1:148142075-148142097 AGGAAGGGAGGGAAGGCAGAAGG + Intronic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915315208 1:155024662-155024684 AGGTAGGTAGTGGGTGCAGAGGG - Intronic
915343001 1:155186387-155186409 AGGGAGTGAAGGAGAGCAGAGGG - Intronic
915440534 1:155942790-155942812 AGGTTGGTGAGCAGGGTAGAAGG - Exonic
915650795 1:157309043-157309065 AGGGAGGGAAGGAAGGAAGAGGG - Intergenic
915716573 1:157950168-157950190 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
915847681 1:159285097-159285119 AGGTGAGTTAGGAGGGGAGATGG + Intergenic
916242756 1:162656577-162656599 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
916276423 1:162998979-162999001 AGGTAGATGAGAAGGGAAGAAGG + Intergenic
916608796 1:166369620-166369642 AAGGAGGAAAGGAGGGCAGGAGG - Intergenic
916740660 1:167644548-167644570 AGGGAGGGAAGGAGAGCAGATGG + Intronic
916834969 1:168534187-168534209 AGGAAGGAAAGGAAGGCAGAAGG - Intergenic
916991372 1:170249208-170249230 AGGGAGGGAAGGAGTGGAGAAGG - Intergenic
917234160 1:172872862-172872884 GGGGAGGGAAGGAGGGAAGAAGG - Intergenic
917393795 1:174569303-174569325 AGGAAGGGAAGAAGGTCAGATGG - Intronic
917562032 1:176168479-176168501 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
917845635 1:179018014-179018036 AGCTAGCTAAGAAGGCCAGAGGG + Intergenic
917904118 1:179572775-179572797 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
918018273 1:180659446-180659468 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
918131954 1:181637419-181637441 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
918857754 1:189780666-189780688 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
918876152 1:190046330-190046352 AGGGAGTGAAGGAGGGGAGAGGG + Intergenic
919320431 1:196030161-196030183 AGGCAGCTAGGGAGGGAAGATGG + Intergenic
919348021 1:196411117-196411139 AGGTAGGAAAGAAGGGAGGAAGG - Intronic
919353791 1:196495492-196495514 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
919502994 1:198361657-198361679 AGGAAGGGAAGAAGGGCAGGAGG - Intergenic
919574947 1:199296126-199296148 AGGAAGGTGAGGAGAGCGGAGGG + Intergenic
919613137 1:199771979-199772001 AGGAAGGGAAGAAGGGAAGAAGG + Intergenic
919801973 1:201359566-201359588 AGGTAGGGAAGGAGGGGGCAGGG + Intronic
919820299 1:201468297-201468319 AGGGAGGGAAGGAGAGAAGAGGG + Intronic
919847710 1:201651918-201651940 AGGGAGGAAAGGAGGGGAGTTGG + Intronic
919911522 1:202113789-202113811 AGGTATGTGAGGATGGCAGCAGG - Intergenic
920634450 1:207686083-207686105 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
920664331 1:207950219-207950241 AGGTAGGTTTGGATGGTAGAGGG + Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921598112 1:217076968-217076990 AAATAGGTAAGGGGGGAAGAAGG + Intronic
921630863 1:217432157-217432179 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
921942144 1:220853472-220853494 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
922172112 1:223164440-223164462 AGGAAGGGAAGGAGGGGACAGGG + Intergenic
922232935 1:223702032-223702054 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
922244839 1:223786001-223786023 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
922871446 1:228905186-228905208 AAGTAGATGAGGAAGGCAGAAGG + Intergenic
922887018 1:229028178-229028200 AGGCAGGGAAGGAGAGGAGAGGG + Intergenic
922945254 1:229508444-229508466 AGGTAGGTCGGGAAGGCAGCCGG + Intergenic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923250956 1:232179272-232179294 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
923332954 1:232942558-232942580 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
923614334 1:235524434-235524456 AGGCGGGGAGGGAGGGCAGAAGG + Intergenic
923784464 1:237054188-237054210 AGGGAGGAAAGAAGGGAAGAAGG - Intronic
924202585 1:241675120-241675142 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
924298618 1:242614140-242614162 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
924402807 1:243705607-243705629 AGGTGAGTAAGGAAGGCACAGGG + Intronic
924602576 1:245504383-245504405 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
924664620 1:246058325-246058347 AGGTGGGGGAGGAGGGCAGGAGG + Intronic
924681366 1:246237431-246237453 AGGTAGCTTAGGAGGGCTGCTGG + Intronic
924728711 1:246692735-246692757 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1062843133 10:686484-686506 ATGCAGGTAAGGAGGCCACACGG - Intronic
1062922863 10:1293084-1293106 AGGGAGGAAAGGAGGGAAGGGGG + Intronic
1062989462 10:1802598-1802620 GGTTAGATAAGGAGGCCAGAAGG + Intergenic
1063014978 10:2067011-2067033 AGGTAGATAGGGAAGCCAGAAGG - Intergenic
1063193326 10:3718064-3718086 AGGGAGGGAAGGAGGGAAGTGGG + Intergenic
1063289961 10:4735108-4735130 AGGGAGGGAAGGAGGGAATAAGG - Intergenic
1063625154 10:7682213-7682235 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1064142161 10:12799451-12799473 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1064210512 10:13357239-13357261 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1064235845 10:13574412-13574434 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1064587652 10:16854897-16854919 AGGAAGGAAAGGAGGGAGGATGG - Intronic
1064677349 10:17774772-17774794 AGGTAGGGAAGGAGGGAGGGAGG - Intronic
1064703981 10:18051192-18051214 AGGGAGGGAAGGATGGAAGAGGG + Intergenic
1064717144 10:18188275-18188297 AGGAAGGAAAGGAGGCAAGAAGG - Intronic
1065233469 10:23622403-23622425 AGGTGGGGAAGGTAGGCAGAGGG - Intergenic
1065494976 10:26318535-26318557 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1065689134 10:28315339-28315361 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1065784850 10:29203652-29203674 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1065791305 10:29263265-29263287 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1065846838 10:29751576-29751598 AGGCAGGTCAGGTGGGCAGCTGG + Intergenic
1065874186 10:29982977-29982999 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1066011191 10:31195062-31195084 AGGTATGTAAGGACGTCAGGAGG + Intergenic
1066021066 10:31302723-31302745 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1066370617 10:34815493-34815515 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1066375879 10:34857293-34857315 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1066487041 10:35856155-35856177 AGGGAGGGAAGGAGGAGAGAGGG - Intergenic
1066497874 10:35959862-35959884 AGGGAGGGAAGGAAGGAAGAAGG - Intergenic
1066761923 10:38763083-38763105 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1066959667 10:42209376-42209398 AGGGAGGGAAGGAGGAAAGAAGG - Intergenic
1067280626 10:44869408-44869430 AGGGAGGGAGGGAGGGGAGACGG + Intergenic
1067921812 10:50466328-50466350 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1068051614 10:51957182-51957204 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1068194137 10:53694399-53694421 AGGGAGGTTAGGAGGGTAGGAGG + Intergenic
1068329239 10:55539039-55539061 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1068731829 10:60366638-60366660 AGGAAGGGAAGGAGGAAAGAGGG + Intronic
1068850352 10:61731742-61731764 AGGAAGGGAGGGAGGACAGAGGG + Intronic
1068945988 10:62729278-62729300 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1069414421 10:68185155-68185177 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1069746194 10:70716492-70716514 AGCAAGGGAAGGAGAGCAGATGG + Intronic
1069855838 10:71440598-71440620 GGCCAGGAAAGGAGGGCAGAGGG - Intronic
1070318710 10:75338240-75338262 AGTGAGGGAAAGAGGGCAGAAGG - Intergenic
1070513697 10:77184100-77184122 AGGAAGGTGAGGAGAGTAGATGG - Intronic
1070597904 10:77845589-77845611 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1070657042 10:78278774-78278796 AGGGAGGTAAGGAGGGAGGAAGG - Intergenic
1070729146 10:78813413-78813435 AGGTAGGTGGGGAGGGGACAGGG - Intergenic
1070837491 10:79459097-79459119 AGGTAGTTAAGGAACGAAGAGGG - Intergenic
1071444829 10:85736016-85736038 AGGGAGGGAAGGAGGGAAGTAGG + Intronic
1071481070 10:86065403-86065425 AGGTAGAGAAGGGTGGCAGAGGG - Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072454943 10:95567513-95567535 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1072537975 10:96377689-96377711 AGGCAGGTGAGGAGGGCCGGGGG + Intronic
1072662803 10:97373011-97373033 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
1072754735 10:98011775-98011797 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1073049765 10:100660003-100660025 AGGGAGGTTAGAGGGGCAGATGG + Intergenic
1073443271 10:103565178-103565200 GGGCAGGTCAGGAGGGCAGCTGG + Intronic
1073638310 10:105221957-105221979 AGTTAGGAAAGGAGGGAAAAAGG + Intronic
1073662650 10:105493877-105493899 AGGAAGGGAAGGAGGGAAGAAGG + Intergenic
1074002435 10:109386714-109386736 AGGGAGGGAGGGAGGGGAGAGGG + Intergenic
1074210654 10:111331050-111331072 AGGAAGGGAAGAAGGGAAGAAGG - Intergenic
1074326405 10:112455373-112455395 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074326431 10:112455428-112455450 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1074326488 10:112455642-112455664 AGGAAGGGAGGGAGGGGAGAAGG - Intronic
1074478640 10:113796998-113797020 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1074514192 10:114149659-114149681 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
1074797906 10:116967573-116967595 AAGTAAATAAAGAGGGCAGAAGG - Intronic
1074827932 10:117228274-117228296 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1074857245 10:117482443-117482465 AGGGAGGGAGGGAGGGCAGGTGG + Intergenic
1074886633 10:117699205-117699227 ATGGAGGAAAGGTGGGCAGAGGG + Intergenic
1075026458 10:118987844-118987866 AGGGAGGGAAGGAGGGGGGAAGG + Intergenic
1075044998 10:119139730-119139752 AGGCTGGTAAGGTGGGGAGAGGG + Intergenic
1075065596 10:119287147-119287169 AGGGAGGGAAGGAGAGAAGAAGG + Intronic
1075646495 10:124100220-124100242 TGGCAGAAAAGGAGGGCAGAGGG - Intergenic
1075656299 10:124163346-124163368 AGGAAGGAAAGGAGGGAGGAGGG + Intergenic
1075962994 10:126585394-126585416 AGGAAGAAAAGGAGGGAAGAAGG + Intronic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076108094 10:127840431-127840453 AGGTCGGTAAGGATGGTGGAGGG + Intergenic
1076193288 10:128498045-128498067 AGGGAGGTAGGGAGGTCCGAGGG + Intergenic
1076296139 10:129386353-129386375 AGGGAGGGAAGGAAGGGAGAGGG + Intergenic
1076558725 10:131347081-131347103 AGGAAGGAAGGGAGGGGAGAAGG - Intergenic
1076681334 10:132173081-132173103 AGAGAGGGAAGGAGGGGAGAGGG - Intronic
1076804805 10:132850013-132850035 GAGTAGGCAAGGAGGGCAGGCGG - Intronic
1076843315 10:133057124-133057146 AGGCAGGTGAGGAGGGCGGGAGG + Intergenic
1076846389 10:133071479-133071501 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077015946 11:399295-399317 AGGTGGAGAAGGGGGGCAGATGG - Intronic
1077067943 11:652643-652665 AAATAGAGAAGGAGGGCAGAAGG + Intronic
1077070320 11:667401-667423 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1077272194 11:1686659-1686681 AGGGAGGCAGGGAGGGAAGAAGG - Intergenic
1077272285 11:1686934-1686956 AGGGAGGCAGGGAGGGAAGAAGG - Intergenic
1077480484 11:2812302-2812324 AGGGAGGGAAGGAGGGAAGGGGG - Intronic
1077787636 11:5401963-5401985 AGGGAGGGAAGGAGGAAAGAAGG - Intronic
1077888747 11:6404070-6404092 AGGAAGGCAGGGAGGGAAGAAGG + Intronic
1078040374 11:7856098-7856120 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1078064971 11:8072305-8072327 AGGAAGGGAAGGAAGGGAGAGGG - Intronic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078326568 11:10386349-10386371 AGGGAGGCAAAGAGGGCAAAGGG - Intronic
1078929843 11:15904611-15904633 AGGAAGGTAAGGAAGACAGGAGG + Intergenic
1079522338 11:21342681-21342703 AGATAGGAAAGGAAGGAAGAGGG + Intronic
1079629799 11:22659915-22659937 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1079956051 11:26866067-26866089 AGGAAGGAAGGGAGGGAAGACGG + Intergenic
1079964394 11:26963197-26963219 AAGGAGGAAAGGAGGGCAGGAGG + Intergenic
1080156635 11:29118761-29118783 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1080545098 11:33309269-33309291 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
1080928684 11:36784896-36784918 AGGCAGGGAAGGAGGGGAGAGGG - Intergenic
1080941391 11:36922154-36922176 AGGTATGCAAGGAGGGAAGAGGG - Intergenic
1081589406 11:44410604-44410626 AGGTAGGCAAGGAGGGAGAAAGG + Intergenic
1081632988 11:44701938-44701960 AGGTAGATGTGGTGGGCAGAAGG - Intergenic
1081643558 11:44774633-44774655 AGGGAAATAAGGAGGGAAGAAGG - Intronic
1082266966 11:50129640-50129662 AGTTAGGAAATGAGGGGAGATGG + Intergenic
1082289123 11:50348928-50348950 AGTTAGGAAATGAGGGGAGATGG - Intergenic
1083109477 11:60390893-60390915 AGAAAGGAAGGGAGGGCAGAAGG + Intronic
1083138921 11:60705413-60705435 AGGAAGGTCATGAGGGCTGAAGG - Intronic
1083174003 11:60938197-60938219 AGGCAGGTGAGCAGGGCAGAGGG - Intronic
1083186198 11:61019354-61019376 AGGTAGAGCAGGAGGCCAGAGGG - Exonic
1083316908 11:61821003-61821025 AGGTGGGTAAGGAGATGAGAGGG - Intronic
1083427574 11:62596527-62596549 GGGTAGCTAAGGGGGGCAGAGGG + Exonic
1083584557 11:63847322-63847344 TGGTAGGAGAGGAGGGGAGATGG + Intronic
1083620591 11:64047492-64047514 AGGCAGGTGAGGAGGGCTCAGGG - Intronic
1083763568 11:64831762-64831784 AGGAAGGGAGGGAGGACAGATGG - Intronic
1083849305 11:65355721-65355743 AGCTAGGAAAGGAGCGCAGGAGG - Intronic
1083883895 11:65561395-65561417 AGGGAGGTCAGGAATGCAGAAGG + Intergenic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084125134 11:67094399-67094421 AGGGAGGGAGGGAGGGGAGAAGG + Intergenic
