ID: 1035414134

View in Genome Browser
Species Human (GRCh38)
Location 7:158668379-158668401
Sequence TAATAGGTAAGGAGGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 9, 3: 20, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035414134_1035414141 30 Left 1035414134 7:158668379-158668401 CCCTCCGCCCTCCTTACCTATTA 0: 1
1: 0
2: 9
3: 20
4: 168
Right 1035414141 7:158668432-158668454 ATTCTTTTTTTATAAAATAATGG 0: 1
1: 0
2: 19
3: 249
4: 2561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035414134 Original CRISPR TAATAGGTAAGGAGGGCGGA GGG (reversed) Intronic
905373852 1:37504414-37504436 TAATAGGTAAGGATGAGTGAGGG + Intronic
907746217 1:57216231-57216253 TTATAGGTAAGGAGGCCGAAAGG - Intronic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912753043 1:112301271-112301293 TTATAGGTAAGGAAGCAGGAGGG + Intergenic
913385776 1:118256735-118256757 TAATAGGTAAGGAGACATGAAGG - Intergenic
915775003 1:158473771-158473793 AAAGAGGGAAGGAGGGAGGAAGG - Intergenic
915775012 1:158473806-158473828 AAAGAGGGAAGGAGGGAGGAAGG - Intergenic
915775031 1:158473876-158473898 AAAGAGGGAAGGAGGGAGGAAGG - Intergenic
916399727 1:164433751-164433773 TAATAGAAAAGGAGGGGGCAAGG - Intergenic
916527007 1:165619913-165619935 AAAGAGGGAAGGAGGGAGGAAGG - Intergenic
917234484 1:172875942-172875964 TAATAAATAAGCAGGGCAGAAGG - Intergenic
920173379 1:204085103-204085125 AAATAGGTAAGGAGGAAGGAGGG - Intronic
921598112 1:217076968-217076990 AAATAGGTAAGGGGGGAAGAAGG + Intronic
923276006 1:232396938-232396960 AAAAAGGGAAGGAGGGAGGAAGG + Intergenic
924786145 1:247201861-247201883 TCATAAGAAAGGAGGGGGGAAGG + Intergenic
1063573039 10:7234277-7234299 TAAAAGATAAGGAAGGCGGTAGG - Intronic
1064472690 10:15653174-15653196 TAAGAGGGAGGGAGGGAGGAAGG - Intronic
1065910910 10:30304684-30304706 GAAAAGGTAAGGAAGGAGGAAGG + Intergenic
1070312206 10:75282046-75282068 TAACAGGGAAGGAGCGGGGATGG - Intergenic
1070444424 10:76481813-76481835 TAAGAAGTAAGGATGGCTGATGG - Intronic
1072346132 10:94508664-94508686 TAAGAGGAAAAGATGGCGGAAGG - Intronic
1073813347 10:107176220-107176242 AAACAGGGAAGGAGGGAGGAAGG - Intergenic
1074865630 10:117543077-117543099 AAAAAGGAAAGGAGGGGGGAGGG - Exonic
1077067943 11:652643-652665 AAATAGAGAAGGAGGGCAGAAGG + Intronic
1078106795 11:8362913-8362935 AAAAAGGAAAGGAGGGAGGAAGG - Intergenic
1089526611 11:119101254-119101276 TAAGTGGTGAGGGGGGCGGAGGG + Intronic
1090800902 11:130171259-130171281 TAATAGATAAAGAGGGCAGGAGG - Intronic
1091901959 12:4151518-4151540 AAAGAGGGAAGGAGGGAGGAAGG - Intergenic
1092274441 12:7048473-7048495 TAATAGGTGAGGAGAGGAGAGGG - Intronic
1092822434 12:12365148-12365170 GAATAGGTGAGGAAGGAGGAAGG + Intronic
1096345840 12:50845719-50845741 TAATCAGTAGGGAGGGTGGAGGG - Intronic
1107917667 13:45168978-45169000 AAAGAGGGAAGGAGGGAGGAAGG - Intronic
1111251662 13:85608896-85608918 TAATAGGCAAGAAAGGAGGAAGG - Intergenic
1111446209 13:88348178-88348200 AAAAAGGGAAGGAGGGAGGAAGG + Intergenic
1113796700 13:113062426-113062448 TAGCAGGGAAGGAGGGCGCACGG - Intronic
1113796963 13:113064034-113064056 TAGCAGGGAAGGAGGGCGCACGG + Intronic
1114720620 14:24877520-24877542 AAAGAGGGAAGGAGGGAGGAAGG - Intronic
1115426773 14:33269797-33269819 TAATAGGGAAGCAGGGAGGGGGG + Intronic