1084526032 11:69698534-69698556 AGGCATGTGAGGTGGGCAGAGGG + Exonic
1085189187 11:74602999-74603021 AGTAAGTTAAGGAGGACAGAGGG - Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085806723 11:79643263-79643285 AGGAAGGAAGGGAGGGAAGAGGG + Intergenic
1086307157 11:85493773-85493795 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1086307162 11:85493789-85493811 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
1086450362 11:86909412-86909434 ATGAAAGTAAGCAGGGCAGAGGG + Intronic
1086803878 11:91214743-91214765 AGGGAGGGAAGGAGGGAAGAAGG + Intergenic
1087115058 11:94515739-94515761 AGAAAGGAAAGGAGGGGAGAGGG - Intergenic
1087123966 11:94604749-94604771 AGGGAGGTAAGAAGGGTAGATGG - Intronic
1087237169 11:95733036-95733058 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1087237366 11:95734860-95734882 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
1087720662 11:101661908-101661930 AGGAAGGTAAGAAGGTAAGAAGG - Intronic
1087906097 11:103699699-103699721 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1087919123 11:103846296-103846318 AGGAAGGGAGGGAGGGCGGAAGG - Intergenic
1087919139 11:103846336-103846358 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1087973216 11:104511718-104511740 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1088063388 11:105685140-105685162 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1088453437 11:110007548-110007570 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088488029 11:110359823-110359845 AGGGAGGGAAGGAGGAGAGAAGG - Intergenic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1088652641 11:111971973-111971995 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1088695480 11:112362482-112362504 AAGTAGGAAATGAGGGCAGGGGG + Intergenic
1088735535 11:112724975-112724997 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1089297824 11:117480594-117480616 AGGGAAGTGAGGAGGGCAGCAGG + Intronic
1089395037 11:118131204-118131226 TGGTAAGGAAGGAGGGTAGATGG - Intergenic
1089733734 11:120535387-120535409 AGGGAGGGAAGGAGGGAAGAAGG + Intronic
1089747739 11:120628861-120628883 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1090134525 11:124183547-124183569 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1090288031 11:125517183-125517205 AAGGAGGAAAGGAGGGCAGCTGG - Intergenic
1090488209 11:127133971-127133993 AGAAAGGGAAGGAGGGCAGTAGG + Intergenic
1090549775 11:127807143-127807165 AGGGAGGAAAGGAGAGGAGAAGG - Intergenic
1090632563 11:128662961-128662983 GGTTAGGGAGGGAGGGCAGAAGG - Intergenic
1090634649 11:128683392-128683414 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1091539582 12:1447409-1447431 AGGTAGTTAAGGTGGGAGGATGG + Intronic
1091542255 12:1472710-1472732 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1091583420 12:1802272-1802294 AGGTCAGTTAGGAGGGCAGGTGG - Intronic
1091635803 12:2195631-2195653 ATGAAGGCAAGGAGGACAGATGG + Intronic
1091675601 12:2486809-2486831 AGGTGGGGGAGGAGGGCAGGTGG + Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1092092196 12:5812326-5812348 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1092113327 12:5980205-5980227 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1092179172 12:6433599-6433621 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1092281478 12:7101125-7101147 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1092525118 12:9305141-9305163 AGGAAAGCAAGGAGGGCAAAGGG - Intergenic
1092542148 12:9426677-9426699 AGGAAAGCAAGGAGGGCAAAGGG + Intergenic
1093131802 12:15400510-15400532 AACTAGGTAAGGATGGCAGTGGG - Intronic
1093363200 12:18257731-18257753 AGGGAGGGAAGGAAGGAAGAAGG + Intronic
1093366316 12:18303251-18303273 AGGGAGGGAAGGAAGGAAGAAGG - Intronic
1093959845 12:25260276-25260298 AGGGTGGCAAGGAGGGAAGAAGG - Intergenic
1094510864 12:31095756-31095778 AGGAAAGCAAGGAGGGCAAAGGG - Intronic
1094578621 12:31712061-31712083 AGGTAGGGAAGGAGGGAGGGAGG - Intronic
1094589074 12:31804405-31804427 TGGGAGGGAAGGAGGGCAGAAGG - Intergenic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095251854 12:39988660-39988682 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1095700912 12:45190051-45190073 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1095700925 12:45190087-45190109 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1095803798 12:46296473-46296495 AGGGAGGTAAGGAGGGCACCAGG - Intergenic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096310403 12:50515589-50515611 AGGAAGGTTAGGAAGCCAGAAGG - Intronic
1096670454 12:53195524-53195546 AGGTCTGGAAGGAGGGCATATGG + Intronic
1096753341 12:53777641-53777663 TGGTATGTTAGGAGGCCAGAAGG + Intergenic
1096767039 12:53899521-53899543 AGGGAGGAAAGGAGGGGAGGAGG + Intergenic
1096781508 12:53994820-53994842 AGGGAGGGAAGGAGGGCGGGCGG + Intronic
1097475013 12:60042677-60042699 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1097602180 12:61706792-61706814 AGGAAGGAAGGGAGGGAAGAAGG + Intergenic
1097721049 12:63021765-63021787 AGGGAGGGAAGGAGGGAAGGGGG + Intergenic
1098216405 12:68224726-68224748 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1098521769 12:71440843-71440865 AGGGAGGGAAGGAAGGAAGAAGG - Intronic
1098529948 12:71530435-71530457 AGGATGGTAAAGAGGGCATATGG + Intronic
1099168745 12:79338653-79338675 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1099325062 12:81204384-81204406 AGAGAGGTAAGGAGGAAAGAAGG - Intronic
1099533160 12:83812463-83812485 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1099620270 12:84995194-84995216 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1099770063 12:87040938-87040960 AGTGAAATAAGGAGGGCAGATGG + Intergenic
1100065715 12:90641497-90641519 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1100346213 12:93734052-93734074 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1100515447 12:95323112-95323134 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1100522045 12:95384666-95384688 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1100587139 12:95990781-95990803 AGGGAGGAAAGGAGGGCTGGAGG + Intronic
1100643252 12:96503019-96503041 AGGAAGGAAAGGAAGGGAGAGGG - Intronic
1100748059 12:97667300-97667322 AGGAAGGAAGGGAGGGAAGAGGG + Intergenic
1100787096 12:98089963-98089985 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1100850518 12:98705201-98705223 AGATTGCTAAGGATGGCAGAGGG - Intronic
1100877150 12:98974807-98974829 AGGTAGGCAAGGAGACAAGAAGG - Intronic
1101036131 12:100708476-100708498 AAGAAAGTAAGGAGGGAAGAAGG - Intergenic
1101259568 12:103014403-103014425 AGGAAGGAAAGGAGGGGAAAAGG - Intergenic
1101348536 12:103907090-103907112 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1101760082 12:107651251-107651273 AAGGAGGAAAGGAGGACAGATGG + Intronic
1101913094 12:108875420-108875442 AGGCAGGCAAGGAGGGAAGAAGG - Intronic
1101952425 12:109187092-109187114 AGGAAAGGAAGGAGGGAAGAGGG + Intronic
1101985570 12:109443925-109443947 CGCTAGGGGAGGAGGGCAGATGG - Intronic
1102513295 12:113429962-113429984 AGGGAGGGAGGGAGGGAAGAGGG - Intronic
1102625246 12:114229815-114229837 GGATAGGGAAGGAGGACAGAAGG + Intergenic
1102717425 12:114986386-114986408 AGGGAGGAAAGGAGGGAAAAAGG - Intergenic
1102754163 12:115323303-115323325 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1102900052 12:116629387-116629409 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1103102373 12:118189772-118189794 AGGAAGGGAAGGTGGGTAGAGGG + Intronic
1104207108 12:126649723-126649745 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1104222932 12:126803241-126803263 AGGCAGGTAAGGATGGGAAATGG + Intergenic
1104463254 12:128971585-128971607 AGAGAGGAAAGGAGGGAAGAAGG - Intronic
1104668902 12:130667145-130667167 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
1105222556 13:18345815-18345837 AATTACGTAGGGAGGGCAGAAGG - Intergenic
1106154055 13:27135820-27135842 AGCTAGCTAGGGAGGGGAGAAGG + Intronic
1106584141 13:31042856-31042878 AGGTAGGTGTGGAGGGTGGAAGG + Intergenic
1106631026 13:31473687-31473709 AGGGAGGGAAGAAGGGCTGAAGG + Intergenic
1106806725 13:33316149-33316171 AGGTTGGAGAGGAAGGCAGAAGG - Intronic
1107199328 13:37695171-37695193 AGGAAGGAAAGAAGGGAAGAAGG - Intronic
1107788514 13:43977867-43977889 AGGTAGGGACGGAGGGAGGAAGG - Intergenic
1108046441 13:46388288-46388310 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1108291042 13:48961409-48961431 AGGAAAGAAAGGAGGGAAGAAGG + Intergenic
1108822334 13:54368646-54368668 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1108822342 13:54368670-54368692 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1109119472 13:58435998-58436020 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1109211787 13:59543704-59543726 AGGGAGGGAGGGAGGGCAGAAGG + Intergenic
1109281086 13:60356440-60356462 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1109624861 13:64961893-64961915 ATTTAGGAAAGGAGGGAAGATGG + Intergenic
1109971743 13:69779396-69779418 GGGAAGGAAAGGAGGGAAGAGGG - Intronic
1110347785 13:74468184-74468206 AGGTGTGTAATGAGGTCAGAGGG + Intergenic
1110552856 13:76827898-76827920 AGGGAAGGAAGGAGGGAAGAGGG + Intergenic
1110552903 13:76828016-76828038 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1110641545 13:77830244-77830266 AGAAAGGGAAGGAGGGAAGAAGG - Intergenic
1110846510 13:80195832-80195854 AGGATGGGAGGGAGGGCAGAAGG + Intergenic
1110985729 13:81965677-81965699 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1111118279 13:83811162-83811184 TGGTAGGTATGAAGGGCAGATGG - Intergenic
1111363627 13:87210819-87210841 AGGAAGATAGGGAGGGAAGAAGG - Intergenic
1111446178 13:88348054-88348076 AGGCAGGGAGGGAGGGAAGAAGG + Intergenic
1111541917 13:89679691-89679713 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1111699919 13:91673837-91673859 AGGAAAGAAAGGAGGGAAGAGGG - Intronic
1111792020 13:92869538-92869560 AGGAAGGAAAGGAGGGAGGAGGG + Intronic
1111834259 13:93368308-93368330 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
1112108981 13:96273920-96273942 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1112138150 13:96606624-96606646 AGGGAGGGAGGGAGGGCTGAGGG + Intronic
1112350181 13:98626430-98626452 AGGGAGGCAAGGAGAGGAGAGGG + Intergenic
1112927422 13:104693755-104693777 AGGTGGAAAAGGAAGGCAGAAGG + Intergenic
1113074222 13:106452041-106452063 AGGGAGGAAAGGAGGAGAGAGGG + Intergenic
1113420761 13:110170034-110170056 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1113430672 13:110247850-110247872 AGGGAGGGAGGGAGGGGAGAAGG + Intronic
1113598892 13:111554472-111554494 AGGGAGGAGAGGAGGCCAGATGG - Intergenic
1113680661 13:112242106-112242128 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1114339148 14:21724660-21724682 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1114361213 14:21975298-21975320 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1114452339 14:22835731-22835753 AGGTATGTAGGGAAGGGAGAGGG - Intergenic
1114635128 14:24182959-24182981 AGGAAGGTGAGCAGGGCAGGTGG - Exonic
1115149171 14:30264012-30264034 AGGGACGGAAGGAGGGAAGAAGG + Intergenic
1115356569 14:32454672-32454694 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
1115356606 14:32454764-32454786 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
1115644906 14:35362272-35362294 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1115945866 14:38659712-38659734 AGGTAGGTAGGTGGTGCAGATGG - Intergenic
1116200043 14:41781513-41781535 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1116375836 14:44199544-44199566 AGGGAGGGAAGGAGGGAAGAGGG + Intergenic
1116974118 14:51096244-51096266 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1117124511 14:52607634-52607656 AGGAAGCCAAGGTGGGCAGATGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117359527 14:54959406-54959428 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1117480494 14:56139201-56139223 AGGAAGGAAAGGAAGACAGATGG + Intronic
1117508142 14:56422968-56422990 AGGAAGAACAGGAGGGCAGAGGG + Intergenic
1117575172 14:57090913-57090935 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1117857709 14:60052206-60052228 AGGGAGGGAAGAAGGGAAGAAGG + Intronic
1118322513 14:64761573-64761595 AGGTAGGGATGCAGGGCAGAAGG + Intronic
1118336602 14:64858611-64858633 AGACAGGAAAGGAGGGAAGAAGG + Intronic
1118795480 14:69139859-69139881 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1118920561 14:70145958-70145980 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1119089278 14:71765732-71765754 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1119431207 14:74569149-74569171 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1119593892 14:75916196-75916218 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1119610414 14:76056982-76057004 ATGAAGGTTATGAGGGCAGAAGG - Intronic
1120575497 14:86175709-86175731 AGGAAGAGAAGGAGGGGAGAGGG + Intergenic
1120749745 14:88186606-88186628 AGAAAGGCAGGGAGGGCAGAAGG - Intronic
1120873798 14:89360595-89360617 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1120909734 14:89655386-89655408 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
1120928113 14:89818466-89818488 AGGGAGGAAGGGAGGGAAGAAGG + Intronic
1121612807 14:95293144-95293166 AGAGAGGGAAGGAGGGAAGAAGG - Intronic
1121795648 14:96733178-96733200 AGGTGGGTAAAGATGGCAGGAGG - Intergenic
1121971332 14:98359235-98359257 AGGGAGGGAAGGAAGGAAGAAGG - Intergenic
1122031238 14:98914182-98914204 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1122068592 14:99190619-99190641 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1122874068 14:104655180-104655202 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
1123395766 15:19933483-19933505 AGGAAGAAAAGGAGGGCAGGAGG + Intergenic
1123520243 15:21065059-21065081 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1123579307 15:21702444-21702466 AGGAAGGGCAGGAGGGAAGAGGG + Intergenic
1123615934 15:22144955-22144977 AGGAAGGGCAGGAGGGAAGAGGG + Intergenic
1123833992 15:24169426-24169448 AGGCAGATAAAAAGGGCAGAGGG + Intergenic
1123849781 15:24342991-24343013 AGGCAGATAAAAAGGGCAGAGGG + Intergenic
1124803702 15:32860222-32860244 AGGTAGGAAGGGAGGGAGGAAGG + Intronic
1125716451 15:41822462-41822484 AGGTAGGCAAGGAGGGGAGAAGG - Intronic
1125932291 15:43609106-43609128 TGGAAGGAAAGGAGGGCAAAGGG + Intronic
1125933578 15:43616601-43616623 AGGCAGTGAAGGAGGGCAGGGGG + Exonic
1125945387 15:43708578-43708600 TGGAAGGAAAGGAGGGCAAAGGG + Intergenic
1125946676 15:43716063-43716085 AGGCAGTGAAGGAGGGCAGGGGG + Intergenic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1126862595 15:52901546-52901568 AGAAAGGTAATGAGGGAAGAAGG - Intergenic
1126999381 15:54483872-54483894 AGGTAGGTAAAAAGGTGAGAGGG - Intronic
1127007016 15:54582027-54582049 AGGAAGGAAAGGAGGAGAGAAGG + Intronic
1127070223 15:55281706-55281728 AGGAAGGGAAGGAAGGGAGAAGG + Intronic
1127259785 15:57319525-57319547 AGGGAGGGAAGGAGGGGAGCAGG - Intergenic
1127320169 15:57836349-57836371 AGGCAGGTAGGAAGGGGAGAAGG + Intergenic
1127476872 15:59342690-59342712 AGATAGGAAAGAAGGACAGAAGG - Intronic
1127507512 15:59610746-59610768 AGGGAGGTAAGGAGGGAAGGAGG - Intronic
1127534206 15:59874838-59874860 GGGCAGGTAGGGAGGGCAGGAGG - Intergenic
1127574482 15:60277297-60277319 AGGTGGGAAAGGATGGGAGAGGG + Intergenic
1127660804 15:61098268-61098290 AGGCAGGGAAGGAGGGAAGAAGG - Intronic
1127897055 15:63310472-63310494 AGGTTGGAAAGGAGAGAAGAAGG + Intergenic
1128155960 15:65392117-65392139 AGCTAGGTGAGGAGGGCTGGGGG - Exonic
1128365004 15:66993321-66993343 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1129180967 15:73875290-73875312 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
1129332457 15:74834641-74834663 AGGTAGGTGTGGAGAGCAGTGGG - Intergenic
1129519363 15:76176291-76176313 AGGAAGGAACTGAGGGCAGAGGG - Intronic
1129880970 15:79005797-79005819 AGGAGGGGAAGGAGGACAGAAGG - Intronic
1129933127 15:79428504-79428526 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1130042550 15:80417565-80417587 AGGGAGGAAGGGAGGGGAGAAGG - Intronic
1130147044 15:81282391-81282413 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
1130150831 15:81310319-81310341 AGGAAGGTTAGGAGCCCAGATGG - Exonic
1130839216 15:87682050-87682072 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
1130877609 15:88028166-88028188 AGGGAGGGAGGGAGGGCACAAGG + Intronic
1130959894 15:88652541-88652563 AGGAAGGGGAGGAGGGCAAAGGG - Intronic
1130980487 15:88808857-88808879 AGTTAGGTAGGCAGTGCAGAGGG + Intronic
1130993345 15:88889943-88889965 AGGAAGGGAGGGAGGACAGAAGG + Intronic
1131009391 15:89004603-89004625 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1131085435 15:89572136-89572158 AGGAATGGAAGGAGGGCAGTGGG - Intergenic
1131492620 15:92876107-92876129 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1131527964 15:93167650-93167672 AGAGAGGGAAGGAGGGAAGAAGG - Intergenic
1131528084 15:93168034-93168056 AGGGAGGGAGGGAGGGAAGAGGG - Intergenic
1131588530 15:93722423-93722445 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1131588565 15:93722507-93722529 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1131609049 15:93941646-93941668 AGGTAGGTGAGGAAGACAGTGGG - Intergenic
1131778586 15:95829215-95829237 AGGGAGGCTAGGAGGGCAGAGGG - Intergenic
1131810039 15:96163606-96163628 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1131810055 15:96163654-96163676 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG + Intergenic
1132399296 15:101495738-101495760 AGGTAGGGAAGGAGGGAAAGGGG + Intronic
1202988177 15_KI270727v1_random:436689-436711 AGGAAGGGCAGGAGGGAAGAGGG + Intergenic
1132999383 16:2841416-2841438 AGGGATGTCAGAAGGGCAGAGGG - Intergenic
1133002392 16:2857957-2857979 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1133118889 16:3594414-3594436 AGAGAGGAAAGGAGGGCACACGG + Intronic
1133402668 16:5500133-5500155 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1133562179 16:6960562-6960584 AAGGAGGTAAGAAGGGCACAGGG - Intronic
1133601150 16:7341751-7341773 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
1133839262 16:9394033-9394055 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1133873215 16:9708986-9709008 ACCTAGGTCAGGAGGCCAGAAGG + Intergenic
1133909268 16:10050163-10050185 AGGGAGGTAGAAAGGGCAGAGGG + Intronic
1134291714 16:12907045-12907067 AGGGAGGGAAGGAGGGAAGGGGG - Intronic
1134371506 16:13630211-13630233 GGGAGGCTAAGGAGGGCAGATGG - Intergenic
1134375536 16:13669339-13669361 AAGGTGGTCAGGAGGGCAGATGG + Intergenic
1134417408 16:14056315-14056337 AGGAAGGAAAGGAGGAAAGAAGG - Intergenic
1134459900 16:14421874-14421896 AGGGAGGGAAGGAGGGATGAAGG - Intergenic
1134691262 16:16192246-16192268 AGGCAGGGAAGGAGGGGAGATGG + Intronic
1134829143 16:17309409-17309431 AGGCAGGGATGGAGGGGAGAGGG + Intronic
1134861003 16:17560668-17560690 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1135200751 16:20436142-20436164 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1135263918 16:21005246-21005268 AGGGAGGGAAGGAAGGAAGAAGG - Intronic
1135263928 16:21005295-21005317 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
1135491466 16:22913169-22913191 AGGGAGGGAGGGAGGGCGGAAGG + Intronic
1135494450 16:22939354-22939376 AGATAGGAAAGGAGGGCAGGAGG - Intergenic
1135495740 16:22949680-22949702 AGGAAGGAAAGAAGGACAGAAGG + Intergenic
1135873431 16:26173794-26173816 GGGAGGCTAAGGAGGGCAGATGG + Intergenic
1135887707 16:26326504-26326526 AAGGAGGAAAGGAGGGAAGAAGG + Intergenic
1136178553 16:28535254-28535276 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
1136333476 16:29596351-29596373 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1136333482 16:29596371-29596393 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1136399434 16:30009841-30009863 AGGTAGGGGAGGAGGGCAGTGGG - Intronic
1136475434 16:30510279-30510301 AGGTAGGCCAGGAGGGCTGGTGG + Intronic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1137741393 16:50779557-50779579 AGGGAGGTCAGGTGGGCAGTTGG + Intronic
1137896372 16:52217056-52217078 AGGTAGTGGAGGGGGGCAGAAGG + Intergenic
1137931307 16:52590052-52590074 AGGAAGGTAAGAAGGGAGGAGGG + Intergenic
1138134936 16:54513276-54513298 TGGTAGGTGGGGAAGGCAGATGG - Intergenic
1138164451 16:54788077-54788099 AGGAAAGAAAGGAGGGAAGAAGG - Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138218536 16:55227349-55227371 AGAGAGGGAAGGAGGGCAGGAGG - Intergenic
1138264152 16:55647412-55647434 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1138264154 16:55647420-55647442 AAGGAGGGAAGGAGGGAAGACGG + Intergenic
1138335907 16:56252744-56252766 AGGAAGGTTGGGAGGGGAGAAGG - Intronic
1138621244 16:58212973-58212995 AGGGAGGAAATGAGGGAAGAGGG + Intergenic
1138708762 16:58945152-58945174 AGGTAGACAAGAAGGGCTGATGG - Intergenic
1138972060 16:62157317-62157339 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1139028996 16:62855931-62855953 AGGGAGGGAAGGAGAGAAGAAGG + Intergenic
1139210021 16:65067981-65068003 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
1139398229 16:66658214-66658236 AGGTAGGGAGGGAGGGAAGGAGG + Intronic
1139398232 16:66658222-66658244 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1139486963 16:67263253-67263275 AGGTAGATGAGGAGGGCAGATGG + Intronic
1139574131 16:67830734-67830756 AGGTAAGCAAGGAGGGCTGTAGG - Intronic
1139711550 16:68780150-68780172 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1139970954 16:70774720-70774742 AGGGAGGGAGGGAGGGGAGAGGG - Intronic
1140171988 16:72615383-72615405 AGGTAGGAGAGGAGTACAGAAGG + Intergenic
1140186745 16:72780327-72780349 AGTGAGGTAATGAGGGGAGAAGG - Intergenic
1140231016 16:73117203-73117225 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1140257487 16:73349684-73349706 AGGGAGGGAAGGAAGGGAGAGGG - Intergenic
1140257503 16:73349727-73349749 AGGGAGGGAAGGAAGGGAGAGGG - Intergenic
1140338095 16:74130676-74130698 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1140732876 16:77872231-77872253 AGGTGGGTACGCAGGGGAGAGGG - Intronic
1140733321 16:77875831-77875853 AGGGAGGTTAGGAGGGAGGAAGG + Intronic
1140833791 16:78774999-78775021 AGGTAGGTAAGTTGGGCAGATGG + Intronic
1140895039 16:79317352-79317374 AGGGAGAAAAGGAGGGAAGAAGG - Intergenic
1141123195 16:81378785-81378807 AGATAGGAAAGGAGGGAAGGAGG - Exonic
1141193623 16:81842873-81842895 GGGTAGGCAGGGAGGGCTGAGGG + Intronic
1141348472 16:83270891-83270913 AGGAAGGAAAGGAGGGAGGAAGG - Intronic
1141427096 16:83951757-83951779 AGGGAGGGAAGGAGGGTGGAAGG - Intronic
1141473977 16:84259529-84259551 GGGGAGGTAATGAGGTCAGAGGG - Intergenic
1141516280 16:84547431-84547453 AGGAAAGCAAGGAGGGAAGAGGG + Intronic
1141603113 16:85138016-85138038 AGGTAGGGAGGGAGGGAGGAAGG - Intergenic
1141713988 16:85716536-85716558 AGGGAGGGAAGGAGGACAGAGGG + Intronic
1141790119 16:86228697-86228719 AGGTAGGTAGGGAGGGAGGGAGG - Intergenic
1142526259 17:543842-543864 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1142554193 17:761952-761974 AGGTGGGAAAGAAGGTCAGAGGG + Intronic
1142781328 17:2183238-2183260 AGGCAGGAAGGGAGGGAAGAAGG + Intronic
1143193473 17:5057682-5057704 CGGCAGGTAGGGAGGGCATATGG + Intergenic
1143375263 17:6463440-6463462 AGGGAGGCAGGGAGGGAAGAAGG + Intronic
1143647024 17:8237268-8237290 ATGTAGGAAAGGAGGACAGCTGG - Intronic
1143733644 17:8895471-8895493 AGCAGGGTCAGGAGGGCAGAGGG - Intronic
1143794796 17:9327886-9327908 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1143869782 17:9949846-9949868 AGGGAGGGAGGGAGGGCAGGAGG - Intronic
1143958358 17:10693334-10693356 AGGGTGCTAAGGAGGGCAGCTGG + Intronic
1143963421 17:10738980-10739002 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1144439500 17:15268803-15268825 AGGCAGGGAAAGAAGGCAGAGGG + Intergenic
1144560987 17:16320244-16320266 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1145308693 17:21689501-21689523 AGGGAGGCAAGGACAGCAGATGG - Intergenic
1146184686 17:30717212-30717234 AGGGAGGCCAGGAGGCCAGAAGG + Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146493936 17:33303697-33303719 AGGAAGGGAAGGAGGGTAGATGG - Intronic
1146705289 17:34996733-34996755 AGGTTGGAAAGGAGGGTACAGGG + Intronic
1146932439 17:36786941-36786963 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1146944551 17:36864766-36864788 AGGAAGGAAAGGAGGGAGGAGGG - Intergenic
1147425328 17:40343440-40343462 TGGAAGGTTAGGATGGCAGACGG - Intronic
1147617408 17:41837699-41837721 GGGGTGGTAAGGAGGGGAGAAGG + Intronic
1148026495 17:44592723-44592745 AGGGAGGTAGGGAGGGAAGAAGG + Intergenic
1148033817 17:44642552-44642574 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1148074256 17:44926503-44926525 AGGGAGGAAAGGAGGGAAGGTGG + Intronic
1148203334 17:45764296-45764318 AGGGAGGAAAGGAAGGAAGAGGG + Intergenic
1148255197 17:46125030-46125052 AGGTAGGGAGGGAGGGAGGAGGG + Intronic
1149007722 17:51822792-51822814 AGGCAGAAAAGGAGGGAAGAAGG + Intronic
1149289972 17:55208560-55208582 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1149333599 17:55611045-55611067 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1149428972 17:56581701-56581723 AGGAAAGTAAGGAAGGCAGGAGG + Intergenic
1150424825 17:65068978-65069000 AGGAAGGAAAGGATGGGAGAGGG - Intergenic
1150521988 17:65878209-65878231 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1151100505 17:71550805-71550827 AGGGAGGGAAGGAGGGGAAAGGG + Intergenic
1151355926 17:73558431-73558453 AGGAAGGGAGGGAGGGGAGAGGG + Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151758578 17:76088304-76088326 AGGAAGGAAAGGAAGGCACATGG + Intronic
1151761586 17:76106672-76106694 AGGGAGGAAAGGAGGTAAGAAGG + Intronic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152003223 17:77660329-77660351 AGGAAGGGAAGGAGGAAAGAAGG - Intergenic
1203173072 17_GL000205v2_random:169457-169479 AGGAATATATGGAGGGCAGAAGG + Intergenic
1153514762 18:5892990-5893012 AGGGAGGAAAGAAGGCCAGAAGG - Intronic
1153574140 18:6504049-6504071 AGGAAGGAAAGGAGGGAAAAAGG + Intergenic
1153800133 18:8661387-8661409 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1155140521 18:23040142-23040164 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1155241429 18:23867137-23867159 AGGAGGGTGGGGAGGGCAGAGGG - Intronic
1155730965 18:29157506-29157528 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1155813783 18:30276329-30276351 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1156071955 18:33222312-33222334 AGGAAGGAAGGGAGGGAAGAAGG - Intronic
1156146963 18:34194405-34194427 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1156183441 18:34633546-34633568 AGGCAGGTCGGGATGGCAGAGGG + Intronic
1156276548 18:35589071-35589093 AGGTTGGTGGGGAGGGCACATGG + Intronic
1156472483 18:37386330-37386352 AGGTAAGTAAGGAGGAAATAAGG + Intronic