1116098168 14:40399238-40399260 TAAAAGGTAAGGAGAGTAGAAGG + Intergenic
1117311179 14:54524781-54524803 TTATAGGGAAGGAGCGGGGAGGG - Intronic
1119176573 14:72572868-72572890 TAAGAGGGAAGGAGGGAGGGAGG + Intergenic
1122040401 14:98983779-98983801 CAATAGGAAGGGAGGGAGGAAGG + Intergenic
1126775155 15:52094155-52094177 AAATAGGTCAGGAGGGAGGCTGG + Intergenic
1126845942 15:52760757-52760779 TCATAGGTAAGGAGGAGGTAGGG + Intronic
1126861617 15:52889607-52889629 TAATAAATAAAGAGGGCAGAAGG + Intergenic
1128737433 15:70061131-70061153 TGATAGGGAAGGAGGGCGTCAGG + Intronic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1132288830 15:100685327-100685349 TACTCAGAAAGGAGGGCGGAAGG + Intergenic
1132422645 15:101686539-101686561 TAATAGGTAGGGAGGGAGAGAGG - Intronic
1134212441 16:12289075-12289097 GAAGAGATAAGGAGGGAGGATGG + Intronic
1136849780 16:33603436-33603458 AAAGAGGAAAGGAGGGAGGAAGG - Intergenic
1138134028 16:54506301-54506323 TAATTGGGAAGGGGGGTGGAGGG - Intergenic
1138391762 16:56675639-56675661 TTACAGGTAATGAGGGGGGAGGG + Intronic
1138486702 16:57349852-57349874 AAAGAGGGAAGGAGGGAGGAGGG - Intergenic
1139210082 16:65068219-65068241 AAAGAGGGAAGGAGGGAGGAAGG + Intronic
1139493966 16:67302681-67302703 TAAAAGGGAAGGAGGGTGGATGG - Intronic
1141711554 16:85702417-85702439 AAAAAGGGAAGGAGGGAGGAAGG - Intronic
1141848699 16:86629395-86629417 TAATAAGTAAAGAGGGTGGGAGG - Intergenic
1203111370 16_KI270728v1_random:1451750-1451772 AAAGAGGAAAGGAGGGAGGAAGG - Intergenic
1143547408 17:7605988-7606010 TAATAGGTTGGGAGAGCTGAGGG - Intronic
1144044293 17:11440936-11440958 CAAGAGGAAAGGAGGGAGGAAGG + Intronic
1144138395 17:12321364-12321386 TAATAGAGATGAAGGGCGGAGGG + Intergenic
1144380177 17:14687182-14687204 GAATAGATAAGGAGGGAGGGAGG + Intergenic
1146299350 17:31676184-31676206 AAAAAGGAAAGGAGGGAGGAAGG + Intergenic
1146582675 17:34052961-34052983 TCAGAGGAAAGGAGGGTGGAAGG - Intronic
1147003447 17:37382311-37382333 GAAAAGGAAAGGAGGGCAGAAGG - Intronic
1148634459 17:49137290-49137312 TAAGAGGTGATGAGGCCGGAAGG + Intronic
1151327630 17:73388832-73388854 GAAAAGGAAAGGAGGGGGGAAGG - Intronic
1151784146 17:76266765-76266787 TAATAGGTAACTAGGGGGGTAGG - Intronic
1155797374 18:30057500-30057522 AAAGAGGGAAGGAGGGAGGAAGG - Intergenic
1156019445 18:32583034-32583056 TAATTGGGAAGCAGGGCGGGGGG - Intergenic
1156355078 18:36333722-36333744 TAATAGGTTAGGAGGGGTGGCGG - Intronic
1159214645 18:65375130-65375152 TCAAAGGGAAGGAGGGAGGAAGG - Intergenic
1164966191 19:32486896-32486918 TAAAAGGAAAGGAGGGAGGGAGG + Intergenic
1165031061 19:32998667-32998689 AAAGAGGAAAGGAGGGAGGACGG + Intronic
1165762435 19:38329568-38329590 AAAGAGGGAAGGAGGGCAGAGGG + Intergenic
925102025 2:1255269-1255291 TAAAAGGAAAGGAAGGCCGAGGG - Intronic
928251596 2:29686001-29686023 TAAAAGGGAAGGAGGGAGGCAGG - Intronic
928990678 2:37230668-37230690 TAGTAAGAAAGGAGGGCCGAGGG - Intronic
929929772 2:46244404-46244426 TAATAAGTAAAGAGGGTGGTAGG - Intergenic
929973018 2:46600206-46600228 TAAGAGGTAAAGAGGCCTGATGG + Intronic
931018200 2:58010737-58010759 TAATAGATAAGGAGTGCTGTGGG - Intronic
932109581 2:68984592-68984614 TAATAGGAGATGAGGGCAGAGGG + Intergenic