1156524439 18:37753418-37753440 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1156595890 18:38547211-38547233 AGGAAGGGAAGGTGGGCTGAAGG - Intergenic
1156702531 18:39842196-39842218 AGGAAGTTAAGGAGGGGAGGGGG + Intergenic
1156719725 18:40055285-40055307 AGGAAAGTAAAGAGGGCATAGGG + Intergenic
1156925852 18:42577552-42577574 AGATATGTCAGGAGGGCAGGTGG + Intergenic
1157220365 18:45825124-45825146 AGGTAGGAAAGGAGGGAGGGAGG + Intergenic
1157367708 18:47081071-47081093 ATGGAGGGAAGGAGGGAAGAAGG - Intronic
1157596327 18:48866227-48866249 TGGGAGGTGAGGAGGTCAGAGGG - Intergenic
1158103842 18:53861531-53861553 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1158103851 18:53861554-53861576 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1158153112 18:54394441-54394463 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1158611125 18:58941975-58941997 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
1159015566 18:63099424-63099446 AGGAGGTGAAGGAGGGCAGAAGG + Intergenic
1159139310 18:64373463-64373485 AGGTAGGGACGGAGGGAGGAAGG - Intergenic
1159355997 18:67338040-67338062 AGGGAGGTAGGGAGGGAAGGAGG - Intergenic
1159356114 18:67338437-67338459 AGGGAGGAAAGGAGGGAAGAAGG - Intergenic
1159512633 18:69416067-69416089 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1159847816 18:73486952-73486974 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1160118296 18:76103084-76103106 AGTTAGGAATGGAGGCCAGAGGG + Intergenic
1160377550 18:78424772-78424794 AGGTAGGAGAGAAGGGCAAAAGG - Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1161141653 19:2651436-2651458 AGGGAGGAAAGGAAGGCAGGAGG - Intronic
1161257485 19:3317386-3317408 AAGAAGCTAAAGAGGGCAGAGGG + Intergenic
1161260112 19:3332944-3332966 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1161306650 19:3572750-3572772 AGGTTGGTAAGGAAGGCTGCGGG - Intronic
1161468630 19:4445598-4445620 GAGAAGGTCAGGAGGGCAGAGGG + Exonic
1161600568 19:5179855-5179877 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1161610220 19:5238155-5238177 AGGCAGGTGAGGTGGGGAGACGG + Intronic
1161631065 19:5355813-5355835 AGAGAGGAAAGGAGGGGAGAGGG - Intergenic
1161827849 19:6581046-6581068 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161935264 19:7368004-7368026 AGGGAGGGAGGGAGGGCGGAAGG + Intronic
1162030067 19:7913446-7913468 AGTCAGGGATGGAGGGCAGAGGG + Exonic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162338983 19:10080052-10080074 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1162364168 19:10237989-10238011 AGGTAGGAATGGGGGTCAGAGGG - Intergenic
1162533931 19:11252267-11252289 GGGCAGGTAGGGAGGGCTGAGGG + Intronic
1162626857 19:11891410-11891432 AGGGAGGGAAGGAAGGAAGAAGG + Intronic
1162872749 19:13598656-13598678 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1162974097 19:14198481-14198503 AGGGAGGCCAGGAGGCCAGAAGG - Intronic
1163004762 19:14390136-14390158 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1163790359 19:19302661-19302683 GGGTAGGGCAGGAAGGCAGATGG + Intronic
1163825229 19:19519774-19519796 AGGCAGGAGAGGAGGACAGAGGG - Intronic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1164522248 19:28988457-28988479 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1164581641 19:29438743-29438765 AGGGAGAGAAGGAGGGGAGAAGG + Intergenic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1164667361 19:30050445-30050467 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1164744105 19:30598960-30598982 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
1164768707 19:30791642-30791664 TGCTAGAGAAGGAGGGCAGAAGG - Intergenic
1164794401 19:31014581-31014603 AGGGAGAGAAGGAGGGGAGACGG + Intergenic
1164975629 19:32570953-32570975 AGGTAGGAAGGGAGGGAAGGAGG - Intergenic
1165762435 19:38329568-38329590 AAAGAGGGAAGGAGGGCAGAGGG + Intergenic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1166062441 19:40335019-40335041 AGGAAGGGAAGGAGGGAAGGAGG + Intronic
1166291969 19:41869209-41869231 AGATGGGTAAGCAGGGTAGAGGG + Exonic
1166347780 19:42177049-42177071 AGGGAGGAAGGGAGGGCAGGCGG + Intronic
1166475340 19:43119647-43119669 AGGGAGGAAAGGAGGAGAGAAGG - Intronic
1166548561 19:43649575-43649597 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1166707250 19:44914812-44914834 AGGGAGGTAGGGAGGGAGGAGGG + Intronic
1166948086 19:46409251-46409273 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1167303943 19:48696278-48696300 AGGGAGCTAAGGAGGGCGGCTGG - Intronic
1167390293 19:49190384-49190406 AGGGAAGAAAGGTGGGCAGAGGG - Intronic
1167393615 19:49212640-49212662 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167476272 19:49703128-49703150 AGGTAGGAAAGGAGGGAGGGAGG - Intronic
1167506012 19:49871509-49871531 GGGGAGGTAGGGAGGGCAGCTGG - Intronic
1167789716 19:51666669-51666691 AGGTAGGAAGGGAGGGAGGAAGG + Intergenic
1167792655 19:51690991-51691013 AGGTTGGGAAGGAGGGAAGGGGG + Intergenic
1168109044 19:54181632-54181654 AGGGAGGGAAGGAGTGAAGAAGG + Intronic
1168109144 19:54181900-54181922 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1168725043 19:58576380-58576402 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1168726519 19:58585687-58585709 AGGGAGGTAGGAAGGGAAGAAGG - Intergenic
925013564 2:504413-504435 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
925173537 2:1767182-1767204 AGCCAGGGCAGGAGGGCAGAAGG - Intergenic
925222161 2:2150851-2150873 GGGAAGGGAAGGAGGGAAGAAGG + Intronic
925721443 2:6832031-6832053 AGGTCAGGGAGGAGGGCAGAAGG + Intergenic
925794523 2:7527879-7527901 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
925799446 2:7583458-7583480 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
926124722 2:10265138-10265160 AGGGAGGCAAGGAGAGGAGAGGG - Intergenic
926191577 2:10732206-10732228 AGGGAGGGATGGAGGGAAGAAGG - Intronic
926269441 2:11354261-11354283 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
926700250 2:15798680-15798702 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
926809897 2:16746659-16746681 AGGGAGGTGGGGAGGGAAGACGG - Intergenic
926828801 2:16937236-16937258 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
926918927 2:17919908-17919930 AGGTTGGTAAGGAGGAGACATGG + Intronic
926926935 2:17996414-17996436 AGGCATGTAAGGATGGAAGAAGG + Intronic
926974020 2:18495364-18495386 AGGGAGGGAGGGAGGGCGGAAGG - Intergenic
927158563 2:20236509-20236531 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
927347525 2:22063675-22063697 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
927464306 2:23325481-23325503 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
927708093 2:25309324-25309346 AGGGAAGGAAGGAGGGCAGGAGG + Intronic
927877882 2:26670826-26670848 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
927915641 2:26934373-26934395 ACTTAGGCAAGGAGGACAGAGGG - Intronic
928164794 2:28962812-28962834 AGGGAGGAAAGGAGGGAAGGAGG - Intronic
928182744 2:29080923-29080945 AGGGAGGCCAGGAGGGCTGAGGG - Intergenic
928387673 2:30884019-30884041 AGGGAGGTATGCAGGGCAGGTGG + Intergenic
928426608 2:31183779-31183801 AGGAAGGAAAGGAGGGAAGAAGG - Intronic
928426623 2:31183834-31183856 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
928572937 2:32627107-32627129 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
929342208 2:40834258-40834280 AGGGAGGAAGGGAGGACAGATGG - Intergenic
929375835 2:41285917-41285939 AGGTAGATAAGGATGCCAAATGG + Intergenic
929455052 2:42059577-42059599 AGCTAGGGAAGGAGGCCCGAGGG - Intergenic
929484112 2:42339564-42339586 AGGGAGGGAGGAAGGGCAGAAGG - Intronic
929615744 2:43305945-43305967 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
929617763 2:43325554-43325576 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
929624295 2:43390529-43390551 AGATAGGAGAGGAGGGCAGTTGG - Intronic
929635895 2:43520938-43520960 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
929792172 2:45031428-45031450 AGGCTGGTGAGGATGGCAGAAGG - Intergenic
930083801 2:47477897-47477919 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
930110627 2:47675787-47675809 AGGGAGGCAGTGAGGGCAGATGG + Intergenic
930219752 2:48734576-48734598 AGGAAAGGAAGGAGGGAAGAAGG - Intronic
930266073 2:49200637-49200659 AGGGAGGTTAGGAGGGCTCAAGG - Intergenic
930312223 2:49755878-49755900 AGGGAGGGAAGGGGGGAAGAGGG + Intergenic
930352647 2:50277396-50277418 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
930372846 2:50526007-50526029 TGGGAGGTGAGGAGGGTAGAGGG - Intronic
930406267 2:50960326-50960348 AAGGAGGGAAGGAGGGAAGAAGG - Intronic
930406269 2:50960334-50960356 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
930503983 2:52258781-52258803 AGGCAGGGAAATAGGGCAGATGG - Intergenic
930654188 2:53992034-53992056 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
931228169 2:60351792-60351814 AAGCAGGTGAGGAGGGCAGTCGG - Intergenic
931928021 2:67096369-67096391 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
932071612 2:68626361-68626383 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
932379041 2:71265253-71265275 AGGAAGGGAAGGAGGGGAGGAGG - Intergenic
932455823 2:71849346-71849368 AGGTCGGAAAGGAGGGCGTAGGG + Intergenic
932457835 2:71860925-71860947 AGGCAGGGGAGGAGGACAGATGG + Intergenic
932464028 2:71901969-71901991 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
932750781 2:74370350-74370372 AGGGATGTGAGGAAGGCAGAAGG + Intronic
933362734 2:81308463-81308485 AGGGAGGGAGGGAGGGAAGAGGG - Intergenic
933485838 2:82922536-82922558 AGGAAGGTAAGGAGGGAAGTTGG + Intergenic
934036918 2:88095932-88095954 AGGTAGTTAGCAAGGGCAGATGG - Intronic
934139464 2:89031663-89031685 ATATAGGTCAGGTGGGCAGAGGG + Intergenic
934181377 2:89624967-89624989 AATTACGTAGGGAGGGCAGAAGG + Intergenic
934249410 2:90336350-90336372 AGGAAGAAAAGGAGGGCAGGAGG - Intergenic
934260169 2:91467116-91467138 AGGAAGAAAAGGAGGGCAGGAGG + Intergenic
934291679 2:91699209-91699231 AATTACGTAGGGAGGGCAGAAGG + Intergenic
934944988 2:98534372-98534394 AGGAAGGTAAGGAGAGCACCAGG + Intronic
935077005 2:99755236-99755258 ATGAAGGTAGGGAGGGCAGGAGG - Intronic
935077145 2:99756188-99756210 ATGAAGGTAGGGAGGGCAGGAGG - Intronic
935210226 2:100933294-100933316 AGGTAGGTAGAGAGAGGAGAAGG + Intronic
935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG + Intronic
935282920 2:101534557-101534579 AGGGGGGTAGGGAGGGCAGGTGG + Intergenic
935330699 2:101975359-101975381 ACGGATATAAGGAGGGCAGAAGG - Intergenic
935400107 2:102651363-102651385 AGGTAAGAAATGAGGACAGAGGG - Intronic
935438975 2:103069326-103069348 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
935646964 2:105345524-105345546 AGGAAGGGAGGGAGGGAAGAAGG - Exonic
935667520 2:105525476-105525498 AGGGAGGTGGGGAGGGCTGAGGG + Intergenic
935788614 2:106571002-106571024 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
935999363 2:108811143-108811165 AGGGGGGTAGGGAAGGCAGAGGG - Intronic
936416705 2:112322108-112322130 AAGGAGGGAAGGAGGGAAGACGG - Intronic
936722312 2:115267574-115267596 AGGTAGGCAAGGAGAGGAGAGGG - Intronic
937089344 2:119195737-119195759 AGGGAGGGAGGGAGGGAAGAGGG + Intergenic
937089395 2:119195914-119195936 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
937569685 2:123341077-123341099 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938126853 2:128680421-128680443 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
938206940 2:129432003-129432025 AGGAAGGCAAGCCGGGCAGAGGG + Intergenic
938582821 2:132662576-132662598 AGGAAGGTAGGGAGGGCGGGCGG + Intronic
938642038 2:133291431-133291453 CGGGAGGAAAGGAGAGCAGAGGG + Intronic
938677065 2:133647546-133647568 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
938739844 2:134220701-134220723 AGGAGGGTGAGGAGGGGAGAAGG - Intronic
939280472 2:140057914-140057936 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
939520315 2:143222320-143222342 AGTTAGGTAACAAAGGCAGATGG + Intronic
939738492 2:145879260-145879282 AGGGAGGATGGGAGGGCAGATGG + Intergenic
940291676 2:152083371-152083393 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
940356634 2:152750507-152750529 AGGAAGGGAGGGAGGGCGGAAGG + Intronic
940417995 2:153444192-153444214 AGGTAGGTAGGTAGGTCAGCGGG - Intergenic
940482058 2:154245427-154245449 AGGGAGGTAAGAAGGGATGATGG - Intronic
940656132 2:156489849-156489871 AGGAAGGAAGGGAGGGAAGAAGG - Intronic
940888405 2:159011638-159011660 AGGAGGCTAAGGAGGGAAGATGG - Intronic
941180207 2:162250638-162250660 AGGTAGGTAAGGTAGACAGAGGG + Intergenic
941282276 2:163567894-163567916 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
941339305 2:164286966-164286988 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
941600389 2:167536317-167536339 AGGCAGGGAGGGAGGGAAGAGGG + Intergenic
941882906 2:170499914-170499936 AGGGAGGGAGGGAGGGGAGAAGG - Intronic
941886122 2:170529413-170529435 AGGGAGAGAAGGAGGACAGAAGG - Intronic
942615018 2:177782755-177782777 AAGTAGGGAAGAAGGGAAGAGGG - Intronic
943499205 2:188666056-188666078 AGGGAGGGAAGGAGGGAAGGGGG - Intergenic
943809904 2:192171966-192171988 AAGTAGCTGAGGAGGGAAGAAGG - Intronic
944171422 2:196783257-196783279 AGGAAGGGAAGGAGGGAAGGAGG + Intronic
944183784 2:196926289-196926311 GGGGAGGTGAGGGGGGCAGAAGG + Intronic
945097196 2:206231020-206231042 AGGGAGGGAAGGAAGGAAGAAGG - Intergenic
945546884 2:211165756-211165778 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
945677628 2:212875116-212875138 AGGCAGGGAGGGAGGGCAGAAGG - Intergenic
945962423 2:216149488-216149510 AGGTAGATAAGGATAGCAGGGGG - Intronic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
946159934 2:217829919-217829941 AGGCAGGAAAGAAGGGCAGGTGG + Intronic
946276229 2:218633852-218633874 AGGTAGCTAAGGAGAGATGAAGG + Intronic
946360318 2:219215817-219215839 ACTTAGGTAATGCGGGCAGAGGG - Intronic
946552972 2:220823513-220823535 AGGTAGGGAGGGAGGGAGGAGGG - Intergenic
946553108 2:220823912-220823934 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
946686968 2:222280298-222280320 AGGGAGGGAAGGAGGGAGGAGGG + Intronic
946730772 2:222707293-222707315 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
946766048 2:223041972-223041994 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
946872403 2:224096319-224096341 AGGCAGGCTAGGTGGGCAGAGGG + Intergenic
946934682 2:224707967-224707989 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
947006035 2:225512556-225512578 AGGAAAGGAAGGAGGGAAGAAGG - Intronic
947029919 2:225782538-225782560 AGGAAGGGAGGGAGGGCAGAAGG - Intergenic
947077051 2:226355952-226355974 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
947077898 2:226364345-226364367 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
947436578 2:230078256-230078278 AGAAAGGTAGGGAGGGCAGAAGG - Intergenic
947909151 2:233790371-233790393 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
948019002 2:234714966-234714988 TGGGAGGTAGGGAGGGCTGAGGG + Intergenic
948080327 2:235200334-235200356 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
948724248 2:239922041-239922063 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
1168744113 20:221470-221492 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1169007649 20:2222088-2222110 AGGAAGGTCATGTGGGCAGAGGG - Intergenic
1169363015 20:4967458-4967480 AAGAAGGTAAGGAAGGAAGATGG - Intronic
1169673577 20:8131475-8131497 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1170020675 20:11833897-11833919 AGGGAGGAAAGTAGGGAAGAAGG + Intergenic
1170210299 20:13840771-13840793 AGGCAGGTAGGGTGGGAAGAGGG + Intergenic
1170369446 20:15632802-15632824 AGGGAGGAAAGGAGGACAGCAGG - Intronic
1170502242 20:16986680-16986702 AGAGAGGGAAGGAGGGAAGAAGG + Intergenic
1170522079 20:17197154-17197176 AGGGAAGGAAGGAGGGAAGAAGG + Intergenic
1170613165 20:17930089-17930111 TGGGAGGTCAGGAGGGCAGGTGG - Intergenic
1170631749 20:18072333-18072355 AGGGAGGGAAGGAGGGAGGAGGG - Intergenic
1170813929 20:19696984-19697006 AGGGAGGGAAGGAAGGCAGGAGG + Intronic
1170907522 20:20529088-20529110 AGGCAGGAGAGGAGGGCAGTGGG + Intronic
1170953359 20:20956280-20956302 AGGAAGGGAAGGGGGGCAGCAGG + Intergenic
1171042641 20:21779643-21779665 AGATAGGAAAAGAGGGAAGAGGG - Intergenic
1171202681 20:23254679-23254701 AGGGAAGGAAGGAGGGAAGAAGG + Intergenic
1172171656 20:32939001-32939023 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
1172298317 20:33829886-33829908 AGGAAGGGAAGAAGGGCAGATGG + Intronic
1172448021 20:35003192-35003214 ATGTAGCTAACGAGAGCAGAGGG + Exonic
1172537963 20:35688791-35688813 AGGGAGGCAGGGAGGGAAGAAGG + Intronic
1172782713 20:37446755-37446777 AGGAAAGAAAGGAGGGAAGAAGG - Intergenic
1172938888 20:38641110-38641132 AGGTAGGTAGGTAGGTCATATGG + Intronic
1173096088 20:40029716-40029738 AGGAAGGGAAGGAGGGGAGAAGG + Intergenic
1173522888 20:43712306-43712328 TGTTAGGTAAGGAGGGGAGGTGG + Intronic
1173650203 20:44658835-44658857 TGGTAGGTGAGGAGGGTATATGG + Intergenic
1173687065 20:44931163-44931185 AGGGAGGAAGGGAGGGAAGAAGG - Intronic
1173929143 20:46804042-46804064 AGGCAGGAAGGAAGGGCAGAAGG + Intergenic
1174019817 20:47520891-47520913 AGGTAGCTATGGAACGCAGAGGG + Intronic
1174140835 20:48412574-48412596 AGGAAGGGAGGGAGGGAAGATGG - Intergenic
1174164548 20:48575622-48575644 AGGGAGGGAAGGAGGAAAGAAGG + Intergenic
1174346300 20:49932602-49932624 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1174692038 20:52515967-52515989 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1174701236 20:52611238-52611260 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1174819106 20:53712143-53712165 AGGGAAGTAGGGAGGGAAGAAGG - Intergenic
1174869343 20:54168787-54168809 AGGGAGGGAGGGAAGGCAGAAGG - Intronic
1175078236 20:56393850-56393872 AGGCAGGTAAGGAAAGCACAGGG + Intronic
1175271536 20:57737501-57737523 AGGGAGGAAAGGAAGGAAGAAGG - Intergenic
1175499862 20:59442102-59442124 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1175583398 20:60118128-60118150 AGGTGGGTAATGATGGCAGTTGG + Intergenic
1175666378 20:60863730-60863752 AGGAAGGAAGGAAGGGCAGATGG + Intergenic
1175920622 20:62449076-62449098 AGGGAGGTGAGTAGGGCAGGAGG - Intergenic
1176221412 20:63970798-63970820 AGGAAGGAAAGGAAGGAAGAAGG - Intronic
1176221440 20:63970915-63970937 AGGAAGGAAAGGAAGGAAGAAGG - Intronic
1176329055 21:5531099-5531121 AGGAATATATGGAGGGCAGAAGG + Intergenic
1176398702 21:6289852-6289874 AGGAATATATGGAGGGCAGAAGG - Intergenic
1176438455 21:6699252-6699274 AGGAATATATGGAGGGCAGAAGG + Intergenic
1176462717 21:7026322-7026344 AGGAATATATGGAGGGCAGAAGG + Intergenic
1176486278 21:7408100-7408122 AGGAATATATGGAGGGCAGAAGG + Intergenic
1176731105 21:10498239-10498261 AATTACGTAGGGAGGGCAGAAGG - Intergenic
1177097370 21:16853143-16853165 AGGAAGGGAAGGAGGGAAGTAGG + Intergenic
1177237357 21:18409898-18409920 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178251815 21:31010368-31010390 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1178379128 21:32093542-32093564 AGGGAGGGAAGGAAGGAAGAGGG - Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178532947 21:33390256-33390278 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1178741599 21:35206799-35206821 AGGAAGGAAAGAAGGACAGAAGG - Intronic
1178762209 21:35413831-35413853 AAGAAGGGAAGGAGGGAAGAGGG + Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178830000 21:36048066-36048088 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1178876703 21:36419642-36419664 ATTTAGGTAAGGAGGGCCAAGGG - Intergenic
1179050621 21:37885901-37885923 AGGCAAGTTTGGAGGGCAGAAGG - Intronic
1179291326 21:40020701-40020723 AGGTAGGTGAGCAGGGCAGAAGG - Intronic
1179296820 21:40070243-40070265 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1179296847 21:40070334-40070356 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1179365229 21:40752800-40752822 AGGAAGGAAAGGAGGAGAGAAGG + Intronic
1179375550 21:40847121-40847143 AGGCAGGGAAGGTTGGCAGAGGG - Exonic
1179525515 21:41973671-41973693 AGGTAGGTCAGGAGGACACGAGG - Intergenic
1179564725 21:42240095-42240117 AGGCAGGAGAGGAGGGCAGGTGG + Intronic
1179875112 21:44263118-44263140 AGGAAGGTGGGGTGGGCAGAGGG + Intergenic
1180094746 21:45550829-45550851 AGGGAGGCAGGGAGGGGAGATGG - Intergenic
1180892238 22:19297516-19297538 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1180945699 22:19691966-19691988 AGGCAGGTCAGCAGGGAAGAAGG - Intergenic
1181042939 22:20201437-20201459 AGGGAGGGAGGGAGGGAAGAGGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181736084 22:24882656-24882678 AGGAAGGGAAGGAGGTCAGAAGG - Intronic
1181747849 22:24968189-24968211 AGGTAGGGAAGGGGGGCGGCGGG + Intronic
1181969477 22:26679478-26679500 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1182025688 22:27116709-27116731 AGGTAGGAAAGGAGGAAGGATGG + Intergenic
1182050694 22:27310582-27310604 AGGGAGGGAAGGAGGGGGGAGGG + Intergenic
1182050704 22:27310601-27310623 AGGGAGGGAAGGAGGGGGGAGGG + Intergenic
1182050714 22:27310620-27310642 AGGGAGGGAAGGAGGGGGGAGGG + Intergenic
1182164728 22:28161803-28161825 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1182246503 22:28962362-28962384 AGGTAGGCTTGGAGTGCAGAGGG + Intronic
1182461458 22:30486632-30486654 AAGCAGGTGAGGAGGGCAGCAGG - Intergenic
1182708894 22:32308060-32308082 AGGTAGGTAAGAAGGAAGGAAGG - Intergenic
1182708896 22:32308068-32308090 AGGTAGGTAGGTAGGTAAGAAGG - Intergenic
1182709023 22:32308933-32308955 AGGTAGGTAAGAAGGAAGGAAGG - Intergenic
1182860667 22:33556605-33556627 AGGCAGGGAAGGAGGGAAGGAGG + Intronic
1183042623 22:35193614-35193636 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1183085827 22:35486405-35486427 GTGGAGGTAAGGAGGGGAGAGGG - Intergenic
1183239140 22:36643016-36643038 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1183306157 22:37084255-37084277 AGGGAGGAAAGGAAGCCAGAGGG + Intronic
1183487390 22:38096921-38096943 AGGCAGGCAGGGAGGGAAGAGGG + Intronic
1183625515 22:38999209-38999231 AGGCAGGGAGGGAGGGAAGAAGG - Intergenic
1183662694 22:39230745-39230767 AGGGAGGGAAGGTGGGCAGGAGG + Intronic
1184026747 22:41863334-41863356 GGAAAGCTAAGGAGGGCAGAAGG - Intronic
1184116341 22:42424857-42424879 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1184119028 22:42438424-42438446 AGGGAGGGAGGGAGGGCAGGTGG - Intergenic
1184396545 22:44245307-44245329 AGGTAGGTAAGAAGGAAGGAAGG - Exonic
1184476441 22:44724613-44724635 AGGTATGTAGGGAGGGAAGGAGG + Intronic
1184514370 22:44952952-44952974 AGCTAGGTCAGCAGGGCACAGGG - Intronic
1184554039 22:45223369-45223391 AGGGAGGTGAGGAAGCCAGATGG + Intronic
1184614570 22:45629484-45629506 AGGAAGGAAGGGAGGGAAGAGGG - Intergenic
1184690356 22:46114603-46114625 AGGCAGGCCAGGAGGGCACAGGG - Intergenic
1184823766 22:46933145-46933167 AGATAGGAATGGAAGGCAGATGG - Intronic
1185151604 22:49167110-49167132 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1185295377 22:50050548-50050570 AGGTGGGGGAGGAGGGCAGCAGG - Intronic
1185300271 22:50076047-50076069 AGGCAGGGAAGGAGGGAAAAAGG + Intronic
949339879 3:3017961-3017983 AGGAAGGTAAGGAGGGAAGTAGG - Intronic
949349274 3:3108763-3108785 AGTTAGGTCAGGAGAGCAGCAGG + Intronic
949634449 3:5967585-5967607 AGGGAGGAAGGGAGGGAAGAAGG - Intergenic
949697536 3:6716483-6716505 AGGGAGGGAAGAAAGGCAGACGG + Intergenic
950016989 3:9761358-9761380 GGGAAGGAAGGGAGGGCAGAGGG + Intronic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950575471 3:13829706-13829728 AGGGAGACAAGGAGGGCAGGGGG + Intronic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
950797948 3:15525795-15525817 AGGGAAGGAAGGAGGGAAGAAGG + Intergenic
950887412 3:16373872-16373894 AGGCAGGGCAGGAGGGTAGAAGG + Intronic
950902117 3:16507024-16507046 AGGTAGGAAATAAGGGCAGCAGG - Intronic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951104792 3:18730235-18730257 ATTTAGCTAAGTAGGGCAGAGGG - Intergenic
951607275 3:24449980-24450002 AGGAAGGAAAGGAGGGAAGAAGG + Intronic
951738080 3:25889763-25889785 AGGGAGGGAAGCAGGGAAGAAGG - Intergenic
951800130 3:26586656-26586678 AGGTAGGTGAGGAGGAGGGAAGG - Intergenic
951896984 3:27618898-27618920 AGGGAGGGAAGGTGGGTAGATGG - Intergenic
951896986 3:27618906-27618928 AGGTTGGTAGGGAGGGAAGGTGG - Intergenic
951914291 3:27783172-27783194 AAGAAGGAAAGGAGGGGAGAAGG + Intergenic
952145334 3:30525986-30526008 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
952373988 3:32749900-32749922 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
952585738 3:34890049-34890071 AGGAAGTGAAGGAGGGGAGATGG - Intergenic
952814900 3:37438697-37438719 GGGAAGGAAAGGAGGGCAGGTGG + Intergenic
952946858 3:38483814-38483836 AGGCAGGGGAGAAGGGCAGAGGG - Exonic
953098850 3:39806648-39806670 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
953221024 3:40971607-40971629 AGGGAGGGAGGGAGGGAAGAGGG + Intergenic
953357401 3:42266577-42266599 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
953357423 3:42266629-42266651 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
953489436 3:43336310-43336332 AGGGAGGGAAGGCGGACAGAGGG - Intronic
953903691 3:46857685-46857707 AGAAAGGAAAGGAGGGAAGAAGG + Intergenic
955975322 3:64474622-64474644 AGGGAGGTAGGGAGGGAAGGAGG + Intergenic
956057077 3:65311206-65311228 AGGTATGGAAGGAAGGTAGAGGG + Intergenic
956402584 3:68896085-68896107 AGGTAGCTAGGGAGGCCAGAGGG + Intronic
956470930 3:69566200-69566222 GGCAAGGTGAGGAGGGCAGAAGG - Intergenic
956501644 3:69893133-69893155 AGGGAGGTAAGAAGGTGAGAAGG - Intronic
956621006 3:71221501-71221523 AGGAAAGAAGGGAGGGCAGAAGG - Intronic
956637306 3:71379078-71379100 AGATCAGTAATGAGGGCAGAGGG - Intronic
956643388 3:71435257-71435279 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
956675229 3:71725904-71725926 AAGGAGGGATGGAGGGCAGATGG + Intronic
956733085 3:72214631-72214653 AGCTGGGTAAGGAGGGAAGTGGG - Intergenic
958005219 3:87802028-87802050 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
958005293 3:87802275-87802297 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
958584209 3:96065160-96065182 TGGTAGGTTAGGTGGGAAGAAGG + Intergenic
958717974 3:97809729-97809751 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
959068670 3:101682586-101682608 AGGTAGGGAAGGAAGGAATATGG - Intronic
959427364 3:106207540-106207562 TGGGAGGTGAGGTGGGCAGATGG + Intergenic
959594988 3:108119986-108120008 AGGTGGCTGAGGTGGGCAGATGG + Intergenic
960648795 3:119922187-119922209 AGGTAGGTAGGTAGGGAAGGAGG + Intronic
961063045 3:123848978-123849000 TGGTAGGAATTGAGGGCAGATGG + Intronic
961658760 3:128457369-128457391 AGGGAGGGAAGGCGGGCAGGAGG + Intergenic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
961995006 3:131233109-131233131 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
962567296 3:136674184-136674206 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
962707439 3:138058629-138058651 AGAGAGGAAAGGAGGGAAGAAGG + Intergenic
963912990 3:150830874-150830896 AGGAAGGAAAGGAGGACAGAAGG - Intergenic