933486871 2:82935325-82935347 TAATGAGTAAGGAGGGCAGCTGG - Intergenic
935117336 2:100147547-100147569 AAATGGGCAAGGAGGGAGGAGGG + Intergenic
937230519 2:120395861-120395883 TTAGAGGTGAGGAAGGCGGAGGG - Intergenic
938928243 2:136063820-136063842 TAAGAGGTAATGAGGGGAGAAGG - Intergenic
940552796 2:155182992-155183014 TCAGAGGGAAGGAGGGAGGAGGG + Intergenic
940900821 2:159124859-159124881 TACTTGGTGAGGAGGGCGGGGGG - Intronic
941558669 2:167016752-167016774 AAAGAGGTAAGGAAGGAGGATGG + Intronic
944675478 2:202032127-202032149 TAATAGGTCGAAAGGGCGGAAGG - Intergenic
947488753 2:230575905-230575927 TAATCGGTAAGGCTGGTGGAGGG - Intergenic
1169210950 20:3766093-3766115 GAAGAGGTAGGGAGGGTGGAAGG - Intronic
1169541626 20:6606104-6606126 GAAAAGGGAAGGAGGGCGGGAGG - Intergenic
1170191501 20:13649374-13649396 TAAAAGGGAGGGAGGGAGGAAGG + Intergenic
1173747647 20:45450032-45450054 TATTAGGTAAGGTGGGCGTGGGG + Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1179243762 21:39612848-39612870 TGATAGGTGAGGAGGCCGGCGGG - Intronic
1181844818 22:25698573-25698595 TAAGAGGGAAGGAGTGCTGAGGG + Intronic
1182048538 22:27295928-27295950 TGAAAGGAAAGGAGGGAGGAAGG + Intergenic
1183339375 22:37271197-37271219 TAAAAGGAAAGGAGGAGGGAAGG - Intergenic
1185087159 22:48747030-48747052 TCACAGGCTAGGAGGGCGGAGGG + Intronic
951350328 3:21599758-21599780 CCATAGGTAGGGAGGGAGGAAGG - Intronic
952344163 3:32468541-32468563 AAATAGGGAAGGAGGGAGGAAGG - Intronic
952659653 3:35830146-35830168 TAAGAGGGAAGGAGGGAGCAAGG - Intergenic
955928524 3:64031950-64031972 TTATAGGAAAGGAGGGAGGTAGG - Intergenic
957294174 3:78315089-78315111 TTATAGGTAAGGAAGTGGGACGG + Intergenic
959183682 3:103014601-103014623 TAATAGATAGGGAAGGTGGAAGG + Intergenic
963476348 3:145809715-145809737 TCATAGGTAGGTAGGGCTGAGGG - Intergenic
966403923 3:179575520-179575542 TAATAAGGAGGGAGGGAGGAAGG - Intronic
966472039 3:180300507-180300529 TAAAAGATAAGGAGAGAGGAGGG + Intergenic
967680000 3:192350711-192350733 TAATATGTGAGGAGGGATGAAGG + Intronic
968979263 4:3837804-3837826 TTATAGATAAGGAGGGTGGCTGG - Intergenic
969926304 4:10589119-10589141 TAATAAGTAAAGAGGGTGGGAGG + Intronic
973739043 4:53901768-53901790 TAAAAGGGAAGGAAGGAGGAAGG + Intronic
976465660 4:85365915-85365937 TAAAAGTAAAGGAGGACGGAGGG - Intergenic
977047977 4:92090912-92090934 TAAAAGGCAAGGACGCCGGATGG - Intergenic
978534389 4:109745672-109745694 GAATAGGGAAAGAGGGAGGAGGG + Intronic
984361106 4:178733676-178733698 TAATAGGGAAGGAGCGTGGGAGG - Intergenic
986627017 5:9731602-9731624 TATTAAGTAAGGAGTGCTGAAGG - Intergenic
987087339 5:14483243-14483265 TAATAGGAAAGGAAGACAGAGGG + Intronic
987346996 5:16987841-16987863 TTATGGCTAAGGAGGGGGGAAGG - Intergenic
988424676 5:31049743-31049765 TAGTAGGAAAGGTGGGAGGAAGG - Intergenic
990687502 5:58322693-58322715 AAACAGGAAAGGAGGGCAGAAGG + Intergenic
994269545 5:97760654-97760676 TAATAGGAAATGAGGGGGCAGGG + Intergenic
994772579 5:104002166-104002188 TAATATGCAAGGAGGGCAGCTGG + Intergenic
999663427 5:153889158-153889180 TAACAGGAAAGGAGGGCAGGGGG + Intergenic
999968618 5:156836209-156836231 TAATAGGTATAGAGGGTGAATGG - Intergenic
1000772027 5:165366288-165366310 AAAAAGGGAGGGAGGGCGGAGGG + Intergenic
1003366629 6:5481278-5481300 TAATAGGCAGGGAAGGGGGAGGG + Intronic