963929827 3:150991965-150991987 TGGTTGGGAAGGAGGGTAGATGG + Intergenic
964056786 3:152470939-152470961 AGGGATGAAAGGAGGGAAGAAGG - Intergenic
964110685 3:153084199-153084221 AGTTAGGGCAGGAGGGGAGAAGG + Intergenic
964236454 3:154535994-154536016 AGGAAGGAAAGGAGGGGAGGAGG - Intergenic
964839756 3:160980806-160980828 AGGGAGGGAAGGAAGGTAGAAGG + Intronic
965077713 3:164001251-164001273 AAGAAGGAAAGGAGGTCAGAAGG + Intergenic
965202517 3:165677497-165677519 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
965211594 3:165797156-165797178 AGGAAGGAAGGGAGGGAAGAAGG - Intronic
966154516 3:176901574-176901596 ATGTAGGTAAGAAGGGGAGAAGG + Intergenic
966273774 3:178141225-178141247 AGGTACGTATGGAGGGTGGAAGG - Intergenic
966273800 3:178141301-178141323 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
966273812 3:178141333-178141355 AGGTACGTATGGAGGGTGGAAGG - Intergenic
966273830 3:178141389-178141411 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
966273838 3:178141417-178141439 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
966273851 3:178141453-178141475 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
966273866 3:178141497-178141519 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
966273888 3:178141557-178141579 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
966273896 3:178141585-178141607 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
966311026 3:178594039-178594061 GGGTAGGTAAGGAGGGAGGGAGG - Intronic
966461506 3:180181717-180181739 AGGGAGGGAAGGAGGGAGGATGG - Intergenic
966588212 3:181650984-181651006 AGGAAGGAAGGGAGGGGAGAGGG + Intergenic
966936510 3:184713052-184713074 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
967190117 3:186977590-186977612 AGGCAGCCAAGGAGGGCGGAAGG + Intronic
967283503 3:187845975-187845997 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
967323143 3:188213717-188213739 AGGGAGCAAAGGAGAGCAGAAGG - Intronic
967954914 3:194870595-194870617 AGGTAGGTAAGCCGGGCATCAGG + Intergenic
968196741 3:196712783-196712805 CGGGAGGGAAGGAGGGCACACGG - Intronic
968442406 4:630542-630564 GGGAAGCTGAGGAGGGCAGAGGG + Intronic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969465848 4:7355947-7355969 TGGAAGGAAGGGAGGGCAGAGGG - Intronic
969481587 4:7449339-7449361 AGGAAGGAAAGGAGGGAAGAAGG - Intronic
969504291 4:7574598-7574620 AGGGAGGCAAGGAGGGAGGAAGG + Intronic
969655796 4:8497858-8497880 AGGTAGCTCAGGTGGGCAAAGGG - Intergenic
969823703 4:9740216-9740238 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
969827666 4:9770765-9770787 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
970365065 4:15350136-15350158 AGGGAGGGAAGGAGGAAAGAAGG + Intronic
970396917 4:15677673-15677695 GGGAAGGTATGGAGGACAGAGGG - Intronic
970434690 4:16022104-16022126 AAGGAGGGAAGGAGGGAAGAAGG + Intronic
970689990 4:18611668-18611690 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690068 4:18611890-18611912 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690154 4:18612128-18612150 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970690240 4:18612366-18612388 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
970728496 4:19075422-19075444 AGGAAGGAAAGGAGGGAGGAGGG + Intergenic
971045543 4:22801615-22801637 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
971978564 4:33723258-33723280 AGTTAGGATAGGAGGGGAGAAGG + Intergenic
971989469 4:33872714-33872736 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
972055523 4:34797185-34797207 AGGGAGGGATGGAGGGAAGAAGG - Intergenic
972351942 4:38244228-38244250 AGGGAGGGCAGGAGGGCAGGAGG - Intergenic
972598550 4:40551578-40551600 AGAAAGGAAAGGAGGGAAGAAGG + Intronic
974251401 4:59389679-59389701 AGGGAGATAAGAAGAGCAGAGGG + Intergenic
974755383 4:66199539-66199561 AGGGAGGCAAGGAAGGAAGAGGG - Intergenic
975226239 4:71876234-71876256 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
975226250 4:71876262-71876284 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
975470679 4:74762573-74762595 AGGAAGGAAAGGAGGGCTGAAGG + Intronic
975884073 4:78943479-78943501 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
975905323 4:79204522-79204544 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
975955341 4:79830534-79830556 AAGGAAGTAAGGAGGGAAGAGGG + Intergenic
976322897 4:83735960-83735982 AGGAAGGTAAGAAGGGAAGGAGG - Intergenic
976476684 4:85492083-85492105 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
976818297 4:89175404-89175426 AGGTTGGGAAAGAGGGAAGATGG - Intergenic
976890808 4:90045230-90045252 GGGTTGGTAGGAAGGGCAGAAGG - Intergenic
977290563 4:95160602-95160624 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
977655213 4:99513649-99513671 AGGGAGGGAATGAGGGCAGGAGG - Intronic
977815997 4:101415089-101415111 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
978541250 4:109818522-109818544 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
979032418 4:115666294-115666316 AGGGAGGCAAGGAGGGAAGGAGG - Intergenic
979506456 4:121502741-121502763 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979506466 4:121502765-121502787 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979563317 4:122124602-122124624 AGGGAGGTATGGAGGGTGGAGGG - Intergenic
979687257 4:123524529-123524551 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
979698513 4:123640848-123640870 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980253783 4:130350173-130350195 AGGGAGGGAAGGAAGGAAGAAGG - Intergenic
980423290 4:132592659-132592681 TGTTAGGTTAGGAGGACAGATGG - Intergenic
980714225 4:136611162-136611184 AGGGAGGAATGGATGGCAGAAGG - Intergenic
981413335 4:144458747-144458769 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
981721241 4:147803583-147803605 AGGTAGGGAAGCATGGGAGAGGG - Intronic
982558625 4:156900878-156900900 AGGGAGGAAAGGAGGGAAGGAGG + Intronic
982882083 4:160731932-160731954 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
982967338 4:161929107-161929129 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
983197791 4:164826623-164826645 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
983480327 4:168265810-168265832 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
983945709 4:173583696-173583718 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
984056742 4:174939933-174939955 AGGAAGGGAGGGAGGGTAGAAGG - Intronic
984486686 4:180379134-180379156 AGGAAGGTAGGGAGAGGAGAAGG - Intergenic
984760063 4:183356302-183356324 AGGGAGGGAAGGAAGGAAGAAGG - Intergenic
985099706 4:186446731-186446753 AGGGAGGGAGGGAGGGCAGGCGG - Intronic
985107004 4:186509557-186509579 AGGAAGGGAAGGAAGGAAGAAGG + Intronic
985829557 5:2218215-2218237 AGGAAGGGAAGGAGGGATGAGGG + Intergenic
985835250 5:2266416-2266438 AGGCAGGGAAGCAGGGAAGAGGG + Intergenic
985866676 5:2519552-2519574 AGGGAGGAGAGGAGGGCAGAGGG - Intergenic
985958055 5:3279026-3279048 AGGGAGGAAGGGAGGGAAGAGGG - Intergenic
986146680 5:5084369-5084391 AGGTAGGTTAGGAAAGCAAAAGG - Intergenic
986190863 5:5495006-5495028 AAGTAGCTGAAGAGGGCAGAAGG - Intergenic
986226494 5:5820121-5820143 AGTGAGCTAAGGGGGGCAGATGG - Intergenic
986312834 5:6567408-6567430 AGGCAGGTAAGGAGGTCAGGAGG + Intergenic
986313350 5:6571064-6571086 AGGAAGGGAAAGAGGGAAGAGGG + Intergenic
986418375 5:7551005-7551027 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
986490746 5:8286981-8287003 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
987361512 5:17111533-17111555 AGGGAGGGAAGGAGGGGGGAGGG - Intronic
987642565 5:20631540-20631562 AGATAGGAAGGGAGGGAAGAAGG + Intergenic
987688659 5:21238778-21238800 AGGAAGGTAAATAGGGCAAAGGG + Intergenic
988712038 5:33788419-33788441 AGGAAGGTAAGGGGAGGAGATGG + Intronic
989192982 5:38689417-38689439 AGGCAGGGGAGGAAGGCAGAAGG - Intergenic
989427405 5:41312647-41312669 AGGGAGGAAGGGAGGGAAGAAGG - Exonic
989481706 5:41938420-41938442 AGGTAGGCAAAGAGAGAAGAAGG + Intronic
989559097 5:42830525-42830547 AGGTAGGTAGGGAGGGAAGTAGG - Intronic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
989969917 5:50511299-50511321 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
989981897 5:50655486-50655508 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
990210486 5:53478624-53478646 AGGGAGGGAAGGAGAGAAGAGGG + Intergenic
990312032 5:54549369-54549391 AGGTGGGCAAAGTGGGCAGAAGG - Intergenic
990334110 5:54755658-54755680 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
990507494 5:56458963-56458985 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
990687502 5:58322693-58322715 AAACAGGAAAGGAGGGCAGAAGG + Intergenic
990762312 5:59143157-59143179 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
990846181 5:60142223-60142245 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
991235167 5:64385487-64385509 AGGGAGGCAAGGAGGGAAGGAGG + Intergenic
991272145 5:64796792-64796814 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
991272158 5:64796836-64796858 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
991518927 5:67472496-67472518 AGGGAGGGAAGGAGGGTGGAAGG - Intergenic
991622275 5:68557124-68557146 AGGGAGGAAAGGAGGGCAAAAGG + Intergenic
991974750 5:72174970-72174992 AGGGAGGGAAGGAGGGAAGGCGG - Intronic
992008851 5:72507463-72507485 AGGAAGGAAGGGAGGGGAGAGGG + Exonic
992847550 5:80766817-80766839 AGGTATGGAAGGGTGGCAGAGGG - Intronic
992873144 5:81025974-81025996 AGGGAGGGAGGGAGGGAAGAGGG - Intronic
992895413 5:81240912-81240934 TGGTATTTAAGGAGGGCTGAGGG + Intronic
993280406 5:85919315-85919337 AGGTGGATGAGGAGGCCAGAAGG + Intergenic
993322629 5:86492114-86492136 AGGAAGGAAAGGAGGGAGGACGG - Intergenic
993375066 5:87141102-87141124 AGGGAGGAAGGGAGGACAGAAGG + Intergenic
993417431 5:87652761-87652783 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
993536979 5:89098630-89098652 AGGGAGGAAAGGAGGGAAGGAGG - Intergenic
993604460 5:89971269-89971291 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
993669810 5:90747028-90747050 TGTTAGGCAAGGAAGGCAGATGG + Intronic
994084515 5:95743674-95743696 AGGGAGGGAAGGAGGGAAGAGGG - Intronic
994198854 5:96949907-96949929 AGGGAGGGAAGGAGGACGGAAGG - Intronic
994596412 5:101843259-101843281 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
994641561 5:102416573-102416595 AGAAAGGTAAGGAGGTGAGAAGG + Intronic
994730985 5:103490482-103490504 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
994842311 5:104941220-104941242 AGGAAGGAAGGGAGGGAAGAAGG + Intergenic
995324518 5:110875315-110875337 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
995440223 5:112183196-112183218 AGGTAGGTAGGGAGCTCTGAGGG - Intronic
995554095 5:113309913-113309935 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
995868369 5:116717339-116717361 AGTTAGGGAAGGAGGGAGGAAGG - Intergenic
996001929 5:118374742-118374764 AGGTAGGTCAGGGGACCAGAGGG + Intergenic
996167418 5:120242311-120242333 AGGAAGGAAAGGAGGGAAGATGG - Intergenic
996881356 5:128300036-128300058 AGGGAGTTAAATAGGGCAGAAGG - Intronic
997204248 5:132032946-132032968 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
997512371 5:134462407-134462429 AGCCAGGCAAGGAGGGCAGATGG + Intergenic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
997556991 5:134808658-134808680 AGGGAGGTAAAGAGGGGAGTAGG - Intronic
998039587 5:138943950-138943972 TGGTAGGACAGGAGGGGAGAGGG - Intergenic
998155609 5:139785213-139785235 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
998352014 5:141508102-141508124 GGGTAGGTTAAGAGGACAGAGGG + Intronic
998469221 5:142370355-142370377 AGGGAGGTAAGGAGGGAAGTGGG - Intergenic
998471868 5:142389882-142389904 ATGCAGGGAAGCAGGGCAGAGGG + Intergenic
998490120 5:142539491-142539513 AGGGAGGGAAGGAGGGGAGGGGG - Intergenic
999184757 5:149698825-149698847 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
999275114 5:150325069-150325091 AGAGAGGGAAGGAGGGAAGAAGG + Intronic
999423555 5:151466182-151466204 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
999692685 5:154162365-154162387 AGGGAAGAAAGGAGGGAAGAAGG + Intronic
999943471 5:156569743-156569765 AGGTGGATATGGAGGACAGAGGG + Intronic
1000115281 5:158148616-158148638 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1000115294 5:158148652-158148674 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115299 5:158148668-158148690 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115304 5:158148684-158148706 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000115309 5:158148700-158148722 AAGAAGGGAAGGAGGGAAGAAGG - Intergenic
1000641698 5:163710667-163710689 TGGGAGCTAAGGAGGGCAGCAGG + Intergenic
1000696175 5:164387183-164387205 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1000984854 5:167855724-167855746 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1000997523 5:167974101-167974123 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997575 5:167974255-167974277 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997591 5:167974308-167974330 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1001003802 5:168031774-168031796 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1001312122 5:170618529-170618551 AGGGAGGAAAGGAGGGAGGAGGG + Intronic
1001404437 5:171465949-171465971 AGGAAGGGAAGGAGATCAGATGG + Intergenic
1001408716 5:171495315-171495337 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1001731795 5:173965669-173965691 AGGCAGATAAGGAGGCCAGAGGG + Intergenic
1001855568 5:175007605-175007627 AGGAAGAAAAGGAGGGAAGAAGG - Intergenic
1002102360 5:176863791-176863813 AGGAGGGGAAGGAGGGAAGAAGG - Intronic
1002509262 5:179702387-179702409 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1002539025 5:179893912-179893934 AGGGAGGCAAGGAGGGAGGAGGG + Intronic
1002852686 6:1010553-1010575 AGGGAGGAAATGAGGGAAGAAGG - Intergenic
1002899558 6:1399489-1399511 AGGGAGGTAAGGAGGGAAAGAGG + Intergenic
1002917660 6:1542026-1542048 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1002917709 6:1542170-1542192 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1002917724 6:1542206-1542228 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
1003007084 6:2392203-2392225 ATGCAGGAAAGGAGGGCAGGAGG + Intergenic
1003226077 6:4207148-4207170 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1003254599 6:4463858-4463880 AGGAAGGGATGGAGGGCAGCTGG + Intergenic
1003414822 6:5898390-5898412 AGGAAGGGAGGGAGGGCAGGAGG - Intergenic
1003517568 6:6829959-6829981 AGGAAGGCAGGGAGGGAAGAAGG + Intergenic
1003558472 6:7161575-7161597 AGATAGGAAAGGAGGGCATGGGG - Intronic
1003709787 6:8576425-8576447 AGGTAGGGAGGGAGGAAAGAAGG - Intergenic
1003946090 6:11077232-11077254 ATGAATGTAAGGAAGGCAGATGG - Intergenic
1004015449 6:11727972-11727994 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1004067880 6:12266847-12266869 TGGTAGGGAAGAAGGGCAAAGGG + Intergenic
1004131205 6:12921632-12921654 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1004182089 6:13389989-13390011 AGGTAGCAAAGGAGGGAAGGTGG - Intronic
1004239596 6:13907996-13908018 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1004494709 6:16152818-16152840 AGGTAGGGAAGGTGGGTGGAAGG + Intergenic
1004761119 6:18667655-18667677 AGGAAGGTAGGGAGGGAGGAAGG - Intergenic
1004761134 6:18667710-18667732 AGGCAGGGAGGGAGGGAAGAAGG - Intergenic
1005402640 6:25450727-25450749 AGGGAGGAAAGGAGGAAAGAAGG - Intronic
1005598400 6:27401625-27401647 AAGGAGGGAAGGAGGGAAGAAGG - Exonic
1005847780 6:29794691-29794713 AGGGAGGAAAGGAGGAAAGAAGG - Intergenic
1006255651 6:32830144-32830166 AGGTAGGTGGGGAGGACAAAAGG - Intronic
1006308811 6:33242619-33242641 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1006471345 6:34230875-34230897 AGGTAGGAGATGAGGTCAGAGGG + Intergenic
1007079901 6:39092579-39092601 GGGTAGGGAAGGAGGGAAAAAGG - Intergenic
1007082315 6:39116459-39116481 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1007122864 6:39397819-39397841 AGGTGTGTAAGAAGGGCTGATGG + Intronic
1007214073 6:40222584-40222606 AGTAAGGTTTGGAGGGCAGAAGG + Intergenic
1007594317 6:43042096-43042118 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1007741066 6:44009691-44009713 AGGAAGGGAGGGAGGGCGGAGGG + Intergenic
1007814943 6:44515023-44515045 AGGAAGGAAAGAAGGGAAGAAGG + Intergenic
1008015670 6:46516653-46516675 AGGGAGGGAAGGAGGAAAGAAGG - Intergenic
1008128677 6:47696141-47696163 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1008140921 6:47831086-47831108 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1008286181 6:49654047-49654069 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1008348072 6:50454052-50454074 AGGTAGGCAAGTAGGGAAGAGGG + Intergenic
1008362330 6:50635529-50635551 AGGGAGGGAGGGAGGGGAGAAGG + Intergenic
1008418612 6:51271717-51271739 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1008630914 6:53362375-53362397 AGGGTGGTAAAGTGGGCAGAGGG - Intergenic
1009418058 6:63437165-63437187 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1009761533 6:68012969-68012991 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1009828884 6:68904036-68904058 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1010177840 6:73050301-73050323 AGGAAGGAAGGGAGGGAAGAAGG + Intronic
1010331632 6:74629963-74629985 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1010345952 6:74811143-74811165 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1010484786 6:76397100-76397122 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1010533521 6:76995222-76995244 AGGTAGGAAGGGAAGGCAGATGG - Intergenic
1011222226 6:85066896-85066918 AGGAAGGAAAGGAGGGAAGGAGG + Intergenic
1011361980 6:86537009-86537031 AGGGAGGTCGGGAGGACAGAAGG - Intergenic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1011399255 6:86941884-86941906 AGGAAGGGAAGGAGGGAAGGAGG + Intronic
1011775579 6:90727028-90727050 AGATAGCTGAGGAGGGCAGATGG + Intergenic
1011841196 6:91501085-91501107 AGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1012422336 6:99078659-99078681 AGGGAGGGAAGGAGGGAAGGGGG + Intergenic
1012639163 6:101587432-101587454 AGGTAGGTAAGTAGGTAGGAAGG - Intronic
1012671277 6:102050790-102050812 AGGGAGGGAGGGAGGACAGAAGG + Intronic
1012872842 6:104692139-104692161 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1013201151 6:107897002-107897024 AGGGAGGGAAGGAGAGAAGAAGG + Intronic
1013419481 6:109952908-109952930 ATGTAAGAAAGCAGGGCAGAAGG + Intergenic
1013536911 6:111071385-111071407 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1013677334 6:112480234-112480256 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1013677354 6:112480290-112480312 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1015085571 6:129287080-129287102 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1015383936 6:132600870-132600892 AGAGAGGGAAGGAGGGAAGAAGG + Intergenic
1015384006 6:132601090-132601112 AGGGAGGGAAGGAGGGAAGAAGG + Intergenic
1015631520 6:135236533-135236555 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1015805809 6:137107270-137107292 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1015890499 6:137965354-137965376 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1015978289 6:138813614-138813636 AGATAGGGAAGGAGGTGAGAAGG + Intronic
1016273433 6:142318823-142318845 AGGTAGGGAATGAGGCTAGATGG + Intronic
1016499656 6:144705149-144705171 AGGCAGGTAAGGAGGGTTGTTGG + Intronic
1016534229 6:145092684-145092706 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1016941490 6:149485905-149485927 AGGGAGGTAAGAATGGCACATGG + Intergenic
1017041111 6:150309213-150309235 AGGGAGGTAGGGAGGGAGGAAGG + Intergenic
1017286352 6:152680957-152680979 AGGAAGGGAGGGAGGGTAGAAGG + Intergenic
1017334066 6:153234493-153234515 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1017408697 6:154147075-154147097 AGGTGGGGAAGGGGAGCAGAAGG + Intronic
1017854095 6:158333565-158333587 AGTTTGGGAAGGTGGGCAGAGGG - Intronic
1017929305 6:158938510-158938532 AGGAAGGTAGGGAGAGCAGCAGG + Intergenic
1017994875 6:159523221-159523243 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1018846291 6:167559118-167559140 AGGGAGGGACTGAGGGCAGAGGG + Intergenic
1019336370 7:484852-484874 AGGAAGGTATGCAGGGCTGAGGG + Intergenic
1020128913 7:5548785-5548807 AGGAAGGGAAGGAGGGAGGAGGG + Intronic
1020376851 7:7497044-7497066 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1020412231 7:7905301-7905323 GGATAGGGAAGGAGGGGAGAGGG + Intronic
1020989942 7:15184308-15184330 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1021329944 7:19324020-19324042 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1021352280 7:19609903-19609925 AGGAAGGTCAGGAGGGAGGAAGG - Intergenic
1021472737 7:21024326-21024348 AGGTGGGGAAGGAGGGAATAGGG - Intergenic
1021847127 7:24774260-24774282 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1021847150 7:24774316-24774338 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1022004349 7:26253799-26253821 AGGAAGGAAAGGAGAGGAGAAGG + Intergenic
1022109236 7:27218185-27218207 AGGTAGGTAAGGAGGGAGGGAGG - Intergenic
1022252299 7:28620534-28620556 AGGTAGTGAAGGTAGGCAGAAGG + Intronic
1022514335 7:30965833-30965855 AGGAAGAGCAGGAGGGCAGATGG - Intronic
1022541789 7:31144413-31144435 AGGGAGGTAGGGAGGGAGGAAGG - Intergenic
1022581637 7:31560970-31560992 AGGTAGGTAATGAGGTAAAAAGG + Intronic
1022638644 7:32160848-32160870 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1022813649 7:33893469-33893491 GGGTAGGTATGGAGGCTAGAAGG - Intergenic
1023199882 7:37685401-37685423 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1023382767 7:39624205-39624227 AGAAAGGGAAGGAGGGGAGAGGG - Intronic
1023473578 7:40552293-40552315 ACAGAGGTATGGAGGGCAGAGGG - Intronic
1023505870 7:40899220-40899242 AGGGAGGGAAGGAGGGCGGGCGG - Intergenic
1023592392 7:41793669-41793691 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1023871790 7:44267175-44267197 AGGGAGGGCAAGAGGGCAGAGGG - Intronic
1024144955 7:46504717-46504739 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1024298155 7:47862791-47862813 AGCCAGGAAAGGAGGACAGAAGG + Intronic
1024300344 7:47882688-47882710 AGGGAGGGAGGGAGGGCAGGAGG + Intronic
1024439775 7:49403746-49403768 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1025147035 7:56514156-56514178 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1025321609 7:58100280-58100302 AGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1025321658 7:58100614-58100636 AGAAAGGAAGGGAGGGCAGAAGG + Intergenic
1025605074 7:63033830-63033852 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1025948593 7:66124519-66124541 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1026007419 7:66610999-66611021 AGGAAGGAAAGGAGGGAAGGAGG + Intergenic
1026133183 7:67636942-67636964 AGGCAGGGAGGGAGGGAAGAAGG - Intergenic
1026205673 7:68255328-68255350 AGGAAGGGGAGGAGGGGAGAAGG - Intergenic
1026241742 7:68581473-68581495 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1026261443 7:68759003-68759025 AGGGAGGCAAGGAGGGAAGGAGG + Intergenic
1026277752 7:68895041-68895063 GGGTAGGGAAGGAGGAGAGAGGG - Intergenic
1026318889 7:69251652-69251674 AGGAAGGAAAGAAGGGGAGAAGG + Intergenic
1026492194 7:70872312-70872334 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1026526349 7:71156661-71156683 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1026952972 7:74359941-74359963 AGGCAGGTACTGAGGGCAGGTGG + Intronic
1026953228 7:74361147-74361169 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1027416882 7:77983408-77983430 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1027416908 7:77983480-77983502 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1027733572 7:81905206-81905228 AGGAAGGGAAGGAGGGAAGGGGG - Intergenic
1027733583 7:81905230-81905252 AGGGAGGGAAGGAAGGCAGGAGG - Intergenic
1027770341 7:82398903-82398925 AGGAAGGAAAGAAGGGTAGAAGG - Intronic
1028127774 7:87133957-87133979 AAGTAGATAAGGAAGGCAGAAGG + Intergenic
1028371791 7:90100327-90100349 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1028482389 7:91321783-91321805 AGGAAGTTAGGGAGGGAAGATGG - Intergenic
1028636786 7:92997994-92998016 AGGAAGGCAAGGAGGGAAGGAGG - Intergenic
1029178698 7:98683822-98683844 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1029300794 7:99580911-99580933 AGGGAGGGAGGGAGGACAGAAGG - Intronic
1029628840 7:101737737-101737759 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1029628853 7:101737769-101737791 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029853638 7:103490523-103490545 AGGGAGAAAAGGAGGGAAGATGG + Intronic
1030232381 7:107222000-107222022 AGGAAGGAAAGAAGGGCAGAAGG + Intronic
1030278593 7:107745460-107745482 AGATTGGAAAGGAGGGCAGCAGG + Intronic
1030629932 7:111884717-111884739 AGGTAGGGAGGAAGGGCAGGTGG + Intronic
1030783882 7:113636328-113636350 AGTTAGGCAAGGATGGGAGATGG - Intergenic
1030942494 7:115671312-115671334 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1031866172 7:127040085-127040107 AGGGAGGGGAGGAGGGAAGAAGG + Intronic
1032326035 7:130928740-130928762 AGGGAGGGAGGGAGGGGAGAAGG + Intergenic
1032503470 7:132417706-132417728 AGGTGGGGGAGGAGGGGAGAGGG + Intronic
1032577449 7:133070628-133070650 AGGGAGGGAGGGAGGGGAGAGGG - Intronic
1032720885 7:134550118-134550140 AGGTGAGTAAGGAGGTCAGCAGG - Intronic
1032998881 7:137480937-137480959 AGGTAGGGATGGAGAACAGAAGG - Intronic
1033892018 7:146025133-146025155 AGGGAGGGAAGGAGGGTGGAAGG - Intergenic
1034263317 7:149770368-149770390 AGAGAGGTAGGGAGGGCAGGAGG + Intronic
1034487918 7:151377599-151377621 AGGCAGGCAAGCTGGGCAGATGG - Exonic
1034598475 7:152223281-152223303 AATTACGTAGGGAGGGCAGAAGG + Intronic
1034605325 7:152307371-152307393 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1034605330 7:152307383-152307405 AGGGAGGAAGGGAGGGGAGAAGG + Intronic
1034889757 7:154829470-154829492 AGGGAGGGAAGAAGGACAGAAGG + Intronic
1034925786 7:155120540-155120562 AGGTCAGTAAGGAGGGATGATGG - Intergenic
1035163617 7:156969706-156969728 AGGGAAGGAAGGAGGGCAGGTGG + Exonic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414063 7:158668175-158668197 GGGTCGGTAAGGAAGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414134 7:158668379-158668401 TAATAGGTAAGGAGGGCGGAGGG - Intronic
1035531010 8:350840-350862 AGGTAGGTAAGTAGGTAGGAGGG + Intergenic
1036089924 8:5654426-5654448 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1036154169 8:6326250-6326272 AGGAAGGGAAGAAGGGAAGAGGG + Intergenic
1036338725 8:7895816-7895838 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1036338737 8:7895844-7895866 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1037115857 8:15226170-15226192 AGGTAGGTAGGTAGGTCCGAAGG - Intronic