1005212591 6:23484746-23484768 TAAAAGGCAAGGAGGGGGAAGGG - Intergenic
1005883392 6:30076232-30076254 TAATAGGTAAGGAAGGAAGATGG - Intergenic
1006734077 6:36259827-36259849 TACTAGGGAGGGAGGGAGGAGGG + Intronic
1007422915 6:41730293-41730315 TTATAGGGAAGGAGTGAGGAAGG + Intronic
1009620672 6:66072013-66072035 TACTAGGAAAGGAGGGAGAAAGG + Intergenic
1010307031 6:74336880-74336902 AAAAAGGAAAGGAGGGGGGAGGG - Intergenic
1013575712 6:111482598-111482620 GAAAAGGCGAGGAGGGCGGAGGG + Intronic
1015158599 6:130126080-130126102 AAAGAGGTAAGGAGGGAGGGAGG - Intronic
1016008556 6:139114511-139114533 TAAGAGGTAAGGAGGGGCCAGGG - Intergenic
1016829497 6:148419571-148419593 AAACAGGACAGGAGGGCGGACGG - Intronic
1017157567 6:151335916-151335938 TAAAAGGGAGGGAGGGTGGAAGG - Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1021294258 7:18884795-18884817 GAATAGGTAAGGAAGGTCGAAGG - Intronic
1021867726 7:24975708-24975730 TAAAAGGTAAGAAGTGCTGAAGG + Intronic
1022062466 7:26811451-26811473 TACTAGGTAAAGAGGGTGTAGGG - Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023700723 7:42889334-42889356 TAAGAGGAAAAGAGGGAGGAGGG - Intergenic
1024122297 7:46257067-46257089 TAATAGGTCAGATGGGCAGATGG - Intergenic
1024424133 7:49206328-49206350 TCATAGGTAAGGAGGAAGGAAGG + Intergenic
1024466165 7:49713446-49713468 TCAGAGGTAAGGAGGGAGGGAGG + Intergenic
1032469303 7:132166657-132166679 GAAAAGGAAAGGAGGGCAGAAGG + Intronic
1033855234 7:145552877-145552899 TAATGGGTACAGAGGGCGGAAGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414134 7:158668379-158668401 TAATAGGTAAGGAGGGCGGAGGG - Intronic
1036227819 8:6974710-6974732 GAATAGGAAATGAGAGCGGATGG + Intergenic
1036230272 8:6993827-6993849 GAATAGGAAATGAGAGCGGATGG + Intergenic
1036232724 8:7012930-7012952 GAATAGGAAATGAGAGCGGATGG + Intronic
1038150399 8:24938258-24938280 AGATAGGGAAGGAGGGCAGAAGG + Intergenic
1038491963 8:27977767-27977789 AATTAGGTAAGGAGGCCGGAAGG - Intronic
1044341552 8:91051651-91051673 AAATAGGAAAGGTGGGTGGAGGG + Intergenic
1045642498 8:104267122-104267144 TAATAGATAAGGAGGCTGAAAGG + Intergenic
1051184417 9:14443267-14443289 TAATAGCTGAGGATGGAGGATGG - Intergenic
1055442610 9:76351676-76351698 AAAGAGGTAGGGAGGGAGGAAGG + Intronic
1057267642 9:93629805-93629827 TACTAGGAAAGCAGGGTGGAGGG - Intronic
1058693528 9:107539483-107539505 TCATAGGTAAGGTGGGGGGCGGG + Intergenic
1058920317 9:109608276-109608298 TAATAGGAAAAAAGGGAGGAGGG - Intergenic
1060018592 9:120109067-120109089 TAATAGGCATAGAGGGCTGAGGG - Intergenic
1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG + Intergenic
1186699213 X:12071280-12071302 TTATAGGCAAGGAGGGAGGGAGG - Intergenic
1187217852 X:17294549-17294571 TAAAAGGAAAGCAGGGCAGAAGG + Intergenic
1192191020 X:68991198-68991220 GAAGAGGGAAGGAGGGAGGAAGG - Intergenic
1192278273 X:69655814-69655836 CAATAGGTAAGGAGGGTGAGAGG + Intronic
1197986716 X:132273840-132273862 TAATGGGTATGGGGGGTGGATGG - Intergenic
1198546260 X:137695740-137695762 TTATAGAGAAGGAGGGCAGAGGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1198768917 X:140107645-140107667 TAATAGGGAAGGAAGGTGGGAGG + Intergenic
1201146181 Y:11066744-11066766 TGAGAGGGAAGGAGGGAGGAGGG + Intergenic