1037222469 8:16541334-16541356 AGGCAGGGAAGGAGGGAAGAAGG + Intronic
1037680531 8:21093556-21093578 AGGAAGGAAGGGAGGGCGGAAGG + Intergenic
1037907907 8:22726271-22726293 GCTTAGGTATGGAGGGCAGATGG + Intronic
1038012456 8:23486026-23486048 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1038150399 8:24938258-24938280 AGATAGGGAAGGAGGGCAGAAGG + Intergenic
1038157679 8:25006069-25006091 AGGGAGGGAGGGAGGGCAGGAGG + Intergenic
1038276830 8:26128223-26128245 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1038491963 8:27977767-27977789 AATTAGGTAAGGAGGCCGGAAGG - Intronic
1038689320 8:29746696-29746718 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1039352970 8:36782361-36782383 AGGGAGGTAGGGAGGGAGGAAGG - Intergenic
1039493554 8:37965244-37965266 GGGTAGGTAACCGGGGCAGAGGG - Exonic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1039762204 8:40589948-40589970 AGGGAGGGAAGGAGGGAAGAAGG - Intronic
1039776914 8:40746208-40746230 AGGGAGGGAAGGAGGGAAGGAGG - Intronic
1039812679 8:41063493-41063515 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1041135892 8:54758471-54758493 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041203448 8:55473874-55473896 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1041444184 8:57931899-57931921 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041453791 8:58035862-58035884 AAGCAGGGAAGGAGGGCAGAAGG - Intronic
1041802323 8:61813504-61813526 AAGGAGGGAAGGAGGGAAGAAGG - Intergenic
1041802325 8:61813512-61813534 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1041953628 8:63533180-63533202 AGGAAGGGAGGGAGGGAAGAGGG - Intergenic
1042705935 8:71665633-71665655 AGGGAGGAATGGAGGGTAGAAGG - Intergenic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043313047 8:78886215-78886237 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1043313078 8:78886303-78886325 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1043322698 8:79009472-79009494 AGGGAGGGATGGAGGGCAGGAGG - Intergenic
1043692634 8:83174656-83174678 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1043756529 8:84010532-84010554 AGTTAGGGAAGGAAGCCAGATGG + Intergenic
1044119955 8:88382484-88382506 AGGGAGGAAGGGAGGGAAGAGGG - Intergenic
1044253199 8:90028688-90028710 AGGAAGGGAAGGAGGGAGGAAGG - Intronic
1044450374 8:92329335-92329357 ATGGTGGTAAGGAGGACAGATGG - Intergenic
1044590864 8:93913528-93913550 AGGTAGGGAAGGAGAGAGGAAGG - Intronic
1045544713 8:103118223-103118245 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1045789373 8:105964100-105964122 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1046494748 8:114998903-114998925 AGGAAGGAAAGGAGGGATGAAGG - Intergenic
1046561441 8:115842760-115842782 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1046768562 8:118096685-118096707 AGGGAGGGAAGGAGGGAAGGAGG + Intronic
1046774760 8:118152439-118152461 AGGTAGGGAGGGAGGGAGGAAGG - Intergenic
1047130124 8:122009413-122009435 AGGAAGGTAAGGAGGGAGGGAGG - Intergenic
1047305663 8:123651122-123651144 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1047501654 8:125446388-125446410 AGGAAGGGAAGAAGGGAAGAAGG - Intergenic
1047549065 8:125850095-125850117 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1047552239 8:125887387-125887409 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1047772260 8:128038991-128039013 AGGGAGGGAAGGGAGGCAGAAGG + Intergenic
1048141156 8:131795972-131795994 AGATAGATAAGAAGGTCAGATGG + Intergenic
1048279676 8:133095909-133095931 AGGTGGGTGAGGAAGGCAGGAGG - Intronic
1048281705 8:133110305-133110327 AGGCAGGTGGGGAAGGCAGAAGG - Intronic
1048453567 8:134555973-134555995 AGGGAGGGAAGGAGGGAAGGCGG + Intronic
1048578540 8:135711751-135711773 AGGGAGGGAAGGAGGGGAGGAGG + Intergenic
1048746499 8:137620079-137620101 AGGGAGGAAAGAAGGGAAGAAGG - Intergenic
1048904108 8:139070724-139070746 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1049154108 8:141056493-141056515 AGGTAGGCAGGGAGGGACGAGGG + Intergenic
1049174706 8:141184758-141184780 AGGCAGGGAGGGAGGGCAGCTGG - Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049360613 8:142210988-142211010 AGGTAGGGGAGCTGGGCAGACGG - Intergenic
1049445687 8:142630319-142630341 GGGTAGGTAAGATGGGTAGATGG - Intergenic
1049703433 8:144025055-144025077 AGGTAGGTCCTGAGGGGAGATGG - Intronic
1050084455 9:1950054-1950076 AGGGATTTAAGGAGGGGAGAAGG + Intergenic
1050292716 9:4172903-4172925 ATGTAGGGAAGCAGGCCAGATGG + Intronic
1051165046 9:14252940-14252962 AGGAAGGAAAGGAGGGAGGAAGG + Intronic
1051440246 9:17075477-17075499 AGGGAGGGAAGGAGGGGGGAAGG - Intergenic
1051505984 9:17828310-17828332 AGGTGGGAAAGGAGGGCTGTAGG - Intergenic
1051677311 9:19571255-19571277 AGGAAGGTAAGGAGCATAGAAGG + Intronic
1051952861 9:22658426-22658448 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1052346225 9:27412541-27412563 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1053132941 9:35628649-35628671 TGGTAGGTGAGCAGAGCAGAGGG + Intronic
1053337319 9:37286988-37287010 AGGGAGGGAAGGAGGGGGGAGGG - Intronic
1054317430 9:63609040-63609062 ACGTAAGTAAGCAAGGCAGAAGG + Intergenic
1054710309 9:68504439-68504461 AGATAGGAAATGAGGTCAGAGGG - Intronic
1054805123 9:69389994-69390016 AAGGAGGTAAGGACAGCAGAAGG + Intronic
1055103883 9:72492854-72492876 AGGAAGGTAGGGAGGGAGGAAGG - Intergenic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055749217 9:79486370-79486392 AGGGAGGGAAGGAAGGAAGAGGG - Intergenic
1055824255 9:80304871-80304893 AGGACGGTAAGGTGGGCTGAGGG + Intergenic
1056010176 9:82320953-82320975 ATGTAGGAATGGAGGCCAGAAGG - Intergenic
1056325965 9:85479314-85479336 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1056616290 9:88169208-88169230 AGGAAGGAAGGGAGGGAAGAAGG + Intergenic
1057458132 9:95233117-95233139 AGGCGGGAAAGGAGGGGAGATGG + Intronic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1057988081 9:99737931-99737953 AGGTAGGTAAGGGGGAGAGAGGG - Intergenic
1058643316 9:107107870-107107892 AGGAAGGCAGGGAGGGAAGAAGG + Intergenic
1058663637 9:107289075-107289097 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1058663644 9:107289095-107289117 AGGGAGGGAGGGAGGGAAGAAGG - Intronic
1058712634 9:107694057-107694079 AGGGAGGTAGGGATCGCAGAGGG - Intergenic
1058909334 9:109506547-109506569 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1058960449 9:109988510-109988532 AGGAAGGAAGGGAGGGAAGAAGG + Intronic
1059241141 9:112806719-112806741 AGGTAAGTAAGAAGGGCTGAGGG - Intronic
1059479802 9:114580305-114580327 AGGAAGTTAAGGTGGGAAGATGG + Intergenic
1059638196 9:116191019-116191041 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1059655178 9:116351369-116351391 AGAAAGGAAAGGAGGGAAGAAGG + Intronic
1059675827 9:116538201-116538223 AGGAAGGGAAAGAGGGAAGAAGG + Intronic
1059719476 9:116945617-116945639 AGGAAGGGAGGGAGGGCAGAAGG - Intronic
1059723687 9:116985866-116985888 AGGAAGGCATGGAGAGCAGAGGG + Intronic
1059822086 9:117984589-117984611 AGTGAGGGAAGGAGGGAAGATGG + Intergenic
1059962113 9:119575719-119575741 AGATAAGTAGGGAAGGCAGAGGG + Intergenic
1060045805 9:120339178-120339200 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1060135887 9:121153430-121153452 AGTTAGGTAAGGGGGTCAGCAGG - Intronic
1060395310 9:123312437-123312459 AGGGAGGGAGGGAGGGGAGAGGG + Intergenic
1060446150 9:123690059-123690081 AGGGAGGGAGGGAGGGAAGAAGG + Intronic
1060658575 9:125389270-125389292 AGGTAGGGTGGGAGGACAGAGGG - Intergenic
1060685364 9:125606200-125606222 AGGAAGGCAGGGAGGGAAGAAGG + Intronic
1060685367 9:125606208-125606230 AGGGAGGGAAGAAGGGCATAGGG + Intronic
1060729274 9:126027095-126027117 AGGTAGGTGAGGAAGGGAGTAGG - Intergenic
1060744629 9:126123183-126123205 AGGCTGGTAAGTAGGGCACAGGG + Intergenic
1060892170 9:127195826-127195848 AGGTAGGTAGGTAGGAAAGAAGG - Intronic
1061016984 9:127986992-127987014 AGGGAGGGAGGGAGGGCAGGAGG + Intergenic
1061016986 9:127987000-127987022 AGGGAGGGCAGGAGGGAAGAAGG + Intergenic
1061060270 9:128246743-128246765 AGGGAGGAAAGGAGGGAGGATGG - Intronic
1061462332 9:130750380-130750402 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
1061551151 9:131335368-131335390 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1061682552 9:132250150-132250172 GGGTAGGGGATGAGGGCAGAGGG + Intergenic
1061950125 9:133931467-133931489 AGGGAAGAAAGGAGGGGAGAAGG - Intronic
1061999329 9:134207884-134207906 AGGTAGGTAGGGAGGACAGGTGG - Intergenic
1062201682 9:135306161-135306183 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1062328238 9:136023039-136023061 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1062328254 9:136023080-136023102 AGGGAGGGAAGGAGGGAAGAGGG + Intronic
1062408303 9:136408641-136408663 AGGTAGGAAAGTCGGGAAGAGGG - Intronic
1062449169 9:136608330-136608352 AGGGAGGGAAGGAGGGGAGAGGG + Intergenic
1062449190 9:136608402-136608424 AGAGAGGTAAGGAGGTGAGAGGG + Intergenic
1062449218 9:136608471-136608493 AGGGAGGGAAGGAGGGGAGAGGG + Intergenic
1203433040 Un_GL000195v1:109223-109245 AGGAATATATGGAGGGCAGAAGG - Intergenic
1185476777 X:420172-420194 AGGAAGGGAAGGAAGGAAGAGGG - Intergenic
1185602339 X:1348942-1348964 AGAAAGGGAAGGAGGGAAGAAGG - Intronic
1185700656 X:2228083-2228105 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1185999160 X:4989099-4989121 AGGGAGGGAAGGAGGGAAGGAGG - Intergenic
1186053658 X:5626698-5626720 AGGAAGGTTAGGAGGGAAGAAGG + Intergenic
1186269193 X:7866489-7866511 AGGTAGGAAGGGAGGAAAGAAGG - Intergenic
1186406991 X:9313042-9313064 AGGGAGGGAAGGAGGGAAGGAGG + Intergenic
1186490018 X:9964217-9964239 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1187068172 X:15861451-15861473 GGGGAGGGAAGGAGGGAAGAAGG - Intergenic
1187415890 X:19092972-19092994 AAGTAGGTAAGTAGGTCACAAGG + Intronic
1187425955 X:19177198-19177220 AGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1187715894 X:22102217-22102239 AGGTTGGGAAGGATAGCAGAGGG - Intronic
1188052058 X:25499756-25499778 AGGTAGGTAAGGAGGTAGGTAGG - Intergenic
1188699190 X:33237180-33237202 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1189374994 X:40459716-40459738 AGGGAGGGAAGGAGGGGAGGCGG + Intergenic
1189588663 X:42488554-42488576 AGGGAGGAAAGGAGGGAAGGAGG - Intergenic
1190682696 X:52841638-52841660 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1190708679 X:53050045-53050067 AGGAAGGAAAGGAGGAAAGAAGG - Intronic
1190766671 X:53480965-53480987 AGGTGGATAGGGAGGCCAGAAGG - Intergenic
1192433117 X:71125894-71125916 AGGGAGGGAAGGAAGGAAGAGGG - Intronic
1194131221 X:90084515-90084537 AGGTATGCAAGGATGGAAGAGGG - Intergenic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1195505629 X:105653514-105653536 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
1195534154 X:105992057-105992079 AGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1195684084 X:107570162-107570184 AGGAAGGGAAGGAGGGAGGAAGG + Intronic
1195892731 X:109713049-109713071 AGGGAGGGAAGGAGGGATGAAGG + Intronic
1196001614 X:110793407-110793429 AGGTAAAGAAGGAAGGCAGACGG - Intronic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1196883698 X:120223552-120223574 AGGAAGCTAAGGGGGGCTGAGGG - Intergenic
1196986980 X:121284607-121284629 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1197507524 X:127325497-127325519 AGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1197762776 X:130039393-130039415 AAGCAGGTGAAGAGGGCAGATGG - Intronic
1197768516 X:130074337-130074359 AGTTAGGTAAGGAGGGGTGCTGG - Intronic
1197816537 X:130504448-130504470 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816547 X:130504486-130504508 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816562 X:130504537-130504559 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816574 X:130504575-130504597 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816658 X:130504871-130504893 AGGAAGGAAAGGAAGGAAGAAGG - Intergenic
1198160560 X:134003703-134003725 AGGGAGGAAGGGAGGGAAGAAGG + Intergenic
1198455423 X:136812848-136812870 AGGAAGGAAAGAAGGGAAGAAGG + Intergenic
1198651845 X:138871824-138871846 AGGTAGGAGATGAGGCCAGAAGG + Intronic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1199046578 X:143181247-143181269 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1199046580 X:143181255-143181277 AAGGAGGGAAGGAGGGAAGAAGG + Intergenic
1199811814 X:151357074-151357096 AGGAAGGGACGGAGGGAAGAGGG - Intergenic
1199814644 X:151386843-151386865 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1200012363 X:153128338-153128360 AGGTAGCTAAGGGAGGCCGAGGG + Intergenic
1200027237 X:153271581-153271603 AGGTAGCTAAGGGAGGCCGAGGG - Intergenic
1200428338 Y:3046820-3046842 AGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1200807132 Y:7444534-7444556 AGGAAGGGAGGGAGGGGAGAAGG + Intergenic
1200807141 Y:7444554-7444576 AGGGAGGGAGGGAGGGGAGAAGG + Intergenic
1200807150 Y:7444574-7444596 AGGGAGGGAGGGAGGGGAGAAGG + Intergenic
1200817464 Y:7548377-7548399 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1200835167 Y:7725587-7725609 AGGCAGGGCAAGAGGGCAGAAGG + Intergenic
1200881738 Y:8220485-8220507 AGGGAGGGAAGGAGGGAAGAAGG - Intergenic
1200908563 Y:8511036-8511058 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1201458953 Y:14201436-14201458 AGGAAGGAAAGGAGGGCTGGAGG + Intergenic
1201550385 Y:15211804-15211826 AGGGAGGGAAGGAAGGAAGAAGG + Intergenic
1201891828 Y:18950922-18950944 AGGAAGGGAAGGGGAGCAGAGGG - Intergenic